ID: 923331761

View in Genome Browser
Species Human (GRCh38)
Location 1:232931760-232931782
Sequence GCCTCCTTCAAAAGAACCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923331756_923331761 17 Left 923331756 1:232931720-232931742 CCTGCTTTATGGCAGAAATTTAC No data
Right 923331761 1:232931760-232931782 GCCTCCTTCAAAAGAACCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923331761 Original CRISPR GCCTCCTTCAAAAGAACCTA GGG Intergenic
No off target data available for this crispr