ID: 923334197

View in Genome Browser
Species Human (GRCh38)
Location 1:232952710-232952732
Sequence CCCCATTAGGAGTTATTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 250}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923334194_923334197 -2 Left 923334194 1:232952689-232952711 CCTTTTACACATAACTTTTTTCC 0: 1
1: 0
2: 5
3: 52
4: 450
Right 923334197 1:232952710-232952732 CCCCATTAGGAGTTATTGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 250
923334191_923334197 23 Left 923334191 1:232952664-232952686 CCATGCCCTCTAATTTTTTTTTT 0: 1
1: 19
2: 144
3: 1218
4: 8645
Right 923334197 1:232952710-232952732 CCCCATTAGGAGTTATTGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 250
923334193_923334197 17 Left 923334193 1:232952670-232952692 CCTCTAATTTTTTTTTTTTCCTT 0: 1
1: 11
2: 337
3: 2459
4: 19469
Right 923334197 1:232952710-232952732 CCCCATTAGGAGTTATTGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 250
923334192_923334197 18 Left 923334192 1:232952669-232952691 CCCTCTAATTTTTTTTTTTTCCT 0: 1
1: 19
2: 324
3: 9990
4: 28624
Right 923334197 1:232952710-232952732 CCCCATTAGGAGTTATTGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 250
923334190_923334197 26 Left 923334190 1:232952661-232952683 CCACCATGCCCTCTAATTTTTTT 0: 2
1: 30
2: 301
3: 1543
4: 7074
Right 923334197 1:232952710-232952732 CCCCATTAGGAGTTATTGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923334197 Original CRISPR CCCCATTAGGAGTTATTGTC AGG Intronic
901958226 1:12803223-12803245 CCCCATTGGTTGTTTTTGTCAGG + Intergenic
901966221 1:12869123-12869145 CCCCATTGGCTGTTTTTGTCAGG + Intronic
901981610 1:13039375-13039397 CCCCATTGGCTGTTTTTGTCAGG + Intronic
902000471 1:13189538-13189560 CCCCATTGGCTGTTTTTGTCAGG - Intergenic
902019716 1:13335305-13335327 CCCCATTGGCTGTTTTTGTCAGG - Intergenic
904986655 1:34556080-34556102 CCCCATTGGTTGTTTTTGTCAGG - Intergenic
906600672 1:47126221-47126243 CCCCATTTGTTGTTTTTGTCAGG - Intergenic
906792070 1:48667906-48667928 CCCCATGACAAGTCATTGTCTGG - Intronic
906851469 1:49254889-49254911 CCCCATTGCGTGTTTTTGTCAGG - Intronic
907333739 1:53687481-53687503 TTCCATGAGGAGTTATTGTGGGG - Intronic
908898853 1:68932239-68932261 CCCTATTAGGAGTTAGTGCAGGG + Intergenic
909165292 1:72215091-72215113 CCCCATTACTTGTTTTTGTCAGG - Intronic
909230486 1:73082885-73082907 CCCCATTACTTGTTTTTGTCAGG + Intergenic
909874781 1:80788384-80788406 CCCCATTGGTTGTTTTTGTCAGG - Intergenic
910580479 1:88818906-88818928 CCCCATTACTTGTTTTTGTCAGG - Intronic
911983056 1:104589798-104589820 CCCCATTGTGTGTTTTTGTCAGG - Intergenic
916803330 1:168234733-168234755 TTCCATGAGTAGTTATTGTCAGG + Intronic
916827681 1:168458292-168458314 CCCCATTACTTGTTTTTGTCAGG + Intergenic
917400725 1:174646475-174646497 CCCCATTGCTAGTTTTTGTCAGG + Intronic
918389408 1:184042506-184042528 CCCCATTGCTTGTTATTGTCAGG - Intergenic
919457991 1:197842757-197842779 CCTGATTAGGAGTCATTGTGAGG - Intergenic
921735983 1:218629063-218629085 CCCCATTGCTAGTTTTTGTCAGG + Intergenic
922186842 1:223282966-223282988 CCCCATTGCTAGTTTTTGTCAGG - Intronic
923334197 1:232952710-232952732 CCCCATTAGGAGTTATTGTCAGG + Intronic
1068256668 10:54519939-54519961 CCCCATTACTTGTTTTTGTCAGG - Intronic
1068485403 10:57651963-57651985 CCCCATTACTTGTTTTTGTCAGG + Intergenic
1069697437 10:70397219-70397241 CCTCATTTGGAGGTCTTGTCAGG - Intergenic
1071441930 10:85706838-85706860 CCCCATTACTTGTTTTTGTCAGG - Intronic
1071975423 10:90950579-90950601 CCCCATTGCTAGTTTTTGTCAGG + Intergenic
1072324472 10:94284105-94284127 CACCATTAGTAGGTATTGGCTGG - Intronic
1074623505 10:115151978-115152000 CCCCATTAATTGTTTTTGTCAGG + Intronic
1074984716 10:118647580-118647602 CCCCATTGCTAGTTTTTGTCAGG + Intergenic
1079833812 11:25305942-25305964 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1079957956 11:26887371-26887393 CCCCATTGCGTGTTTTTGTCAGG - Intergenic
1080237322 11:30086263-30086285 CCTGATTAGGAGCTGTTGTCAGG + Intergenic
1081409037 11:42733926-42733948 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1082629505 11:55525219-55525241 CCCCATTGCTAGTTTTTGTCAGG + Intergenic
1082684786 11:56224343-56224365 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1083073054 11:60006872-60006894 CCCCATTATTTGTTTTTGTCAGG + Intergenic
1083190341 11:61047315-61047337 GCCCATTAGGAGCATTTGTCAGG - Intergenic
1085884859 11:80509964-80509986 CCCCATTGGTTGTTTTTGTCAGG - Intergenic
1086883289 11:92174290-92174312 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1087403951 11:97705509-97705531 CCCCATTGCTAGTTTTTGTCAGG - Intergenic
1087410101 11:97780723-97780745 CCCCATTGCTAGTTTTTGTCAGG + Intergenic
1087719959 11:101651577-101651599 CCCCACTAGAAGTAATTGCCTGG - Intronic
1090267607 11:125363302-125363324 CCCCATCAGTAGCCATTGTCTGG + Intronic
1091609960 12:1998091-1998113 CAACATGAGGAGTTATTCTCAGG + Intronic
1092309491 12:7337047-7337069 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1092703684 12:11261191-11261213 CCCCATTGCTAGTTTTTGTCAGG - Intergenic
1093089535 12:14905761-14905783 CCCCATTTGTAGGTACTGTCTGG - Intronic
1094337085 12:29371839-29371861 TTCCATTAGTAGTTTTTGTCAGG - Intronic
1095067160 12:37791786-37791808 CCCCATTTGTTGTTTTTGTCAGG - Intergenic
1095488970 12:42713149-42713171 CCCCATTGGTTGTTTTTGTCAGG - Intergenic
1096104775 12:48990676-48990698 CCCCATAAGAAGTCATGGTCTGG + Intergenic
1098148637 12:67523481-67523503 ACCTCTTAGGAGTTGTTGTCAGG + Intergenic
1098234101 12:68401894-68401916 CCCCCATAGCAATTATTGTCAGG - Intergenic
1098733783 12:74070863-74070885 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1099418471 12:82423268-82423290 CCCCATTTGTTGTTTTTGTCAGG - Intronic
1099820689 12:87705540-87705562 CCCCATTACCTGTTTTTGTCAGG - Intergenic
1099962419 12:89409387-89409409 CCCCATTACTTGTTTTTGTCAGG + Intergenic
1100457933 12:94770504-94770526 CCCCATATAGTGTTATTGTCAGG - Intergenic
1106045624 13:26138335-26138357 CCCCTTTAGTATTTATTGTAGGG - Intronic
1107451231 13:40511942-40511964 CCCCATTGCTTGTTATTGTCAGG + Intergenic
1108998745 13:56768083-56768105 CCCCATTGGTTGTTTTTGTCAGG - Intergenic
1109565903 13:64116157-64116179 CCCCATTTGTTGTTTTTGTCAGG + Intergenic
1109943153 13:69397436-69397458 CCCCATTACTTGTTTTTGTCTGG + Intergenic
1112856316 13:103773964-103773986 CTCCTTGAGGAGTTATGGTCAGG - Intergenic
1114923029 14:27358808-27358830 CCCCATTTGTTGTTTTTGTCAGG + Intergenic
1115412626 14:33092845-33092867 CCCCATTTGTTGTTTTTGTCAGG - Intronic
1115832618 14:37359098-37359120 CCCCATTGCTAGTTTTTGTCAGG + Intronic
1116008985 14:39328730-39328752 CCCCATTGGTTGTTTTTGTCAGG + Intronic
1116679010 14:47942061-47942083 CCCCATTTTTAGTTTTTGTCAGG - Intergenic
1118829534 14:69417236-69417258 CCCCATTTCTTGTTATTGTCAGG + Intronic
1120777831 14:88456989-88457011 CCCCATTTGTTGTTTTTGTCAGG + Intronic
1122767329 14:104081489-104081511 CCCCACGCGGAGTTGTTGTCAGG + Intergenic
1125211887 15:37226510-37226532 CCCCATTGCTAGTTTTTGTCAGG + Intergenic
1125363783 15:38891865-38891887 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1126863138 15:52906915-52906937 CCCCATTGCTTGTTATTGTCAGG - Intergenic
1126948710 15:53854559-53854581 CCCCATTAATTGTTTTTGTCCGG + Intergenic
1128012635 15:64312481-64312503 CCCCATTTCTGGTTATTGTCAGG - Intronic
1128352076 15:66897714-66897736 CTCCATTAGGAGTAATTGGCTGG - Intergenic
1134628812 16:15742000-15742022 CCCCACTAGGGGATATTGTCTGG + Intronic
1136659858 16:31748255-31748277 CCCCATTTCTAGTTTTTGTCAGG + Intronic
1140030407 16:71333112-71333134 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1140129432 16:72147250-72147272 CCCCATTGGTTGTTTTTGTCAGG - Intronic
1140178811 16:72693287-72693309 CCCCATTGGTTGTTTTTGTCAGG + Intergenic
1141730373 16:85818753-85818775 CCCCATTTTTTGTTATTGTCAGG - Intergenic
1145396074 17:22496080-22496102 CCCCATTTGGGGGTACTGTCAGG + Intergenic
1152909158 17:82988233-82988255 CCCCATTACTTGTTTTTGTCAGG - Intronic
1203168081 17_GL000205v2_random:117303-117325 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1154364499 18:13694593-13694615 CCCCATTTCTAGTTTTTGTCAGG - Intronic
1156529499 18:37801154-37801176 CCCCATTACTGGTTTTTGTCAGG + Intergenic
1159632756 18:70767891-70767913 CCCCATTGGTTGTTTTTGTCAGG - Intergenic
1161603664 19:5202103-5202125 CCCAATTAAGAGTTATTTCCAGG + Intronic
1162049891 19:8026739-8026761 CACCCATAGGAGTTATGGTCAGG + Intronic
1162632158 19:11936952-11936974 CCCCATTTGTTGTTTTTGTCAGG + Intronic
1162632424 19:11939490-11939512 CCCCATTTGTTGTTTTTGTCAGG + Intronic
1164357704 19:27461374-27461396 CCCCCTTACTAGTTTTTGTCAGG + Intergenic
927952445 2:27181452-27181474 CACCATTAGAAGTCAGTGTCAGG - Intergenic
928061607 2:28118987-28119009 CCCCATTACATGTTTTTGTCAGG + Intronic
932441653 2:71741002-71741024 CCCCATTACTTGTTTTTGTCAGG - Intergenic
932814076 2:74847845-74847867 CCCCAGTAAGGGTTAGTGTCAGG - Intronic
933046547 2:77545070-77545092 CCCCATTGCGTGTTTTTGTCAGG - Intronic
933557543 2:83849718-83849740 CCCCATTACTTGTTTTTGTCAGG + Intergenic
935399883 2:102649200-102649222 CCCCATTACTTGTTTTTGTCAGG - Intronic
935523952 2:104143221-104143243 TCCCATTTGGAGTTATTTTATGG + Intergenic
937645352 2:124260243-124260265 CCCCATTTCTAGTTCTTGTCCGG - Intronic
937838579 2:126499261-126499283 CCCCCTTAGTATTTATTGTAGGG - Intergenic
940323858 2:152404481-152404503 CCCCATTACGAGTAATTCTGAGG - Intronic
940448870 2:153813480-153813502 CCCCATTATGAGTTATGGAGAGG + Intergenic
943704936 2:191024456-191024478 CTGCATTAGCAGTTCTTGTCTGG - Intergenic
945391115 2:209266246-209266268 CCCCATTTGTTGTTTTTGTCAGG - Intergenic
945700379 2:213161897-213161919 CTCAATTAGGAGTCATTGTACGG - Intergenic
946502313 2:220262587-220262609 CTCCATTAGGATTTTTTTTCTGG + Intergenic
947033918 2:225829428-225829450 CCCCATTGCTAGTTTTTGTCAGG - Intergenic
947980390 2:234403681-234403703 CCTCATTTGGGGTTATTGTGAGG + Intergenic
1171007522 20:21481259-21481281 CCCCATTTGTTGTTTTTGTCAGG + Intergenic
1172208210 20:33179723-33179745 CCCCATAAGCAGTTCTGGTCAGG + Intronic
1176325452 21:5444628-5444650 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1176333467 21:5573319-5573341 CCCCATTACTTGTTTTTGTCAGG + Intergenic
1176394290 21:6247633-6247655 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1176403676 21:6341834-6341856 CCCCATTACTTGTTTTTGTCAGG + Intergenic
1176433481 21:6647270-6647292 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1176467129 21:7068541-7068563 CCCCATTACTTGTTTTTGTCAGG + Intronic
1176490690 21:7450319-7450341 CCCCATTACTTGTTTTTGTCAGG + Intergenic
1176509952 21:7688064-7688086 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1179453241 21:41479895-41479917 CCCCGTTAGGAATCACTGTCAGG + Intronic
1180317941 22:11293133-11293155 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1180599366 22:17005725-17005747 CCCCATTGCTAGTTTTTGTCAGG - Intronic
1182806699 22:33078061-33078083 CACCATTACCAGTTATTTTCTGG - Intergenic
1183046863 22:35227386-35227408 CTCAATTAGGAGTTATGGCCTGG + Intergenic
949297942 3:2548439-2548461 CCCCATTGGTTGTTTTTGTCAGG + Intronic
950815626 3:15699117-15699139 CCCCATTGCTAGTTTTTGTCAGG - Intronic
951628628 3:24694383-24694405 CCCCATTGCAAGTTTTTGTCAGG + Intergenic
953623483 3:44552159-44552181 CCACATCAAGAGTTAGTGTCAGG + Intergenic
954484263 3:50832088-50832110 CCCCATTACTTGTTTTTGTCAGG - Intronic
955898082 3:63722208-63722230 CCCCATTGGTTGTTTTTGTCAGG - Intergenic
955937716 3:64118079-64118101 CCCCATTACTTGTTTTTGTCAGG - Intronic
956079484 3:65542629-65542651 CCCCATTGTGTGTTTTTGTCAGG - Intronic
957475297 3:80714621-80714643 CCCCATTGGTTGTTTTTGTCAGG - Intergenic
957594583 3:82246076-82246098 CTCCATTAGGAAAGATTGTCAGG + Intergenic
957844688 3:85716761-85716783 CCCCATTGCTAGTTTTTGTCAGG + Intronic
958027756 3:88069119-88069141 CCCCATCAGAAGTGATTCTCAGG + Intronic
958261053 3:91381917-91381939 CTCCATTAGGAGCTCTTGTAAGG + Intergenic
964007339 3:151847526-151847548 CCCCATTACTTGTTCTTGTCAGG + Intergenic
966078402 3:175967766-175967788 CCCCATTACTTGTTTTTGTCAGG - Intergenic
966137033 3:176710420-176710442 CCCCATTTCGTGTTTTTGTCAGG - Intergenic
967338810 3:188373972-188373994 CCCCATTATTTGTTTTTGTCAGG + Intronic
967985470 3:195092405-195092427 CCCCATTACTTGTTTTTGTCAGG - Intronic
970181938 4:13407271-13407293 CCCCATTACTTGTTTTTGTCAGG + Intronic
970927207 4:21466717-21466739 CCCCATTAGGAGACGTTATCTGG - Intronic
971429105 4:26545082-26545104 CCCCATTACTTGTTTTTGTCAGG + Intergenic
971429618 4:26551821-26551843 CCCCATTGCCAGTTTTTGTCAGG + Intergenic
971723171 4:30273360-30273382 CCCCATTGCTTGTTATTGTCAGG + Intergenic
974085693 4:57258463-57258485 CCCCATTACTTGTTTTTGTCAGG + Intergenic
974836196 4:67253893-67253915 CCCCATTGGTTGTTTTTGTCAGG + Intergenic
977164800 4:93681656-93681678 CCCCATTGGTTGTTTTTGTCAGG - Intronic
977168100 4:93726249-93726271 CCCCATTGGTTGTTTTTGTCAGG + Intronic
977828165 4:101557868-101557890 CCCCATTACTTGTTATTGTCAGG + Intronic
980151217 4:129050989-129051011 CCCCATTACTTGTTTTTGTCAGG + Intronic
980504006 4:133691255-133691277 CCCCATTGGTTGTTTTTGTCAGG + Intergenic
985344159 4:188985447-188985469 GCCCAGTAGGAGTGAGTGTCAGG - Intergenic
986453299 5:7888959-7888981 AGCCACTAGGAGCTATTGTCAGG - Intronic
987880277 5:23735193-23735215 CCCCATTTGTTGTTTTTGTCAGG - Intergenic
988389819 5:30613091-30613113 CCCCATTGCGTGTTTTTGTCAGG + Intergenic
988918171 5:35916590-35916612 CCCCATTACTTGTTTTTGTCAGG - Intronic
989672323 5:43933133-43933155 CCCCATTATTTGTTTTTGTCAGG + Intergenic
990223856 5:53627145-53627167 CCCCATTGCGTGTTTTTGTCAGG + Intronic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
990993706 5:61710281-61710303 CCCCATTGGTTGTTTTTGTCAGG - Intronic
991280403 5:64906931-64906953 CCCCATTTTGTGTTTTTGTCAGG + Intronic
991985018 5:72276291-72276313 CCCCATTACTTGTTTTTGTCAGG - Intronic
995668242 5:114569053-114569075 CCCCATTACTTGTTTTTGTCAGG - Intergenic
995828854 5:116331770-116331792 CCCCATTTGTTGTTTTTGTCAGG + Intronic
995963613 5:117875984-117876006 CCCCATTGGTTGTTTTTGTCAGG + Intergenic
998220380 5:140273309-140273331 CCCCATTTGGAGGTGATGTCAGG - Intronic
998759637 5:145418617-145418639 CCCCATTGGTTGTTTTTGTCAGG - Intergenic
999371116 5:151055968-151055990 CCCCATTCGGAGTTCATGACGGG - Intronic
1000061807 5:157664320-157664342 CCCCATTTCTAGTTTTTGTCAGG - Intronic
1000194552 5:158945336-158945358 CCCCATTACTTGTTTTTGTCAGG + Intronic
1000376482 5:160587220-160587242 CCCCATTGCTAGTTTTTGTCTGG + Intronic
1000377546 5:160597271-160597293 CCCCATTGCTAGTTTTTGTCAGG - Intronic
1001372189 5:171216166-171216188 CTCCATTGGTTGTTATTGTCAGG + Intronic
1002119263 5:176989116-176989138 CCCCCTTAGGAGTAATTGAATGG - Intronic
1002791758 6:442140-442162 CCCCATCATGAGTAAGTGTCTGG - Intergenic
1004326081 6:14675116-14675138 CCTCACTAGGAGTTACTGTTAGG - Intergenic
1005347349 6:24903716-24903738 CCACATTAGAAGTTACTCTCTGG - Intronic
1008350812 6:50487928-50487950 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1008994109 6:57638227-57638249 CTCCATTAGGAGCTCTTGTAAGG - Intronic
1009182717 6:60537323-60537345 CTCCATTAGGAGCTCTTGTAAGG - Intergenic
1009661813 6:66622302-66622324 CCCCATTGGATGTTTTTGTCAGG - Intergenic
1009724131 6:67514554-67514576 CCCCATTGTTAGTTTTTGTCAGG + Intergenic
1010459890 6:76102263-76102285 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1010923256 6:81711115-81711137 CCCCATTGCTTGTTATTGTCAGG - Intronic
1011316227 6:86034650-86034672 CCCCATTGCTAGTTTTTGTCAGG - Intergenic
1012152769 6:95776030-95776052 CCCCATTAATTGTTTTTGTCAGG + Intergenic
1013103596 6:107008108-107008130 GCCCACTAGGAGCTACTGTCTGG - Intergenic
1013669685 6:112386511-112386533 CCCCATTGGTTGTTTTTGTCAGG - Intergenic
1014180569 6:118379895-118379917 CCCCATTGCTAGTTTTTGTCAGG - Intergenic
1017291547 6:152744070-152744092 CCCCATGAGGATTTGGTGTCTGG + Intergenic
1017987062 6:159453274-159453296 CCCCATTGCGTGTTTTTGTCAGG - Intergenic
1024183684 7:46925393-46925415 CCCCATTGGCTGTTTTTGTCAGG + Intergenic
1024352095 7:48376939-48376961 CCCCACTAGGAGTGACTTTCTGG - Intronic
1024440463 7:49410199-49410221 CCCCATAAGAATTTACTGTCAGG - Intergenic
1028081750 7:86585924-86585946 CCCCATTGTGTGTTTTTGTCAGG + Intergenic
1028507673 7:91588013-91588035 CCCCATTGGTTGTTTTTGTCAGG - Intergenic
1031651741 7:124299958-124299980 CCCCATTACTTGTTTTTGTCAGG + Intergenic
1036737775 8:11333487-11333509 CCCCTTTAGCATTTCTTGTCAGG - Intergenic
1037685338 8:21134218-21134240 CCCCATTACTTGTTTTTGTCAGG + Intergenic
1038105023 8:24423157-24423179 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1040766471 8:50917191-50917213 CCCCATTTCTAGTTTTTGTCAGG + Intergenic
1043734534 8:83727068-83727090 CCCCATTACTTGTTTTTGTCAGG + Intergenic
1044632655 8:94294371-94294393 CCCCATTGCTAGTTTTTGTCAGG - Intergenic
1045088640 8:98715008-98715030 CCCCATTTGTTGTTTTTGTCAGG - Intronic
1045134842 8:99204235-99204257 CCCCATTGCTAGTTTTTGTCGGG - Intronic
1046254176 8:111674542-111674564 CCCCATTGCTAGTTTTTGTCAGG + Intergenic
1047116178 8:121844017-121844039 CCCAAGTATGAGTTATTGTCAGG + Intergenic
1051808327 9:21022106-21022128 CCCCATTTGTTGTTTTTGTCAGG - Intronic
1051939301 9:22485610-22485632 CCCCATTGCTAGTTTTTGTCAGG - Intergenic
1052060959 9:23960887-23960909 CCCCATTGGCTGTTTTTGTCAGG + Intergenic
1052146705 9:25059413-25059435 CCCCATTAATTGTTTTTGTCAGG + Intergenic
1052479868 9:29009906-29009928 CCCCATTTCTAGTTTTTGTCAGG - Intergenic
1057284073 9:93734574-93734596 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1203428230 Un_GL000195v1:61903-61925 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1203438055 Un_GL000195v1:161400-161422 CCCCATTACTTGTTTTTGTCAGG + Intergenic
1203366171 Un_KI270442v1:258894-258916 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1186040550 X:5472974-5472996 CCCTATTATGTGTTTTTGTCAGG - Intergenic
1187837956 X:23454993-23455015 CCCCATCACGTGTTTTTGTCAGG + Intergenic
1190623084 X:52308192-52308214 CCCCATTTCTAGTTTTTGTCAGG - Intergenic
1190979957 X:55448132-55448154 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1191028462 X:55941246-55941268 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1191156390 X:57278304-57278326 CCCCATTTCTTGTTATTGTCAGG - Intergenic
1191655447 X:63592058-63592080 CCCCATTACTTGTTTTTGTCAGG + Intergenic
1191681352 X:63843503-63843525 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1191685029 X:63880739-63880761 CCCCATTACTTGTTTTTGTCAGG + Intergenic
1192180726 X:68914125-68914147 CCCCACTATGGGTTATTGTGAGG - Intergenic
1192898099 X:75465674-75465696 CCCCATTGCTAGTTTTTGTCAGG - Intronic
1192914996 X:75642597-75642619 CCCCATTACTTGTTTTTGTCAGG + Intergenic
1192992548 X:76476098-76476120 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1192998343 X:76536454-76536476 CCCCATTTCTAGTTTTTGTCAGG + Intergenic
1193072767 X:77323744-77323766 CCCCATTTCTAGTTTTTGTCAGG - Intergenic
1193189962 X:78559083-78559105 CCCCATTTCTAGTTTTTGTCAGG + Intergenic
1193316837 X:80074889-80074911 CCCCATTTCTAGTTTTTGTCAGG - Intergenic
1193609346 X:83610232-83610254 CCCCATTACTTGTTTTTGTCAGG + Intergenic
1193618435 X:83719483-83719505 CCCCATTACTTGTTTTTGTCAGG - Intergenic
1194130546 X:90075505-90075527 GCCAATTAGAAGTTATTGCCTGG + Intergenic
1194444531 X:93971754-93971776 CCCCATTACTTGTTTTTGTCAGG + Intergenic
1195817900 X:108908511-108908533 CCCCATTTCTTGTTATTGTCAGG - Intergenic
1195827703 X:109020584-109020606 CCCCATTACTTGTTTTTGTCAGG + Intergenic
1195993321 X:110705415-110705437 CCCCATTACTTGTTTTTGTCAGG - Intronic
1196096290 X:111804115-111804137 CCCCATTACTTGTTTTTGTCAGG + Intronic
1196151971 X:112384472-112384494 CCCCATTACTTGTTTTTGTCAGG + Intergenic
1196218601 X:113085320-113085342 CCCCATTGTGTGTTTTTGTCAGG + Intergenic
1197157943 X:123290816-123290838 CTCCATTTGGAATTATTGTAGGG - Intronic
1198753978 X:139963789-139963811 CCCCATTACTTGTTTTTGTCAGG - Intronic
1198922340 X:141744269-141744291 CCCCATTGGTTGTTTTTGTCAGG - Intergenic