ID: 923334742

View in Genome Browser
Species Human (GRCh38)
Location 1:232958412-232958434
Sequence CTGAATGTCAAGGAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 295}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923334742_923334745 3 Left 923334742 1:232958412-232958434 CCTCTCTGCTCCTTGACATTCAG 0: 1
1: 0
2: 0
3: 38
4: 295
Right 923334745 1:232958438-232958460 TCAGCTGAAGTATGTAGTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 141
923334742_923334746 14 Left 923334742 1:232958412-232958434 CCTCTCTGCTCCTTGACATTCAG 0: 1
1: 0
2: 0
3: 38
4: 295
Right 923334746 1:232958449-232958471 ATGTAGTGGTGGTTGCCCAAAGG 0: 1
1: 0
2: 0
3: 4
4: 117
923334742_923334744 0 Left 923334742 1:232958412-232958434 CCTCTCTGCTCCTTGACATTCAG 0: 1
1: 0
2: 0
3: 38
4: 295
Right 923334744 1:232958435-232958457 AGCTCAGCTGAAGTATGTAGTGG 0: 1
1: 0
2: 0
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923334742 Original CRISPR CTGAATGTCAAGGAGCAGAG AGG (reversed) Intronic
900969447 1:5981281-5981303 CTGGATGTGAAGTAGCATAGAGG - Intronic
901718822 1:11178629-11178651 CTGGATGTGAAGAAGCAGAAAGG - Intronic
901720238 1:11191562-11191584 CTAAATATCAAAGAGCATAGTGG - Intronic
901762016 1:11478016-11478038 CTAAATGTCAGGGTGCTGAGTGG - Intergenic
903541380 1:24098287-24098309 CTGACTGTGGAGGATCAGAGAGG + Intronic
904296993 1:29526230-29526252 CAGAATGTACAGGAGGAGAGTGG + Intergenic
905204795 1:36337254-36337276 CTGCCTGTCAAGGAGCAGCCTGG + Intergenic
905784177 1:40739750-40739772 GTAAAAGTCAAGGAGCACAGAGG + Intronic
907199492 1:52714244-52714266 GAGGATGTCAAGGAGCAGAAAGG + Intergenic
910535644 1:88294589-88294611 AAGCATGTCAAGGGGCAGAGCGG - Intergenic
913088746 1:115461747-115461769 CTGACTGTCCACCAGCAGAGGGG + Intergenic
915554661 1:156654690-156654712 TTGAATGGGAAGGAGCAGAAAGG + Intronic
915677149 1:157542494-157542516 CTCAATTTCCAGGAGCACAGAGG - Intronic
916184493 1:162117586-162117608 CTGAAAGACAAGGAGGAGTGAGG - Intronic
918792225 1:188843344-188843366 CTGAATTTCCAGGACCAGATGGG - Intergenic
921600952 1:217105723-217105745 CTGATTGTCCAGGTGCAGAATGG - Intronic
922364633 1:224852195-224852217 CCGAAGGCAAAGGAGCAGAGGGG + Intergenic
922608835 1:226909153-226909175 CTGAGTCTCAAGGGGGAGAGTGG + Intronic
922826064 1:228520026-228520048 CTGCATGTCACGTGGCAGAGAGG + Intergenic
922861339 1:228818883-228818905 CTGGATGGCCAGCAGCAGAGAGG + Intergenic
923334742 1:232958412-232958434 CTGAATGTCAAGGAGCAGAGAGG - Intronic
923726106 1:236506823-236506845 CAGTATGTTAATGAGCAGAGGGG + Intergenic
924121053 1:240798512-240798534 GAGAATGTCAAAGAGCAGGGTGG + Intronic
1062939480 10:1410703-1410725 CTGAAAGTGAAGGAGGACAGGGG - Intronic
1064240315 10:13621490-13621512 CTGAAGGCAAAGGAGGAGAGTGG - Intronic
1067182305 10:43997554-43997576 CTGAAGGTCAAAGAGCTCAGTGG - Intergenic
1067666714 10:48285451-48285473 CTGAATGTCGGGGAGGAGTGGGG - Intergenic
1070557121 10:77537237-77537259 CTGAAATTAAAGGAGCAGGGGGG - Intronic
1070700707 10:78599792-78599814 CTGAATTGCTAGGAGAAGAGAGG - Intergenic
1073230717 10:101967380-101967402 CTCACTGTCAATCAGCAGAGTGG + Intronic
1075102735 10:119517647-119517669 GTGAATGTCAAGGGGAGGAGGGG - Intronic
1075222982 10:120600681-120600703 CTGAATTTCAGGAAACAGAGAGG + Intergenic
1077607711 11:3623169-3623191 CTGGAGGTCATGGAGCAGAAAGG + Intergenic
1078491566 11:11774085-11774107 CTGAAGCTCAAGGAGGTGAGGGG - Intergenic
1080328201 11:31103144-31103166 GTGATTGTCCAGGAGCAGATTGG - Intronic
1080765591 11:35293920-35293942 ATGTATGTCAAGGCTCAGAGCGG + Intronic
1080785616 11:35472675-35472697 GTGAAGGTCATGGGGCAGAGTGG + Intronic
1081448934 11:43154576-43154598 CCGAATATCCAGGAGAAGAGAGG + Intergenic
1083915527 11:65740889-65740911 CTCAATATCAAGGGGCAGAGGGG + Intergenic
1084922016 11:72478711-72478733 CTGAATGTGAAAGGGCAGAGGGG + Intergenic
1087597400 11:100271751-100271773 TTCAAAGTCAAGGAGCAGATTGG - Intronic
1088091295 11:106043052-106043074 CTGTGAGTCAAGGAGCAAAGGGG + Intergenic
1088360807 11:108987150-108987172 CTGGAAGTGTAGGAGCAGAGAGG + Intergenic
1088792870 11:113241651-113241673 CTGAATGTGCAGGAGTAGAAGGG + Intronic
1088853113 11:113721718-113721740 CTGAATGTGCAGGAAGAGAGAGG - Intergenic
1089082527 11:115788730-115788752 CTGTATGGCAAGGAACTGAGGGG + Intergenic
1089647301 11:119888792-119888814 AAGAATGCCAAGGAGCAGAGAGG + Intergenic
1089741931 11:120590471-120590493 CTGGATGTCAGGGTGCAGGGAGG - Intronic
1089763501 11:120746263-120746285 CTCAAGGTCAAAGAGCAAAGAGG - Intronic
1089825239 11:121269280-121269302 CTGAATGACAAGGACAAAAGGGG + Intergenic
1090502539 11:127275525-127275547 TGGAATGTGCAGGAGCAGAGAGG - Intergenic
1091716442 12:2780670-2780692 CAGAATGTAAAGGAATAGAGGGG + Intergenic
1091981346 12:4866622-4866644 CTGCCTGTCCAGGTGCAGAGTGG + Intergenic
1092244530 12:6856232-6856254 CTGAAGGCCAAGGGGAAGAGGGG + Intronic
1096544267 12:52327011-52327033 CAGAATGGCAAGGATCAGAAAGG + Intergenic
1098894111 12:76038056-76038078 CTGGATGAAATGGAGCAGAGAGG + Exonic
1099472253 12:83065737-83065759 CTGACTCTCAAGGACTAGAGGGG + Intronic
1099721750 12:86370975-86370997 CTATATGTATAGGAGCAGAGAGG + Intronic
1100984522 12:100191413-100191435 CTGAGGGGCAAGGAGCTGAGAGG - Intergenic
1101498520 12:105279010-105279032 CAGAAAGTCAAGGAGGTGAGGGG - Intronic
1101613017 12:106309378-106309400 CTGAAGGGCAAGGAGTGGAGTGG - Intronic
1102143102 12:110633133-110633155 CTGAATGGAGAGGAGCATAGGGG - Intronic
1103184612 12:118945696-118945718 CTGAAATTCAAGAAGCAGAGGGG - Intergenic
1103251442 12:119503313-119503335 CAGAATGACAAAGAGTAGAGGGG + Intronic
1104267703 12:127251929-127251951 CTGAAGGACAATAAGCAGAGAGG - Intergenic
1104387673 12:128365027-128365049 CTGGTTGTTAAGGAACAGAGAGG - Intronic
1104983264 12:132583203-132583225 GTGAAGGTCAAGGAGGAGCGCGG + Exonic
1105424673 13:20284202-20284224 CTGGATAGGAAGGAGCAGAGGGG - Intergenic
1106013794 13:25849082-25849104 CTGAAGGGAAAGGAGGAGAGAGG + Intronic
1108000370 13:45900585-45900607 CTAGATGTCCAGGAGCAAAGAGG + Intergenic
1108246340 13:48518015-48518037 CTGGAAGTCAAGGAGCAGCAAGG + Intronic
1110212137 13:72986298-72986320 ATGAATGTCAGAAAGCAGAGTGG + Intronic
1111331613 13:86765567-86765589 CTGCCTGTCAAGGAGCAGCCTGG - Intergenic
1111518379 13:89364569-89364591 CTGAATGTCAGTTAGCTGAGAGG - Intergenic
1112220810 13:97487922-97487944 TAGAATGACATGGAGCAGAGAGG - Intergenic
1112762222 13:102704324-102704346 CTTATAGTCAAGGAGCAGGGAGG + Intergenic
1112941072 13:104862472-104862494 GAGAATGTGAAGGATCAGAGAGG + Intergenic
1113761702 13:112852588-112852610 CTGTCTGTCCAGGAGAAGAGGGG + Intronic
1114883757 14:26821371-26821393 CTGTATGGCAAGGAGCACAATGG + Intergenic
1116024500 14:39498395-39498417 CTGAAGGTCCTTGAGCAGAGGGG + Intergenic
1116825888 14:49673082-49673104 CTGGATGTGAAGGAGAAGGGAGG - Intronic
1118110364 14:62711682-62711704 GTGAAGGGCAAGGAGCAAAGAGG - Intronic
1118316951 14:64731347-64731369 CTGAATCTCCTGCAGCAGAGGGG - Exonic
1118874689 14:69773834-69773856 CTGATTGTCTAGGGGTAGAGGGG - Intergenic
1118897317 14:69955890-69955912 GTGAAGGTAAAGGAGGAGAGTGG + Intronic
1119031556 14:71196838-71196860 CTGACTGTCAAGGAGCTGAAGGG - Intergenic
1119157300 14:72422853-72422875 CTGCAAGTCAAGGAGCACCGAGG + Intronic
1119936185 14:78594257-78594279 CTGAAGGACAAGGCGCCGAGGGG + Intronic
1120823060 14:88930775-88930797 CAGATTGTCAAGGAGCAGGCTGG + Intergenic
1121906652 14:97752144-97752166 CTGAGGGTCATGGAGCAGACAGG - Intronic
1124021780 15:25931986-25932008 CTGAATGTCAACAAGCAGTTTGG - Intergenic
1124260160 15:28182420-28182442 CTGAATGACAAGGACCAGCTGGG - Exonic
1125551068 15:40545185-40545207 CAGAATGCCAAGGTGCAGTGTGG - Intronic
1125769344 15:42154532-42154554 CAGAAGGGGAAGGAGCAGAGTGG + Intronic
1128479732 15:68026827-68026849 CTGAATATTGAGGAGCAGAGAGG + Intergenic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128544957 15:68560693-68560715 CTGACCAGCAAGGAGCAGAGAGG - Intergenic
1129889738 15:79063975-79063997 CTGAGTGTCAAAGTTCAGAGAGG + Intronic
1130010445 15:80149065-80149087 CTGTATTTCTGGGAGCAGAGTGG + Intergenic
1130094770 15:80847766-80847788 CAGAATGTCAAAGTGCAGAAGGG + Intronic
1130956624 15:88631326-88631348 GTGATTGTCAAAGAGCTGAGGGG - Exonic
1132746056 16:1436782-1436804 CCGAATGGGAAGGTGCAGAGAGG - Exonic
1133560333 16:6944716-6944738 ATGTATGTCAAGGGGCAGAAAGG - Intronic
1133613054 16:7451056-7451078 CTGAGTGACAAGGAGGAGACTGG + Intronic
1134244769 16:12531670-12531692 CTGAATATCTGGGTGCAGAGAGG + Intronic
1135523836 16:23198296-23198318 CTGAATGGCAAGATGAAGAGTGG + Intronic
1138531132 16:57635012-57635034 CTGGATGGGAGGGAGCAGAGGGG + Intronic
1138543277 16:57701397-57701419 CTGAATGCAAAGGAGAAAAGAGG - Intronic
1138566728 16:57838948-57838970 CTGACTAGCAAGGTGCAGAGTGG + Intronic
1140074676 16:71686569-71686591 CTGACTGTAAAGGAGCACAGAGG - Intronic
1140858476 16:78998785-78998807 CTGAAGGTCAAGGATCAGACTGG - Intronic
1142314479 16:89334940-89334962 CAGACAGTCAAGCAGCAGAGTGG + Intronic
1203141053 16_KI270728v1_random:1766200-1766222 ATCTATGTCAATGAGCAGAGAGG + Intergenic
1142589918 17:998883-998905 CTGAAAGACATGGGGCAGAGAGG + Exonic
1142598002 17:1038982-1039004 CTGAATGCCACGGACCCGAGAGG + Intronic
1142682872 17:1560813-1560835 CTGGATGTCAAGAAACAGAGGGG + Intronic
1143511944 17:7401228-7401250 CTGAAAGGAAAGGAACAGAGAGG - Intronic
1149160387 17:53686750-53686772 CTGGATGACAAGCTGCAGAGAGG - Intergenic
1150921265 17:69486108-69486130 CTGCATGTGAAGGAGAAGTGGGG + Intronic
1151548236 17:74806403-74806425 CTGGATGTCAAGGAGGAGGGAGG - Intronic
1151957336 17:77386968-77386990 CTGAAGGTTAAGCAGAAGAGTGG + Intronic
1153278930 18:3395902-3395924 CTAAATGTCAAAAAACAGAGTGG + Intergenic
1153744830 18:8167066-8167088 CTTAAGGTCAGGAAGCAGAGAGG + Intronic
1154203211 18:12314325-12314347 CTGAACCTCAAGGAGAAGACTGG - Intronic
1155240390 18:23858895-23858917 CTGCAGGCCAAGGAGCAGCGAGG - Intronic
1155329317 18:24698760-24698782 CTGCAAGCCAAGGAGGAGAGAGG + Intergenic
1158658657 18:59364661-59364683 CAGAAGGACAAGGAGCAGATTGG - Intergenic
1160007102 18:75075602-75075624 CAGCATGTCCAGGAGCAGAGGGG - Intergenic
1160010665 18:75105331-75105353 CTGAATGGCGTGGAGCAGAGAGG + Intergenic
1160047333 18:75399158-75399180 CTGAAAGTAAAGGAAGAGAGAGG + Intergenic
1161953838 19:7482212-7482234 CTGCAGGACCAGGAGCAGAGGGG + Intronic
1162230612 19:9262836-9262858 CTGCATGTCCAGGAGCAGTATGG - Intergenic
1162786334 19:13037190-13037212 CTGTGTGTCAGGGAGAAGAGGGG + Intronic
1164136227 19:22418955-22418977 CTGAATGTTAAGGAGCCTATGGG - Intronic
1164769050 19:30794184-30794206 CTTAATATCAAAGATCAGAGAGG - Intergenic
1165473549 19:36016865-36016887 CTGAATGTCACATAGGAGAGGGG + Intronic
1166567880 19:43776236-43776258 CTGAGTGCCTGGGAGCAGAGTGG + Intronic
1166852345 19:45766792-45766814 CTGAGGGTCCAGGACCAGAGAGG + Exonic
1167015741 19:46839820-46839842 CTGACTCTCCAGGATCAGAGGGG - Intronic
1167168181 19:47813575-47813597 GGGAATGCCAAGGGGCAGAGAGG - Intronic
1167886024 19:52500730-52500752 ATGTATGTCAGGGAGCAGAGGGG + Intronic
1167888052 19:52518111-52518133 ATGTATGTCAGGGAGCAGAGCGG + Intergenic
1167916407 19:52743502-52743524 ATGTATGTCAGGGAGCAGAGTGG - Intergenic
1167920545 19:52779690-52779712 ATCTATGTCAGGGAGCAGAGGGG - Intronic
1167922374 19:52792369-52792391 ATCTATGTCAGGGAGCAGAGGGG - Intronic
1168605396 19:57755376-57755398 CTGATTTTGAAGGAGCATAGAGG - Exonic
925057288 2:864969-864991 CTGACTTTCAAGGAGAGGAGGGG + Intergenic
925149678 2:1606567-1606589 CTGAGTGTAAAGGACCTGAGAGG + Intergenic
925699982 2:6627133-6627155 CTGAATGTGGAGGAAAAGAGCGG + Intergenic
926268687 2:11348132-11348154 CTGAATGACAAGCAACAGACTGG - Intronic
926275072 2:11397273-11397295 CTGAGTGGCCAAGAGCAGAGTGG - Intergenic
926738430 2:16091581-16091603 ATTAATGACAAGGAGAAGAGAGG - Intergenic
926764451 2:16311929-16311951 TTGAATTTCAAGGCACAGAGAGG - Intergenic
927827189 2:26317050-26317072 CTGATTCTACAGGAGCAGAGGGG + Exonic
927850350 2:26494837-26494859 CTGGAAGTCAAGGAGCACACAGG - Intronic
927860876 2:26559201-26559223 CTGAATCTCAGGAAGCAGAGAGG + Intergenic
929666752 2:43839257-43839279 CTGCATGTCAAAGGGCGGAGGGG + Intronic
929723715 2:44400443-44400465 CTGAATGTCCATGGGTAGAGTGG - Intronic
929790413 2:45018335-45018357 CTGAATATCACTGATCAGAGTGG - Intergenic
930626385 2:53702712-53702734 TTGAACTTCAAGGAGCGGAGTGG - Intronic
932597915 2:73105727-73105749 ATCCATGTCAAGGAGAAGAGAGG + Intronic
932619993 2:73259598-73259620 ATGAATGGCAAGGAACAGAGTGG + Intronic
933358437 2:81245228-81245250 TAGAAAGTCAAGGAGGAGAGAGG + Intergenic
933804158 2:85986276-85986298 CTGAATTTCAAGGCCCAGCGCGG + Intergenic
934619823 2:95797268-95797290 CTGTATGGCTCGGAGCAGAGAGG - Intergenic
934641065 2:96027289-96027311 CTGTATGGCTCGGAGCAGAGAGG + Intronic
935727460 2:106036315-106036337 CTACCTGTCAAGGCGCAGAGAGG + Intergenic
937438975 2:121901167-121901189 CTGAACTTCTAGAAGCAGAGGGG + Intergenic
937801503 2:126086012-126086034 CTAAATGTCTAGGAGTAGAATGG - Intergenic
937980842 2:127614447-127614469 CTGATGGGCAAGGAGGAGAGAGG - Intronic
938366727 2:130740533-130740555 GTGAAAAACAAGGAGCAGAGGGG + Intergenic
940014184 2:149086299-149086321 CAGAAAGGCAAGGAGAAGAGTGG + Intronic
942848902 2:180459320-180459342 CTCAAATTCAAGGGGCAGAGTGG - Intergenic
943532645 2:189103722-189103744 CTGAAGGTGAAGGAGGGGAGAGG + Intronic
944689556 2:202147347-202147369 CTGAAGGTCTAGGGGCAGAGGGG + Intronic
944841059 2:203624140-203624162 CTGAAAGTCAAGGAGCATGTGGG - Intergenic
944869068 2:203891885-203891907 AGGTAGGTCAAGGAGCAGAGAGG - Intergenic
945254589 2:207792828-207792850 GTGAATGTCTAGGAGCAGAATGG - Intergenic
946940835 2:224768797-224768819 CTGAATGGCTAGGAAGAGAGGGG + Intronic
947389943 2:229628608-229628630 CAGAATGTCAAGGAGCTCTGTGG + Intronic
948232092 2:236356170-236356192 AAGAATGTCCAGGGGCAGAGAGG + Intronic
1169682232 20:8228378-8228400 GTGGATGGCAAGGAACAGAGAGG - Intronic
1172450232 20:35017375-35017397 TAGAATGTCAAGGATCAGAGGGG + Intronic
1172639044 20:36430071-36430093 CTGTCTGCCATGGAGCAGAGAGG - Intronic
1173616109 20:44403909-44403931 CTGAATGGCCAGGAGCTGTGGGG + Intronic
1174519106 20:51116031-51116053 CTGAGGCTCAAAGAGCAGAGTGG - Intergenic
1174546302 20:51327849-51327871 CTGTCTGGAAAGGAGCAGAGAGG - Intergenic
1174566475 20:51468494-51468516 CTGAAATACACGGAGCAGAGAGG + Intronic
1175352737 20:58336917-58336939 ATGAATGTCAAGCAGCAGCCTGG - Intronic
1175860425 20:62147504-62147526 CTGCATGCCAAGCAGCAAAGAGG - Intronic
1177038915 21:16081865-16081887 ATAAATGTAAAGGAGAAGAGAGG + Intergenic
1177452289 21:21285982-21286004 CTGAGTGACAAGGAAGAGAGAGG + Intronic
1179459184 21:41522237-41522259 CTGATAGCCCAGGAGCAGAGTGG + Intronic
1180800395 22:18629125-18629147 CGGACAGTCAAGGAGCAGGGTGG + Intergenic
1180851629 22:19024681-19024703 CGGACAGTCAAGGAGCAGGGTGG + Intergenic
1181017059 22:20076839-20076861 CTGATAGCCAAGGAGCAGGGCGG + Intergenic
1181221324 22:21366137-21366159 CGGACAGTCAAGGAGCAGGGTGG - Intergenic
1181588145 22:23865582-23865604 CTGATAGCCAAGGAGCAGAGTGG + Intronic
1182746126 22:32606765-32606787 CTGAATGAAGAGGAGCAGAGAGG - Intronic
1182866220 22:33606781-33606803 CTGAATGTGGAGGTGCAGGGTGG - Intronic
1183334335 22:37237989-37238011 CTGAATGACAGGAAGCAGGGAGG + Intronic
1183409148 22:37644862-37644884 CTGAATCTCCAGGAGCTGTGGGG - Exonic
1183668783 22:39260021-39260043 CTGCCTGGAAAGGAGCAGAGGGG - Intergenic
1184402722 22:44283112-44283134 CTGCGTGTCAAAGAGCACAGCGG + Intronic
1185158963 22:49211307-49211329 CTGAATGTCCAGAAGCCAAGCGG + Intergenic
1203298438 22_KI270736v1_random:60321-60343 TGGAATGTAAAGGAGTAGAGTGG + Intergenic
1203313421 22_KI270736v1_random:158603-158625 CAGAATGACATGGAGAAGAGTGG + Intergenic
950847463 3:16028825-16028847 CTGAGTGAGAAGTAGCAGAGAGG - Intergenic
951134924 3:19094329-19094351 CTGTGTGTCAAGGGTCAGAGGGG + Intergenic
953439362 3:42904804-42904826 CTGAAAGTCAGGCAGAAGAGTGG - Intronic
956691088 3:71878022-71878044 CTGAATGTGAGGCAGGAGAGCGG - Intergenic
957074627 3:75592070-75592092 CTGAATGACAAGGATTTGAGAGG + Intergenic
957718870 3:83969089-83969111 CTGAAGGGCAAGGAGTAAAGGGG + Intergenic
960052324 3:113250665-113250687 CTGAATGGAAAGGAGCTGAATGG + Exonic
960621145 3:119637890-119637912 GTGAATGCTAAGGATCAGAGAGG - Intronic
960634213 3:119767972-119767994 CTGAATGACCAGTTGCAGAGAGG - Intergenic
962437375 3:135379506-135379528 CTGATTGCCAAGTAACAGAGAGG - Intergenic
964617180 3:158679096-158679118 CTGAAGGTCTAGGAGCCTAGAGG - Intronic
965220393 3:165919928-165919950 CTAAATGGAAAGGAGAAGAGAGG - Intergenic
966537898 3:181054454-181054476 TTGAAGGGCAAGGAACAGAGTGG - Intergenic
966794386 3:183699381-183699403 CTGGAACTCAAGGAGGAGAGAGG + Intronic
968295671 3:197574917-197574939 CAGATTGACAAGGAGCAGACTGG + Intergenic
968609991 4:1552569-1552591 CTGACTCTCAGGGAGGAGAGAGG - Intergenic
969807954 4:9625519-9625541 CTGAATGTAGAAGAGCAGTGGGG - Intergenic
970251166 4:14117600-14117622 GTGAAAGTCATGGAGCAGAAAGG - Intergenic
972432560 4:38997271-38997293 GTCAATGACAAGGGGCAGAGGGG + Intronic
974908882 4:68091345-68091367 TTGAATGCCAAGGAGAAGGGTGG - Intronic
975844997 4:78515737-78515759 GTGGATGCCAAGGAGCAGGGTGG - Intronic
976329094 4:83807878-83807900 CTGAAACTCTAGCAGCAGAGAGG + Intergenic
977009677 4:91621839-91621861 TTGAATGTCAACTAGCAGAAAGG - Intergenic
977276483 4:94983529-94983551 ATGAATGTCAACAGGCAGAGAGG + Intronic
978636410 4:110812671-110812693 CTGACTGTCATGGAGTATAGAGG - Intergenic
979656848 4:123205206-123205228 CAGAATGTCAGGGAGTACAGTGG + Intronic
979803356 4:124939270-124939292 CTTTATGTCATGGAGCAGAGTGG + Intergenic
979949827 4:126878285-126878307 CTCCATGTGAAGGAGCACAGAGG - Intergenic
982164497 4:152602681-152602703 GTGAACGTCAGGGAGCAGAGGGG + Intergenic
982418439 4:155164778-155164800 CTGCATTTCCAGGAGCAGAATGG + Intergenic
982534760 4:156596404-156596426 CTCAATATCATTGAGCAGAGAGG - Intergenic
985045621 4:185937896-185937918 CTGAGTTTGAAGGGGCAGAGAGG - Intronic
987042404 5:14075338-14075360 CTGAAAGTCAAGGAACAGCTGGG - Intergenic
987810877 5:22834263-22834285 CTGATTTTCAAAGAGCACAGTGG + Intronic
990801342 5:59607543-59607565 CAGCATGCCAAGGAGGAGAGCGG + Intronic
997271210 5:132539828-132539850 CTGTATGTCAGGGGTCAGAGGGG + Intergenic
997888781 5:137657085-137657107 TCCAAGGTCAAGGAGCAGAGGGG + Intronic
998413066 5:141925539-141925561 CTGAAGGTCAAGGACCAGGCTGG - Intronic
999279828 5:150357828-150357850 CGGGAAGTGAAGGAGCAGAGCGG + Exonic
1000706619 5:164520738-164520760 CTGAATGTCATGGCTAAGAGAGG - Intergenic
1001203857 5:169744065-169744087 ATGAATAGCAAGGAGCAGATTGG + Intronic
1002031269 5:176432492-176432514 GTGTATGTCAGTGAGCAGAGGGG + Intergenic
1003257479 6:4487175-4487197 GGGAAAGCCAAGGAGCAGAGAGG + Intergenic
1003977935 6:11361454-11361476 CAGAGTGTCAAGGGGCAGGGGGG + Intronic
1005701841 6:28409437-28409459 CAGAATCTCAAGGAGCAGTTAGG - Intergenic
1005894297 6:30164436-30164458 CTGACTGCCAGGGCGCAGAGGGG + Intronic
1006680785 6:35795613-35795635 CTGAATGTTGAGGAGACGAGAGG - Intronic
1006919015 6:37615411-37615433 CTGGAGGCCAAGGAGCAGACAGG + Intergenic
1007563692 6:42831676-42831698 CTGAATGTGGAGGAGGAGAAAGG - Intronic
1008737308 6:54561291-54561313 CAGGAAGTCAAGGAGCAAAGTGG + Intergenic
1010276838 6:73978196-73978218 CTGAGAGTCAAGAAGCACAGTGG - Intergenic
1012238007 6:96839635-96839657 CTGTTGGTAAAGGAGCAGAGAGG - Intergenic
1012887938 6:104866093-104866115 TTGAAAGTCAAGGAGCAAAAGGG + Intergenic
1014866400 6:126535761-126535783 ATCAATGTCATGGAGCAGTGCGG + Intergenic
1016344883 6:143102701-143102723 CAAAATGTAAAGGAGTAGAGAGG - Intronic
1016657675 6:146540815-146540837 CTAAGTGTCTAGGAGCACAGTGG - Intergenic
1016720693 6:147293875-147293897 CTGAATGTGAAGAAGAAGATAGG + Intronic
1017670493 6:156765401-156765423 CTGAAAGAAAAGGAGCAGATAGG + Intergenic
1018278520 6:162158970-162158992 CTGAATGCCAAGGTGGAGATGGG - Intronic
1019769536 7:2874997-2875019 CTGAGAGTCAAGGAGCACATTGG - Intergenic
1019796551 7:3054206-3054228 CTGAGTGTGCAGGAGGAGAGTGG + Intergenic
1019799668 7:3078980-3079002 CTGGTTGTCAAGGAGCTGATGGG - Intergenic
1020871353 7:13633273-13633295 CTTAATCTCAAGGAACAGAGAGG + Intergenic
1020908555 7:14097991-14098013 CAGGATGTCAGGGAGCTGAGAGG - Intergenic
1021050669 7:15980821-15980843 TTTCATGACAAGGAGCAGAGAGG + Intergenic
1023674195 7:42613473-42613495 CTGAATGGTTAGAAGCAGAGTGG - Intergenic
1024698138 7:51877614-51877636 CTGAACACCAAGGAGCAGATGGG - Intergenic
1026551703 7:71374418-71374440 CTGAAACACAAGGAGCAGAAAGG - Intronic
1027812664 7:82925148-82925170 ATGAATGGCCAGGAGCAGAGCGG - Intronic
1028167142 7:87550262-87550284 CTGAACCTGAAGGTGCAGAGTGG - Exonic
1028667574 7:93364298-93364320 CTGCATGTCTAGGGGCAGGGTGG - Intergenic
1030063303 7:105640224-105640246 CTGAACTTGAAGGTGCAGAGAGG + Intronic
1030195051 7:106845122-106845144 TAAAATGTCAAAGAGCAGAGCGG + Intergenic
1030567284 7:111174506-111174528 CCGAATTTCAAGGTTCAGAGTGG + Intronic
1031458254 7:122011361-122011383 CTGATTGTCAAGCAACAAAGGGG - Exonic
1037746991 8:21653540-21653562 ATCAATGGCCAGGAGCAGAGGGG + Intergenic
1040761090 8:50844865-50844887 GTCAATGACAAGGAGCAGATAGG + Intergenic
1040982283 8:53256024-53256046 CTGAATTTCAATGAGTAAAGGGG - Intergenic
1041260481 8:56017152-56017174 CTGGATGTCCAGGTGCTGAGCGG + Intergenic
1041629103 8:60064606-60064628 CTGAAAGTCTAGGTGCAGAGAGG - Intergenic
1042390259 8:68226370-68226392 GAGAATGCCAAGGAGCACAGAGG + Intronic
1042432972 8:68729270-68729292 CTGAATGTTAATTAGCAGAGTGG + Intronic
1044448202 8:92302605-92302627 CTGAATGTCAAGAGGAACAGAGG - Intergenic
1044580176 8:93818581-93818603 CTGTAAGTCAAGGAGCAGTGAGG + Intronic
1046038871 8:108878133-108878155 CTGTATGTCAAAAAGCAAAGGGG - Intergenic
1047325423 8:123831146-123831168 CTGCAAGTCAAGGAGCAAGGAGG - Intergenic
1047809292 8:128390900-128390922 CAGAATGTGAATGAGCAGAGAGG + Intergenic
1048863765 8:138743788-138743810 CTGAATGCCAAGATGCTGAGCGG + Intronic
1049088575 8:140496347-140496369 CTGACTGCCAAGGGGCAGGGTGG - Intergenic
1049360757 8:142211595-142211617 CTGGGTGGCAAGCAGCAGAGAGG + Intergenic
1049374567 8:142282936-142282958 CTGTCTGTCAATGAGCAGAGGGG + Intronic
1049374762 8:142284134-142284156 GTGTCTGTCAATGAGCAGAGTGG + Intronic
1050051093 9:1602365-1602387 CTGAATGCTTAGGACCAGAGAGG - Intergenic
1050920074 9:11189123-11189145 CTAGATGGCAAGAAGCAGAGAGG - Intergenic
1052071603 9:24088775-24088797 GTGAAAGCAAAGGAGCAGAGAGG + Intergenic
1054869867 9:70039355-70039377 CAGATTGGCAAAGAGCAGAGAGG + Intergenic
1056798108 9:89673179-89673201 CTGACTGCCCAGAAGCAGAGGGG + Intergenic
1057026916 9:91740977-91740999 GTGATTGTCAGGGAGGAGAGAGG + Intronic
1057244966 9:93447408-93447430 CTGAATGTGAAGGTCAAGAGAGG - Exonic
1057258148 9:93567491-93567513 CTGCTTGTCAGGGAGCAGAGAGG - Intergenic
1057912988 9:99034687-99034709 ATAAATGTCATGGAACAGAGAGG + Intronic
1058581967 9:106468036-106468058 CTGCTTTTCAAGGAGCAGATGGG + Intergenic
1058786397 9:108393239-108393261 CTGAAAGTCCAGGAACACAGAGG + Intergenic
1058923773 9:109641739-109641761 CTCAATGTCAAGGAGTAGTGTGG - Intronic
1059363572 9:113767551-113767573 CTGAATCCCAAAGTGCAGAGAGG - Intergenic
1060170693 9:121458777-121458799 CTGAATGACTGGGGGCAGAGAGG - Intergenic
1061709648 9:132478844-132478866 ATGAATGACAAGCTGCAGAGCGG - Intronic
1062005044 9:134234828-134234850 GTGTATGCCAAGGTGCAGAGGGG - Intergenic
1062089922 9:134670486-134670508 CTGCCTCTCTAGGAGCAGAGAGG - Intronic
1062530239 9:136996500-136996522 CTGTTTGTCAAGGTGCAGGGCGG - Exonic
1190278508 X:48914295-48914317 CTGTAGGCCAAGAAGCAGAGAGG + Intronic
1190756454 X:53405808-53405830 CAGTATATCAAGGAGCAGCGTGG - Exonic
1191627437 X:63283920-63283942 CTGCCTGTCAAAGAGCAGAGGGG - Intergenic
1192209078 X:69116017-69116039 GTGCAGGTCAAGGAGCAGAGAGG + Intergenic
1192381833 X:70625344-70625366 CTGAATTTCAGAGAGCATAGTGG - Intronic
1192789644 X:74368778-74368800 CTGTATGTCTAGAAGCAAAGAGG + Intergenic
1193443975 X:81577351-81577373 CTGCCTGGCAAGGAGCAGTGGGG - Intergenic
1193474669 X:81948632-81948654 ATTTATGTCAATGAGCAGAGGGG - Intergenic
1197639247 X:128950040-128950062 CTGGATGTCAAGGATTAGAAAGG + Intergenic
1197756992 X:130002517-130002539 CTGAAGGCCAAAGAGTAGAGGGG + Intronic
1198722856 X:139642732-139642754 CTGAATTACAAGGAGCAGAAGGG - Intronic
1198802236 X:140459736-140459758 CTGAGTGTCAATGGGCAGACAGG - Intergenic
1201107131 Y:10771633-10771655 TGGAATGTAAAGGAGCAGAATGG - Intergenic
1201110362 Y:10794750-10794772 TTGAATGTCATGGAGCGGAGTGG - Intergenic
1201115683 Y:10833555-10833577 CTGAATGGGAAGGAGTTGAGTGG - Intergenic
1201128021 Y:10931618-10931640 TGGAATGTAAAGGAGTAGAGTGG - Intergenic
1201601202 Y:15730386-15730408 CTGAAGGTCAAAGAGAAAAGAGG + Intergenic