ID: 923336112

View in Genome Browser
Species Human (GRCh38)
Location 1:232971611-232971633
Sequence GTGGTGAACGAGACTGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 72}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923336108_923336112 17 Left 923336108 1:232971571-232971593 CCTACTGTATGCTAGGTGTCATT No data
Right 923336112 1:232971611-232971633 GTGGTGAACGAGACTGACCAAGG 0: 1
1: 0
2: 1
3: 6
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923336112 Original CRISPR GTGGTGAACGAGACTGACCA AGG Intronic
902272111 1:15312123-15312145 GTGGTGAATGTGACTTCCCAGGG - Intronic
905651180 1:39658032-39658054 GTGGGGAACGGGACAGAGCATGG - Intergenic
912006662 1:104911486-104911508 CTGGTGACCAAGAGTGACCAAGG + Intergenic
913206651 1:116545185-116545207 GTGGGGAACAAGACAGACAAAGG + Intronic
918062032 1:181070305-181070327 GTTGTGGACAAAACTGACCAGGG - Intergenic
923336112 1:232971611-232971633 GTGGTGAACGAGACTGACCAAGG + Intronic
924647774 1:245895010-245895032 GTGGTGAACGCCACAGTCCAAGG + Intronic
1066177315 10:32921540-32921562 GTGGTGCACGAGACACACAAGGG + Intronic
1068617035 10:59130122-59130144 GTGGTAAAGGAGACTAAACATGG + Intergenic
1069610810 10:69771344-69771366 GTGAGGAACCAGACTGCCCAGGG + Intergenic
1071477201 10:86035112-86035134 GTGGTTATAGACACTGACCAGGG - Intronic
1075848632 10:125567849-125567871 GTGGTGAGCCAGAGTGACCTTGG - Intergenic
1076210670 10:128642173-128642195 GTGATGAACGAGTCAGCCCAGGG - Intergenic
1079093957 11:17499272-17499294 GTGGTGTATGATACTGACAATGG + Intronic
1080819753 11:35794107-35794129 GTGGTGGTTGAGACTGATCATGG - Intronic
1097362295 12:58671319-58671341 GTGGTGAAAGACAATGACCCTGG + Intronic
1100678922 12:96897945-96897967 GTGGTGAGTGTGACTGGCCAGGG + Intergenic
1103085056 12:118056390-118056412 GTTGTGAAGGAGATTGACTAGGG - Intronic
1105639060 13:22243909-22243931 GTGGAGAACTAGAGTGGCCATGG + Intergenic
1105641407 13:22268845-22268867 GTGGGGAGCCAGACTGAGCAGGG + Intergenic
1108322873 13:49304218-49304240 GTGGAGACCTAGACTGAGCATGG + Intergenic
1108597639 13:51963235-51963257 GTGGTGTACTAGACTCACAAAGG + Intronic
1109062445 13:57634530-57634552 GTGGTGAAGGTGACCGACCACGG + Exonic
1113672225 13:112183052-112183074 GTGGAGAAGGAGGCTGACGATGG - Intergenic
1114844702 14:26307531-26307553 GTGCTGAAAGATACTGACGAAGG - Intergenic
1117602401 14:57389838-57389860 GTGGTGAAAGAGAGTGACCAGGG - Intergenic
1119234541 14:73008526-73008548 GTGGTCAAAGAAACTGATCAGGG - Intronic
1123143762 14:106108450-106108472 GTGGTGAAGGAGACTCACTGTGG + Intergenic
1123220569 14:106851589-106851611 GTGGTGAAGGAGACTCACTGTGG + Intergenic
1126903424 15:53338224-53338246 GTGGTGAACAAGACAAACAAAGG + Intergenic
1129273377 15:74430987-74431009 GAGGTGAACCAGCCTGTCCATGG - Intronic
1132766788 16:1538396-1538418 GTGGTGAGGGTGAGTGACCAAGG - Intronic
1134044165 16:11089117-11089139 GTGGTGAACAAGACAGCCCGAGG - Intronic
1137565792 16:49531782-49531804 GTGGTGATGGAGGATGACCATGG + Intronic
1140411708 16:74745056-74745078 GAGGCGAACGAGACTGTCCCAGG + Intronic
1140846027 16:78888975-78888997 GTGGTGAGGAGGACTGACCAGGG - Intronic
1155377770 18:25179803-25179825 GTGGTGGAAGAGACTGACGGTGG + Intronic
1159188297 18:65007971-65007993 ATGGTAAACTAGACTGAACAAGG + Intergenic
1161378337 19:3951257-3951279 GTTCTGCACGAGGCTGACCAGGG + Intergenic
1166200262 19:41232913-41232935 GTGGTTAACCAGATTGTCCAAGG + Intronic
1166346429 19:42169003-42169025 GTGGTTTACGAGACAGACCTGGG - Intronic
931617862 2:64179558-64179580 ATGGTGAGCAAAACTGACCAAGG + Intergenic
931925838 2:67071538-67071560 GTGGTGAAAGAGAGTGAGGAAGG - Intergenic
937743263 2:125380716-125380738 GTGGAGAACCAGAGAGACCAGGG + Intergenic
943233114 2:185282959-185282981 GTGAAGAACATGACTGACCAGGG - Intergenic
947701004 2:232233902-232233924 GTGGTTAAGGAGACTGACAACGG + Intronic
948742218 2:240055538-240055560 GATGTGAATGAGATTGACCAAGG + Intergenic
1172285394 20:33736874-33736896 GGGGTGAGTGAGACTGCCCAGGG + Intronic
1174313621 20:49679330-49679352 GTGGTGCTAGAGAATGACCAAGG - Intronic
1174632299 20:51968449-51968471 GTGGTGAACAAGACAGGCAAGGG - Intergenic
1180100821 21:45584247-45584269 GTGGAGAAGGAGACAGAGCAGGG - Intergenic
1181978828 22:26751978-26752000 TTGGGTAAAGAGACTGACCAAGG - Intergenic
1182617247 22:31595686-31595708 GTGCTGAGGGAGACTGAGCATGG + Intronic
1184641003 22:45870056-45870078 CTGGAGAAAGAGACTGACAAAGG - Intergenic
966134309 3:176681164-176681186 GTGGAGAACAACACAGACCAGGG + Intergenic
967477053 3:189934219-189934241 GTGGTGAAGGGGAGTGATCAGGG - Intergenic
985123744 4:186669670-186669692 GTGGAGAACGAGACTGAAGGGGG + Intronic
989804971 5:45592343-45592365 TTGGAGAATGAGACTAACCATGG + Intronic
992794849 5:80246200-80246222 GGGGTGAACCACACTCACCAAGG + Intronic
1001400685 5:171444668-171444690 GTGGTGAAGGGCACTGACCATGG + Intronic
1004885495 6:20047933-20047955 ATGGTGAACCAGGCTGGCCATGG + Intergenic
1007423792 6:41734689-41734711 GGGGAGAAAGAGACTGCCCAGGG + Intronic
1008518918 6:52344541-52344563 GTGGAGAGTGAAACTGACCATGG - Intergenic
1016582816 6:145648322-145648344 CTGCAGAACTAGACTGACCAAGG - Intronic
1018972847 6:168540531-168540553 GTGGTGAAGGTGCCTGGCCAGGG + Intronic
1021682589 7:23149366-23149388 GTGGTAAAAGTGGCTGACCATGG - Intronic
1031502498 7:122536836-122536858 GTGGTGACCAAGTCTGACCAAGG - Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1042153032 8:65810317-65810339 GTGGGGAACGTGACACACCAGGG + Intronic
1047934990 8:129767589-129767611 ATGGTGACCCTGACTGACCATGG + Intronic
1048604116 8:135949804-135949826 GTGGTTAAAGAGACTGCCCATGG - Intergenic
1049724963 8:144141614-144141636 GTGGTGGAAGAGACTGAACCTGG - Intergenic
1051044716 9:12858848-12858870 GTGGTAAAATAGACAGACCATGG + Intergenic
1059749402 9:117233747-117233769 GTGAGCAATGAGACTGACCAAGG + Intronic
1060554484 9:124501242-124501264 GCGGTGAACAAGGCTGACCAGGG - Intronic
1062552803 9:137097838-137097860 GCGGTGATCGAGCCTGAGCAGGG + Exonic
1186196724 X:7116535-7116557 ATGGTGAATGAGGCTGAGCAGGG - Intronic
1186738309 X:12490148-12490170 ATGCAGTACGAGACTGACCATGG + Intronic
1190822026 X:53982572-53982594 GAGGTTAACTAGCCTGACCAAGG + Intronic
1199191852 X:144980436-144980458 GTGGTGAACGATGCTGAGCTTGG - Intergenic