ID: 923336749

View in Genome Browser
Species Human (GRCh38)
Location 1:232977436-232977458
Sequence CACTGTGATGGGAGCAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 509}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923336746_923336749 -10 Left 923336746 1:232977423-232977445 CCAAGTAGGAAGGCACTGTGATG 0: 1
1: 0
2: 1
3: 15
4: 196
Right 923336749 1:232977436-232977458 CACTGTGATGGGAGCAGAGATGG 0: 1
1: 0
2: 3
3: 47
4: 509
923336739_923336749 28 Left 923336739 1:232977385-232977407 CCCATCAGCGTGTGTTGAGTGGA 0: 1
1: 0
2: 0
3: 2
4: 63
Right 923336749 1:232977436-232977458 CACTGTGATGGGAGCAGAGATGG 0: 1
1: 0
2: 3
3: 47
4: 509
923336740_923336749 27 Left 923336740 1:232977386-232977408 CCATCAGCGTGTGTTGAGTGGAT 0: 1
1: 0
2: 0
3: 10
4: 80
Right 923336749 1:232977436-232977458 CACTGTGATGGGAGCAGAGATGG 0: 1
1: 0
2: 3
3: 47
4: 509
923336737_923336749 29 Left 923336737 1:232977384-232977406 CCCCATCAGCGTGTGTTGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 90
Right 923336749 1:232977436-232977458 CACTGTGATGGGAGCAGAGATGG 0: 1
1: 0
2: 3
3: 47
4: 509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923336749 Original CRISPR CACTGTGATGGGAGCAGAGA TGG Intronic
902155017 1:14478167-14478189 GACTGAGATGGGTGGAGAGATGG + Intergenic
902211475 1:14907821-14907843 CACTGGGATGAGAGCTGAGCGGG - Intronic
902242595 1:15098977-15098999 CAATGTGACTGGTGCAGAGATGG + Intronic
902880724 1:19370236-19370258 TACTGTGATGGGAGAGGACAAGG - Intronic
902938037 1:19778914-19778936 CAGTGTGGTGGTTGCAGAGATGG + Intronic
903024983 1:20421821-20421843 TGCTGTGATGGGATGAGAGAGGG - Intergenic
903795060 1:25922691-25922713 CTCTGTGCTAGGAGAAGAGAAGG + Intergenic
904279450 1:29408768-29408790 CACTGAGTTGGGAAAAGAGAGGG - Intergenic
904575465 1:31502503-31502525 CACTGTGCTGGGGGAAGGGATGG - Intergenic
904656424 1:32051635-32051657 AACTGTGGTGGGGGAAGAGAGGG - Intronic
904888562 1:33760721-33760743 CACTGTGCTGGGCTCAGGGAAGG + Intronic
905768249 1:40621146-40621168 TTCTCTGATGGGAGGAGAGAGGG - Exonic
906132512 1:43469049-43469071 CTCTGAGATTGGAGCAGACAAGG + Intergenic
907681562 1:56568947-56568969 TACTGTGGTGGGAGCAGAGAGGG - Intronic
907850551 1:58250693-58250715 CACTGTGACCGTAGCGGAGAAGG - Intronic
908878200 1:68701420-68701442 TAGTGTGATGGGAGATGAGAAGG - Intergenic
908892520 1:68862830-68862852 ACCTGTGCTGGGAGGAGAGAGGG + Intergenic
910214496 1:84829477-84829499 CAGTGGGATGGAAGCAGATATGG - Intronic
910716798 1:90240767-90240789 AACTGAGATGGGAAGAGAGAGGG + Intergenic
910929195 1:92425763-92425785 CACTGTGTTGAGAGCAGGGAGGG + Intergenic
914343063 1:146776574-146776596 TTCTGTGAGGGGAACAGAGACGG - Intergenic
915074977 1:153300374-153300396 CACTGTGATGGATGCAGAACAGG - Intronic
915528069 1:156488258-156488280 CACTAGGATGGGAACAGATATGG - Intronic
915528208 1:156488954-156488976 CACTAGGATGGGAACAGATATGG - Intronic
915906935 1:159885764-159885786 CAGAGTGATGGGCACAGAGAAGG + Intronic
916911663 1:169355534-169355556 CAGTGTAACTGGAGCAGAGAAGG - Intronic
917798706 1:178551401-178551423 AACTGTGGTGGGATCAGAGAGGG + Intergenic
918042595 1:180922220-180922242 CAGGGAGAAGGGAGCAGAGAAGG + Intronic
918232476 1:182548728-182548750 CTCTGTGATGGCAGCAAGGATGG - Exonic
919236032 1:194843743-194843765 CACTGTGATTACAGCAGAGTTGG + Intergenic
919408981 1:197220483-197220505 CAAGGAGATGGGAGCAGGGAGGG + Intergenic
919918097 1:202151491-202151513 CAATGTGATGAGAGCTGTGATGG - Intronic
920206904 1:204298808-204298830 CCCAGGGATGGGAACAGAGATGG + Intronic
920244908 1:204580123-204580145 CAGTGAGAGGGGAGCACAGAGGG - Intergenic
920351736 1:205342484-205342506 CACTGTGCTGGGGACAGAGCAGG + Intronic
920519782 1:206614685-206614707 GTCTGTGATGCAAGCAGAGAAGG - Intergenic
920805024 1:209224872-209224894 CAGTGTGGTTGGAGCACAGAGGG - Intergenic
920961824 1:210670459-210670481 CACAGTGATGGGAGCTCTGAAGG + Intronic
921324224 1:213974620-213974642 CACTGTAATGGGTGGAGATAAGG - Intergenic
922236460 1:223726274-223726296 GTCTGTGATGAGAGCAGGGATGG + Intronic
922577853 1:226674797-226674819 AAGTGGGATGGGAGCAGAGCAGG - Intronic
922968844 1:229717172-229717194 CACTATGATTGGTTCAGAGACGG - Intergenic
923336749 1:232977436-232977458 CACTGTGATGGGAGCAGAGATGG + Intronic
923569194 1:235099158-235099180 CACAGTGTTGGGAGCACAGGTGG - Intergenic
924821153 1:247491847-247491869 CACTGTGAGGTGAGAAGAGCAGG - Intergenic
1064986178 10:21212442-21212464 CAGAGTGATGGGAGGAAAGAAGG + Intergenic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1065231189 10:23600038-23600060 CAGTGTGATGCCAGCAGAAAAGG - Intergenic
1065628083 10:27651673-27651695 CATTGTGAGGGTAGCAGACATGG - Intergenic
1065836915 10:29666658-29666680 CACTGTGTTATGTGCAGAGAAGG + Intronic
1066293026 10:34031032-34031054 CCCTGTGCTGGGAGCAAAGCCGG - Intergenic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1070930742 10:80258947-80258969 CTTTGTGGTGGGAGCAGACATGG - Intergenic
1071011379 10:80944540-80944562 CAGTGGGATGGAAGCAGAGTTGG + Intergenic
1071350955 10:84744089-84744111 CTTTGTGATGGCAGCAGAGATGG - Intergenic
1071493547 10:86152714-86152736 CACTGTGAGGGGCACACAGAAGG + Intronic
1072059518 10:91796485-91796507 CAGCGTGAGGTGAGCAGAGAAGG - Intergenic
1072860104 10:98994689-98994711 CTTGGTGATGGGACCAGAGACGG + Intronic
1073293946 10:102427204-102427226 CATTTAGAGGGGAGCAGAGAAGG - Intronic
1073760097 10:106620048-106620070 CACAGTGCTGGGGGTAGAGAGGG - Intronic
1074219665 10:111424065-111424087 CATTGTGATAGGAGCCAAGAAGG - Intergenic
1074430503 10:113390349-113390371 CACTGTAAGAGGAGCAAAGAAGG + Intergenic
1075087620 10:119424038-119424060 CACTTTGAGGGGAGCTGGGAGGG + Intronic
1075583265 10:123638297-123638319 CACTGTAATATGGGCAGAGAGGG - Intergenic
1075985077 10:126778235-126778257 CACTGTTATGGGACCGGATATGG - Intergenic
1076517613 10:131057004-131057026 CACTGTGATGGTGTCAGAGAAGG + Intergenic
1076579051 10:131494684-131494706 CACTGTGTTTGGAGGAGTGAGGG - Intergenic
1076600604 10:131654718-131654740 CCCTGTGTGAGGAGCAGAGACGG - Intergenic
1076619782 10:131779810-131779832 CTCTGTGCTGGGGGCAGTGATGG - Intergenic
1077117812 11:893248-893270 CCCTGTGCTGGGCACAGAGAAGG - Intronic
1077219840 11:1411022-1411044 CATGGTGATGGGAGCAGAAAAGG - Intronic
1078476901 11:11638181-11638203 CACTGTGCTTGGAGCAGAGTGGG + Intergenic
1078937491 11:15964625-15964647 CACTGTGTTGGGGGCAGGGCAGG + Intergenic
1080034715 11:27699877-27699899 CTGCGTGATGGGAGCAAAGACGG - Intronic
1080610838 11:33902133-33902155 CACTGGGATTGGTTCAGAGAAGG + Intergenic
1080915602 11:36655391-36655413 CAGGGTGATGGGAACACAGAAGG - Intronic
1081236769 11:40655986-40656008 CACTGTCATGAGAACAGAAAGGG + Intronic
1081544604 11:44061299-44061321 TACTGTGAAGTGGGCAGAGAAGG + Intergenic
1081757245 11:45553639-45553661 CACAGTGGTGGGTGCATAGAAGG - Intergenic
1083612231 11:64009776-64009798 CAGTCTCAGGGGAGCAGAGAAGG - Intronic
1083698206 11:64456684-64456706 AACTGTCATGGCGGCAGAGACGG + Intergenic
1084024288 11:66438258-66438280 CTCTGTGAGGGAAGCAGAGGGGG + Exonic
1084742347 11:71147817-71147839 CTCTGTGTTTGAAGCAGAGAGGG - Intronic
1084892263 11:72242443-72242465 CAGAGAGATGGGAGCAGAGATGG - Intronic
1085757836 11:79216335-79216357 TACTGTGATGGGAGTAGACAAGG + Intronic
1086547878 11:88019398-88019420 CAGTGTGGTGGTAGCAGAAATGG - Intergenic
1087188031 11:95222974-95222996 CACTGTGGTAGGAGTACAGATGG - Intronic
1087223787 11:95575596-95575618 CCCTGAGATGGTAGCAGAAATGG + Intergenic
1087500004 11:98938718-98938740 CACAGTGAAGGAAGCAGGGATGG + Intergenic
1087861457 11:103163127-103163149 ACCTGTGAAGGGAACAGAGATGG - Exonic
1088411056 11:109535225-109535247 CACTGTCATGGGAGCAGCATGGG + Intergenic
1089547618 11:119241831-119241853 CAAAGTGATGGGTGTAGAGATGG + Intronic
1090350610 11:126105534-126105556 CAGTGTGCTTGGAGCAGAGCAGG - Intergenic
1090666271 11:128916878-128916900 CCCTGTGCTGGGAGCTGTGAGGG - Exonic
1091320006 11:134642746-134642768 CACTGTGCTGGGACCTGGGAAGG - Intergenic
1091344643 11:134844505-134844527 CACTGTGGTGGGAAGAGAGAGGG + Intergenic
1091838346 12:3601799-3601821 CTCTGTGAGGGGAGAAGAGTGGG + Intergenic
1093510419 12:19920555-19920577 CACTGTGATGAGAACAGCAAGGG - Intergenic
1093923592 12:24887265-24887287 AACTGGGATGGGAACAGATATGG + Intronic
1093984970 12:25520383-25520405 CACAGGGATGGGAGCAGGGGAGG - Intronic
1094524999 12:31225613-31225635 GACTAGAATGGGAGCAGAGACGG + Intergenic
1094588995 12:31803557-31803579 AACTGTGATGGGACCAGGCAAGG + Intergenic
1095462406 12:42456567-42456589 CCCTGTGAAGGAAGCAGAGGGGG - Intronic
1095861456 12:46922477-46922499 AACAGTGATGAGAGTAGAGAAGG - Intergenic
1096498874 12:52053813-52053835 CACTGCGAGGGGAGGAGAAAAGG + Intronic
1097336596 12:58390553-58390575 CACTGCTAAAGGAGCAGAGAAGG - Intergenic
1097652542 12:62319246-62319268 CACTGTCATGGGAACAGCAAGGG + Intronic
1097956890 12:65495489-65495511 CACAGTGATTGGTGCAGGGAGGG + Intergenic
1100398159 12:94202841-94202863 CACAGTGTTGGGGTCAGAGATGG + Intronic
1101120719 12:101576964-101576986 CACTGTGCTGGGCCCAGAAAAGG + Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1102188777 12:110970154-110970176 CACTGTGCTGGGCACAGAGAAGG - Intergenic
1102360030 12:112277710-112277732 CTGTGTGATGTGAGAAGAGATGG - Intronic
1102875997 12:116449202-116449224 CACAGGGATTGGATCAGAGATGG + Intergenic
1102885234 12:116516869-116516891 CTCTGTGTTGGTAGCAGAGCTGG - Intergenic
1103160786 12:118727516-118727538 CACTGTGATGGAAGCTGGGGGGG - Intergenic
1103373855 12:120439883-120439905 CACTGTGATGGGGGCGGGGGAGG - Intronic
1103576538 12:121881614-121881636 CAAAGTCATGGGAGCAGATAAGG - Intergenic
1104515263 12:129419281-129419303 GACTGTGATGGGTTCAGAAACGG + Intronic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1106472737 13:30072089-30072111 CACTGTTAAGGAAGCAGAGCTGG + Intergenic
1107023681 13:35777870-35777892 GACTGTCATGGAAACAGAGAAGG - Intronic
1109156580 13:58918342-58918364 CAATGTGTTGGGTGCAGTGAAGG + Intergenic
1110883907 13:80608620-80608642 CACTGAGATGGCAGCAGAGCTGG + Intergenic
1110954890 13:81541723-81541745 AAGTGTGATGGTAGGAGAGAGGG - Intergenic
1112355798 13:98674044-98674066 CACTGTCATAGGAGCAGGGAAGG - Intergenic
1113442715 13:110341603-110341625 CACTTTGAGAGGAGCAGAGCAGG + Intronic
1113886277 13:113660220-113660242 CACTCAGATGGGGGGAGAGAGGG - Intergenic
1113913215 13:113854503-113854525 CTCTGTGTTTGGGGCAGAGACGG - Intronic
1113926867 13:113946624-113946646 CACTGGGGTGGGAGCAGAACGGG + Intergenic
1114194354 14:20464000-20464022 CACTGTGATGTGGACAGGGAAGG + Intergenic
1114743500 14:25121980-25122002 CACTATGCTGGGAGCAGAGATGG - Intergenic
1115512221 14:34148676-34148698 GACTGAGATGGGAGAAGATAAGG - Intronic
1115574745 14:34699927-34699949 CACTGTGATGAGAGAAGTGCAGG - Intergenic
1117028326 14:51644304-51644326 CACTGAGATGAGAACAGAAAAGG - Intronic
1117053278 14:51884245-51884267 CAAAGTGATGCTAGCAGAGAGGG + Intronic
1117267675 14:54107028-54107050 GTGTGTGATGGGGGCAGAGATGG + Intergenic
1117400831 14:55357283-55357305 AACTGAAATGGAAGCAGAGATGG + Intronic
1118097745 14:62557651-62557673 CACTGTGCTTGGAGCAGAGCAGG + Intergenic
1119349664 14:73953674-73953696 CACTGAGGTGGGTGGAGAGAGGG + Intronic
1120109283 14:80534527-80534549 CACTGTTAAGGGAGCAGGGCCGG + Intronic
1120941192 14:89951438-89951460 CAAAGTGAAGGGAGCAAAGAAGG - Intronic
1121202147 14:92127097-92127119 AACTGTGATGAAAACAGAGAAGG + Intronic
1121227769 14:92333942-92333964 CCCTGTGCGGGGAGCAGAGGTGG + Intronic
1121322038 14:92997475-92997497 TTCTGGGATGGGAACAGAGAGGG + Intronic
1122411148 14:101526827-101526849 TATGGAGATGGGAGCAGAGATGG + Intergenic
1122772638 14:104104169-104104191 CACTGTCCCGGGAGCAGAGCAGG + Intronic
1122897973 14:104769767-104769789 CCCTGGGATGGGACCAGGGATGG - Exonic
1123782974 15:23645457-23645479 CACTGCCTTGGGAGCACAGAAGG + Exonic
1124439911 15:29678202-29678224 CACAGTGACGGGAGCTGAGGAGG + Intergenic
1125069493 15:35534984-35535006 CATAGTGATTGGATCAGAGATGG - Intronic
1127314747 15:57784359-57784381 GAGTGTGAGGGGAGAAGAGAAGG + Intergenic
1127862821 15:63008653-63008675 CAGTGTGACAGGAGCTGAGATGG + Intergenic
1128341111 15:66823087-66823109 CCCGGTGCTGGGAACAGAGAAGG - Intergenic
1128370570 15:67036215-67036237 CTCTTTGAGGTGAGCAGAGAAGG + Intergenic
1128771201 15:70283770-70283792 GACTGTGCTGGGTGCAGAGCAGG - Intergenic
1129164921 15:73771480-73771502 CACTGGGCTGGGAGATGAGATGG - Intergenic
1129930683 15:79408194-79408216 TAGAGTGATGTGAGCAGAGAGGG - Intronic
1129931277 15:79412844-79412866 CACTGTGCTGGGTGCAGCCAAGG - Intronic
1130391972 15:83464740-83464762 CAAGGTGATAGTAGCAGAGATGG - Intronic
1130559443 15:84946841-84946863 AACTGAGATGGGAGCAGGGCAGG - Intergenic
1130616679 15:85416039-85416061 AAGTGAGATGGGAGCACAGAAGG + Intronic
1130662999 15:85845351-85845373 CACTGTGAGGGAAGGTGAGATGG + Intergenic
1130938825 15:88491213-88491235 CACTGTGCTGGGGGCAGAGATGG + Intergenic
1131521515 15:93119592-93119614 CTCTGAGAGGGGAGCAGAGATGG + Intergenic
1131649039 15:94378864-94378886 CACTGTGCTAGGAGCTGAGGGGG - Intronic
1134099257 16:11440100-11440122 CTCAGAGATGGGAACAGAGATGG + Intronic
1136776993 16:32877317-32877339 GACTGGGAAGGGAGCAGGGAAGG - Intergenic
1136893623 16:33984196-33984218 GACTGGGAAGGGAGCAGGGAAGG + Intergenic
1137619387 16:49866600-49866622 CACTGGGATGGGAGCAGATGGGG + Intergenic
1137627228 16:49916852-49916874 CACTGCGATGGGAACAGGGCTGG - Intergenic
1139990926 16:70938754-70938776 TTCTGTGAGGGGAACAGAGACGG + Exonic
1140411834 16:74745694-74745716 CGTTGTGCTGGGAGCAGTGAGGG - Intronic
1140768872 16:78185083-78185105 CAATGGAATGTGAGCAGAGATGG - Intronic
1141212712 16:81996051-81996073 CAGTGTAATTGGGGCAGAGAAGG + Exonic
1141602863 16:85137012-85137034 CACTGTGATTGGTGCAGGGATGG - Intergenic
1141648937 16:85382296-85382318 GACTGTGGTGGGGGCAGGGACGG + Intergenic
1141950818 16:87338413-87338435 ACCTGTGAAAGGAGCAGAGAAGG - Intronic
1142285646 16:89170523-89170545 CTCTGTGATGGGAGCAGACCCGG - Intergenic
1203079410 16_KI270728v1_random:1139426-1139448 GACTGGGAAGGGAGCAGGGAAGG - Intergenic
1143138303 17:4724933-4724955 CCCTGTGTTCAGAGCAGAGAAGG - Intergenic
1144171439 17:12663372-12663394 CACTGTGATGGGAAAATTGAGGG + Intergenic
1144378334 17:14667892-14667914 AACTGTGATGGGACAAGAGAAGG + Intergenic
1144537487 17:16105012-16105034 CAGTGTGGTTGGAGCAGAGGGGG + Intronic
1144711497 17:17404315-17404337 CCCTCTGATGGGAGGAGGGAAGG + Intergenic
1146485776 17:33241409-33241431 CCATGTGGTGAGAGCAGAGAAGG - Intronic
1146624344 17:34424441-34424463 CACTGTTATGGGGGCAGGGCAGG - Intergenic
1147870335 17:43582617-43582639 CCCAGTGATTGGAGCAGAGGTGG + Intergenic
1148389201 17:47258159-47258181 CACTCTGTGGGCAGCAGAGAGGG - Intronic
1149007850 17:51823934-51823956 GACAGTGATGGCAGCAGAGAGGG - Intronic
1149299647 17:55293355-55293377 CACTGTGCTCTGAGGAGAGAAGG + Intronic
1149435024 17:56626459-56626481 CACTGGAAAGGCAGCAGAGAGGG - Intergenic
1149696597 17:58621163-58621185 AGCTGTGATGGGAGAAGAGGGGG + Intronic
1150457531 17:65319191-65319213 CACTGTGTGGGTAGCAGAGCAGG + Intergenic
1150502550 17:65665072-65665094 CAGTGTGATGGTATCGGAGATGG - Intronic
1151487681 17:74411621-74411643 CACTGTGATGACAGCAGCGTGGG - Intergenic
1151621301 17:75246678-75246700 CACTGTGGGGGCAGCTGAGAGGG - Intronic
1152007564 17:77691995-77692017 CACTGTGACGGGGGTAGGGACGG - Intergenic
1152406053 17:80098530-80098552 GGCTGTGGTGTGAGCAGAGACGG + Intronic
1152459488 17:80433688-80433710 CTCTGTGAGGGGGGCAGAGATGG + Intronic
1153115869 18:1655360-1655382 TACAGTGATAGAAGCAGAGATGG + Intergenic
1153560320 18:6365994-6366016 CACTCTGTTAGGAGCACAGATGG + Intronic
1155116546 18:22773898-22773920 CACTGTGGTTAAAGCAGAGAGGG + Intergenic
1155371280 18:25103734-25103756 CTCTGTGATGGGAAGAGAGAAGG + Intronic
1155398780 18:25415923-25415945 CTCTGTGATAGGAGCTAAGAGGG - Intergenic
1155524428 18:26702120-26702142 CACAGTGCTCGGAGGAGAGATGG + Intergenic
1156346416 18:36260825-36260847 CACTGTGACGGAGGCAGAGAGGG - Intronic
1156385708 18:36603267-36603289 CACTGTGATGGGTGTACACATGG - Intronic
1156402410 18:36751852-36751874 CACTGTGAAAGGCACAGAGAGGG + Intronic
1157416771 18:47509902-47509924 CACTGTGAGAGTAGCAGAGGAGG + Intergenic
1158082830 18:53614525-53614547 GACTCTGATGGTAGCAGATATGG + Intergenic
1160986183 19:1839998-1840020 CACTGTGAGAGGAGGAGGGAGGG + Intronic
1161482913 19:4519609-4519631 CACTGGGCTGGGAGGAGGGAGGG + Intergenic
1161581422 19:5082976-5082998 CACTGACAGGGGAGCAGGGAGGG - Intronic
1161934869 19:7365426-7365448 CACTGAGATGCAAGCAGTGAAGG + Intronic
1162592666 19:11602857-11602879 CACTGTGAGGAGAGGAGAGTGGG + Intronic
1162792529 19:13070423-13070445 CACAGTGAAAGGAGCAGGGAAGG - Intronic
1162838297 19:13336262-13336284 GACTGTGTTGGGAGAAGAGAAGG - Intronic
1163402784 19:17104290-17104312 CACTGTAGAGGCAGCAGAGAAGG + Intronic
1163739677 19:19003764-19003786 CAGTGAGATGGGAACAGAGCAGG - Intronic
1164305619 19:24002507-24002529 CACTGGGGTGGGAGCAGGGAAGG + Intergenic
1164642707 19:29838107-29838129 CACAGTGGTGGAATCAGAGAGGG - Intergenic
1166184563 19:41131435-41131457 GCCTGTGATGGGAACAGTGAGGG - Intergenic
1166373327 19:42314112-42314134 CACAGTGACGGGATCAGGGAAGG + Intronic
1166414894 19:42588286-42588308 CAGGGAGCTGGGAGCAGAGATGG + Intronic
1166422819 19:42652021-42652043 CAGTGTCAGGGGAGGAGAGAGGG - Intronic
1166543838 19:43622779-43622801 AACTTTGATGGGGGCAGTGAGGG - Exonic
1167623849 19:50573961-50573983 CACTTTGATGGGATGAGACAGGG - Intergenic
1167742240 19:51330538-51330560 CACCGTGATTGGCTCAGAGATGG + Intergenic
1167903125 19:52637218-52637240 CACAGAGATGGGAGAAGAGGCGG - Intronic
1167909303 19:52689323-52689345 CGCTGAGATGGGAGAAGAGGCGG - Intronic
1167934143 19:52892689-52892711 CACAGAGATGGGAGAAGAGGTGG - Intronic
1168097045 19:54121855-54121877 CACAGTGATGGGACCAGTGGAGG + Exonic
1168380855 19:55922140-55922162 CACTGTCATGAGAACAGCGAGGG + Intronic
1168397745 19:56063436-56063458 CATTGCAATGGGAGCAGAAAAGG - Intergenic
1168666672 19:58209790-58209812 TGCTGTGAGGGGAGCAGAGCTGG + Intronic
925671597 2:6315605-6315627 CACGCAGATGGGAGCAGGGAAGG + Intergenic
926273398 2:11385225-11385247 AAGTGAGATGGGACCAGAGAGGG - Intergenic
926414410 2:12634800-12634822 CACTGTGTTGGGAGCCATGAAGG - Intergenic
927380245 2:22471160-22471182 CACTGAGCTGGGAGCTGAGCCGG - Intergenic
927996930 2:27493465-27493487 CACTGTGATGTCACCTGAGAAGG + Exonic
927999025 2:27507063-27507085 CACAGGGGTGGGAGCTGAGAAGG - Intronic
928116049 2:28545834-28545856 CTCTGTGTGGGGAGCAGAGAGGG + Intronic
928275174 2:29894192-29894214 CACTGTGAAGGAAACAGACATGG - Intronic
928945465 2:36768081-36768103 CTCTGCTATGGGAGCGGAGAGGG - Intronic
929335537 2:40739818-40739840 CACTGTGATGTGTGCACACATGG - Intergenic
929481927 2:42317005-42317027 CACTGTGGTGGGTACAGGGAAGG + Intronic
929601545 2:43207679-43207701 CACTGTGATGAGGTCAGTGAGGG + Intergenic
930005359 2:46892200-46892222 AACTGTGAGAAGAGCAGAGAGGG + Intergenic
930752218 2:54945110-54945132 GAATGGGATGGGAGGAGAGAGGG - Intronic
930861541 2:56079264-56079286 CACTGTAAGAGGAACAGAGAGGG + Intergenic
930922244 2:56770145-56770167 CACAGTGATATGAGAAGAGAAGG - Intergenic
931736176 2:65196859-65196881 AATTGCCATGGGAGCAGAGAAGG + Intergenic
932830537 2:74985461-74985483 CCCTGTGATGGGAAGAGAGAGGG - Intergenic
932958595 2:76385781-76385803 CATTGTGATGGCAGAATAGAAGG + Intergenic
933975326 2:87504788-87504810 CACTGGTCTGGGAGAAGAGACGG + Intergenic
935052635 2:99536602-99536624 CCCTGTGATGGGAGTGGAGGAGG + Intergenic
935077070 2:99755655-99755677 AAATTTGAGGGGAGCAGAGATGG - Intronic
936073020 2:109384022-109384044 TCCTCTGATGGAAGCAGAGATGG - Intronic
936318500 2:111446025-111446047 CACTGGTCTGGGAGAAGAGACGG - Intergenic
936719326 2:115231789-115231811 TACTGTGGTGGGAGCATAGAGGG - Intronic
937310686 2:120901233-120901255 GACTGTTATGGAAGCAGAGCTGG + Intronic
937398392 2:121559068-121559090 CACTGTGATGGAGGGAAAGAAGG + Intronic
937996467 2:127698271-127698293 CACTGTGAATGGAGCCCAGAAGG + Intergenic
938322813 2:130376515-130376537 CATTGAGATGGAGGCAGAGATGG + Intergenic
938929969 2:136078062-136078084 TACAATGATGGGAGCGGAGATGG - Intergenic
939094967 2:137824022-137824044 CACTGTAATGGGAACTCAGAAGG - Intergenic
939539628 2:143477304-143477326 CACTGGGATGGAGGCTGAGAAGG + Intronic
941767599 2:169315371-169315393 CTCTGGGATGGGAGCATGGATGG + Intronic
941846551 2:170140100-170140122 CACAGTGGTGGCAGCAGAGTGGG + Intergenic
942288225 2:174443231-174443253 CATTATGATGGGAGCAAAAATGG - Intronic
942454419 2:176128549-176128571 CATTGAAACGGGAGCAGAGAGGG + Intergenic
942471668 2:176267329-176267351 CACTGTGAGGAGAACAGACAGGG + Intergenic
943623841 2:190178400-190178422 CACAGAGAGGAGAGCAGAGAGGG + Intronic
945221727 2:207490457-207490479 CATTGTGAAGGGAGTGGAGAGGG + Intergenic
945474680 2:210266986-210267008 CCCTTTGGTGGGAGAAGAGAAGG + Intergenic
945754884 2:213833855-213833877 CCCTGTGATGGGAGAGGAAAAGG - Intronic
945926004 2:215805152-215805174 CACAGTGATTGGTTCAGAGATGG + Intergenic
947078911 2:226373849-226373871 CACTGTGGTTGGAGCACAGCAGG - Intergenic
947291693 2:228583169-228583191 CACTATCATGGGAGCAGGGTGGG + Intergenic
948665403 2:239531666-239531688 CAGTGTGCAGGGGGCAGAGAAGG - Intergenic
948784200 2:240342925-240342947 CACAGTGATTGGATCAGGGATGG - Intergenic
948953480 2:241270600-241270622 CACTGGATTGGGAGCACAGAAGG - Intronic
949000644 2:241610861-241610883 CACGGGGATGGGGCCAGAGACGG + Intronic
1169076648 20:2764084-2764106 CACTGAGGTGGTAGCAGAGGAGG - Intergenic
1169417029 20:5425993-5426015 GACTGGGATGGGGGCAGGGATGG + Intergenic
1169770354 20:9193121-9193143 CACTGTGCTAGGAGCTGGGATGG + Intronic
1169926112 20:10786108-10786130 AAATGAGATGGGAGAAGAGATGG - Intergenic
1170152367 20:13238941-13238963 ACCAGTGAGGGGAGCAGAGAGGG - Intronic
1170313042 20:15013179-15013201 AACTGTGATTGGGTCAGAGATGG + Intronic
1172134680 20:32679041-32679063 CACTGTGTCGGGGACAGAGATGG + Intergenic
1172161275 20:32870109-32870131 CACTGTGATGTGGGCAGGAAAGG + Intronic
1172244048 20:33433620-33433642 CACTGGAATGGGAGGAGGGAAGG + Intronic
1172854218 20:37988882-37988904 CAGAGTGATGGGAGAAGAGATGG - Intronic
1173364671 20:42374005-42374027 CAGGGAGGTGGGAGCAGAGAGGG + Intronic
1173736021 20:45362123-45362145 AACAGTCATGGCAGCAGAGAGGG + Intronic
1173843279 20:46172956-46172978 CACTGTGATAGATCCAGAGATGG - Intergenic
1174356001 20:49998246-49998268 CACTGTGATGGGAGCAGGTCTGG + Intergenic
1175014635 20:55776436-55776458 CACTCTGAAGGAAACAGAGAGGG + Intergenic
1175193395 20:57226089-57226111 CACTGTGTTTGGAGGAGGGATGG - Intronic
1175412271 20:58778029-58778051 CACTGTGCTGGGAGCTGGGCAGG - Intergenic
1175661201 20:60814059-60814081 CACTGCAATGGGTACAGAGAAGG + Intergenic
1175778388 20:61667121-61667143 CAATGTGATGGAGGCAAAGAAGG + Intronic
1177291840 21:19122609-19122631 CACTGTGATGTGAGCAGGAGGGG + Intergenic
1178375066 21:32059962-32059984 CACTGTTATGAGAGCAGCGCAGG + Intergenic
1178375944 21:32067610-32067632 CACTGTAATTTGGGCAGAGAGGG + Intergenic
1178470101 21:32884845-32884867 CAAGGTGATGGGAGCTAAGACGG - Intergenic
1178603981 21:34019127-34019149 CAGTGAGAAGGGAGCAGGGAGGG - Intergenic
1179167920 21:38949008-38949030 CACTGTGATTGGCCCAGAGCTGG + Intergenic
1179511606 21:41877451-41877473 CACTGTGAGGGGAGCTGAGCAGG + Intronic
1179980487 21:44893246-44893268 CACTCTGACGGGGGCAGGGAGGG - Intronic
1181053574 22:20248948-20248970 CACTGGGGTGGGAGCCGAGGAGG - Intronic
1181171257 22:21011523-21011545 CACTGTGAGGGCGGCACAGAGGG + Intronic
1181178088 22:21048996-21049018 CACTGTGAGGGCGGCACAGAGGG - Exonic
1181735604 22:24879166-24879188 CACAGTGATTGGGGCAGAGATGG - Intronic
1181766797 22:25098125-25098147 CACTGTGATGGGAGAAGCCCAGG + Intronic
1182023801 22:27101701-27101723 CAGTGTGATGGGAGAGGAGATGG + Intergenic
1182041798 22:27243785-27243807 GCCTGTCATGGGTGCAGAGAGGG + Intergenic
1182380984 22:29887507-29887529 CACTGATATGGCAACAGAGAAGG + Intronic
1183604412 22:38860270-38860292 CACTGAGGTGTGGGCAGAGAGGG + Intergenic
1183875663 22:40778315-40778337 CACTGGGATGTCAGCAGACAAGG + Intronic
1183905071 22:41034385-41034407 CACCTAGATGGGAGCTGAGATGG - Intergenic
1184423570 22:44395887-44395909 CAGGGGGATGGGAGCAGAGGCGG + Intergenic
1184478964 22:44736288-44736310 GGCTGTGATGGGAGCAGATGGGG - Intronic
1184901896 22:47451528-47451550 CACTGTGATGGGGGAAGGGAAGG + Intergenic
1185071242 22:48657840-48657862 GCCTGAGCTGGGAGCAGAGAGGG + Intronic
950011200 3:9725093-9725115 CACTGTGATGAGTGCTGTGATGG - Intronic
950904542 3:16525819-16525841 CACAGTGATTGGTTCAGAGATGG - Intergenic
951151694 3:19298275-19298297 CACGGTGATGGAAGAATAGAGGG + Intronic
951548624 3:23854280-23854302 CACAGTGATTGGTTCAGAGAGGG + Intronic
951554039 3:23902910-23902932 CAGTGTTTTGGGAGCAGAAAGGG - Intronic
951931225 3:27969178-27969200 CTGTGTGGTTGGAGCAGAGAGGG - Intergenic
952189418 3:31006851-31006873 CACTGTGATTGGTTCATAGATGG + Intergenic
952332162 3:32374028-32374050 CACAGTGATTGGTTCAGAGATGG + Intergenic
952482279 3:33774014-33774036 TACTGTGATGGAAACAGAGTTGG - Intergenic
953544872 3:43856999-43857021 CAATGTGGTGCGAGGAGAGATGG - Intergenic
953666445 3:44929405-44929427 CACTGTGGTGGGTGGAGAGAAGG + Exonic
954574378 3:51667513-51667535 CACTGAGCTGGGTGCACAGAAGG - Exonic
954827433 3:53386511-53386533 AAGTGTTATGGGAGCAGAGAGGG + Intergenic
956305890 3:67825185-67825207 CACTGGGGTGGTATCAGAGAAGG - Intergenic
957136412 3:76294381-76294403 CACAGTGATGGCAGCAGTGATGG - Intronic
957241583 3:77667271-77667293 GATTGTGATGAGAGAAGAGAGGG - Intergenic
957772064 3:84707367-84707389 AAGAGTGAGGGGAGCAGAGAAGG - Intergenic
958605475 3:96352913-96352935 CACTGTCATGGGAACAGCAAGGG - Intergenic
959228324 3:103615331-103615353 CATTGTGAGGGAAGCAGAGAGGG - Intergenic
959388974 3:105749373-105749395 CACTGGGATGGGAAAAGAAAGGG - Intronic
960718272 3:120599179-120599201 CACAGGAATGGGAGAAGAGAAGG + Intronic
960747465 3:120906375-120906397 CATTTTGATGGGAGCGAAGAAGG - Intergenic
961154522 3:124667606-124667628 CACACTGTTGGGAGCAGAGGAGG - Intronic
961198806 3:125027403-125027425 CTCGGAGATGGGAACAGAGAGGG - Exonic
961505926 3:127370402-127370424 CAGGGTGGTGGGAGCAGAGGGGG + Intergenic
962240634 3:133748102-133748124 GACAGTGATGGGAGGAGACAAGG + Intronic
962478594 3:135779219-135779241 CACAGTGATTGGCTCAGAGATGG + Intergenic
963094119 3:141517511-141517533 CACTGTCATGAGAGCAGCAAGGG + Intronic
963952407 3:151217426-151217448 CAAAGTGGTGGGAGCAGTGAAGG - Intronic
965350068 3:167600365-167600387 CACTGTGGTGGGAAAAGGGAAGG + Intronic
965630896 3:170731437-170731459 CAGTAGGAGGGGAGCAGAGAGGG + Intronic
966381280 3:179347516-179347538 CACTTTGAGGGGAGAAGGGAGGG + Intergenic
966607290 3:181834192-181834214 CACTGGGATGGTGTCAGAGAAGG - Intergenic
967306840 3:188067569-188067591 CTCAGTGATGGGATCTGAGAAGG + Intergenic
968058648 3:195712093-195712115 CCCAGTGATGAGAGGAGAGACGG + Intergenic
968089254 3:195889936-195889958 CACTGTGATGGGAGCTGGGGAGG - Intronic
968520707 4:1033578-1033600 CATTGTGAGGGGACCACAGAAGG - Intergenic
969192396 4:5532841-5532863 AGCAGGGATGGGAGCAGAGATGG + Intergenic
969427764 4:7135685-7135707 CACCGTGCGGGGAGCAGTGAGGG - Intergenic
969569335 4:7999557-7999579 CACTGGCTTGGGAGCAGATAGGG - Intronic
970317883 4:14846705-14846727 CTCTTTCAAGGGAGCAGAGATGG + Intergenic
970609843 4:17714785-17714807 CAGGGTGAGGGTAGCAGAGAGGG + Intronic
971316353 4:25571482-25571504 CACTGTGATGGGATGAAAAAGGG + Intergenic
971425169 4:26508787-26508809 CACTCTGAAGGGTGCAGGGAGGG - Intergenic
973330966 4:48909994-48910016 GAGTGCGATGGGAGCACAGAAGG - Intergenic
973722810 4:53742398-53742420 CACCGTGATTGGTTCAGAGATGG - Intronic
975265313 4:72358012-72358034 CACTTTTTTGGGAGAAGAGAAGG - Intronic
975612025 4:76213221-76213243 CACTGTAAAGGGAACAGAGTCGG + Intronic
977956328 4:103031164-103031186 TACTGTGATGGAAGGAAAGAAGG + Intronic
978044097 4:104105697-104105719 CACTATCATGAGAACAGAGAGGG - Intergenic
978764497 4:112390312-112390334 AACTGAGATGTGAGCTGAGAAGG - Intronic
979447530 4:120832320-120832342 CACTGTCATGAGAACAGAGTAGG + Intronic
979496154 4:121385211-121385233 CACAGTGTTGGGATCAAAGAAGG + Intergenic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
981891885 4:149747930-149747952 CACTGTGATGAGAGCAAACTTGG + Intergenic
982465423 4:155724122-155724144 CAATGTAATGGGAACAAAGAAGG - Intronic
983802701 4:171954784-171954806 CACTGTCAAGAGAGAAGAGAGGG - Intronic
984091289 4:175378518-175378540 CACCTTGATGGTAGCAGGGATGG - Intergenic
985342039 4:188964892-188964914 CACTATGATGGGAACAGCAAAGG - Intergenic
985393295 4:189514460-189514482 CAGGGTGAAGGGAGCAGAGGAGG + Intergenic
985799246 5:1992961-1992983 CAGAGTCATGGGAGCAGTGATGG + Intergenic
986037869 5:3958530-3958552 GACTGTGATGGGAGAAGCGGTGG - Intergenic
986095828 5:4553410-4553432 CACTGAGAAGGGAGCAAAGGTGG - Intergenic
986192339 5:5509207-5509229 CACTGTGAGCTGAGCAGTGACGG + Intergenic
986285414 5:6354988-6355010 CACAGGGAGGGGAGCAGGGAGGG + Intergenic
986419847 5:7568721-7568743 CACTGTGCTGTGAGGAGAGGTGG - Intronic
986465167 5:8013802-8013824 TACTGTAAAGGGAGCAAAGAGGG - Intergenic
986863190 5:11952241-11952263 CACTGTCATGAGAACAGAAAGGG + Intergenic
991615357 5:68491473-68491495 CACTGGGATGTGGGCAGACATGG + Intergenic
991648923 5:68831631-68831653 CACGGTGATTGGTTCAGAGATGG - Intergenic
991920300 5:71650105-71650127 CTCAGTGATGGGAGGAGAGCAGG + Exonic
992030398 5:72715410-72715432 CACTGTGATAAGAGCAGTGGAGG + Intergenic
992338562 5:75798758-75798780 CACTGTGCAGGGAGCCAAGATGG - Intergenic
992953044 5:81879457-81879479 CAGTAAGATGGGAGCAGAAATGG - Intergenic
994129884 5:96214727-96214749 CACTGTGATGAGAACAAAGCAGG + Intergenic
995081393 5:108054531-108054553 CACTGTGGTTTTAGCAGAGAAGG - Intronic
997405581 5:133644126-133644148 CACTGTGCTAGGAGAAAAGAAGG + Intergenic
998113031 5:139516719-139516741 CAATGTGAAGGAAGCAGAGGAGG + Intergenic
998141139 5:139700147-139700169 CACAGTGATTGGTTCAGAGATGG + Intergenic
998799359 5:145853535-145853557 CACTGTGCTTGGTGCATAGAAGG - Intergenic
998934966 5:147225499-147225521 CAATGTGATGGTGGCAGAGCTGG - Intergenic
998971107 5:147593418-147593440 CACTGTCAAAGGAGCTGAGAGGG + Intronic
999180321 5:149665534-149665556 CACAGTGATTGGTTCAGAGATGG + Intergenic
999565885 5:152860902-152860924 CACTGTGATCGGAGCTATGAAGG - Intergenic
999642232 5:153683091-153683113 CCCTGGGATGGGGGGAGAGAGGG + Intronic
999944713 5:156582377-156582399 TACTGTGATGGGTGCATAAAAGG + Intronic
1000020102 5:157311146-157311168 CACTGTGGTGGGAGAAGCCAGGG - Intronic
1000456920 5:161460888-161460910 CATTGTGCAGAGAGCAGAGAAGG + Intronic
1001115686 5:168937417-168937439 CACTGAGAAGGGAGCAGACCAGG + Intronic
1001401028 5:171446518-171446540 CACTGTAAGGGGAGCATAGCAGG + Intronic
1001588290 5:172848327-172848349 CATTGTGATGAGTGCTGAGAAGG + Intronic
1001617989 5:173057330-173057352 CACTGAGAGGGGAGGAGACAGGG + Intronic
1001658259 5:173370763-173370785 CACAGTGATTGGTTCAGAGATGG + Intergenic
1001669689 5:173463427-173463449 CTCTGTGATTGGATGAGAGATGG + Intergenic
1002026355 5:176398380-176398402 CACTCTGATGGGAGGACATAAGG + Intronic
1002096980 5:176837235-176837257 CTCTGTGATGGCAGATGAGATGG - Intronic
1002575601 5:180172180-180172202 CCCTGTGATGAGAGCACAGTGGG + Intronic
1003059026 6:2848128-2848150 AACTTTGATGGAAGCATAGAGGG + Intergenic
1004523553 6:16384646-16384668 CACTATCATGAGAACAGAGAGGG - Intronic
1004755032 6:18601710-18601732 CACTGTGACAGGAGCAGTGTGGG + Intergenic
1005355473 6:24979191-24979213 CAGTGGGAGTGGAGCAGAGAGGG - Intronic
1006116243 6:31777485-31777507 GTCTGTGGTGGGGGCAGAGAGGG - Intergenic
1006267866 6:32940497-32940519 CACTGTGCTAGGAGCTGAGGAGG + Intronic
1006276939 6:33012081-33012103 CAATGGAATGTGAGCAGAGATGG - Intergenic
1007046680 6:38782700-38782722 CAGTGGGATGGGATCAGAAAAGG + Intronic
1007102105 6:39256310-39256332 CACTGTCCTGGGAGCAATGATGG - Intergenic
1007145328 6:39624011-39624033 GAGGGTTATGGGAGCAGAGACGG + Intronic
1007209367 6:40179871-40179893 CACTCTGATGGGTGGAGGGAAGG + Intergenic
1007530830 6:42540561-42540583 CAATGTTATAGGAGCAGAGGCGG - Intergenic
1008743328 6:54636984-54637006 CACTGTGATGAGAACAGCAAAGG + Intergenic
1009402135 6:63269577-63269599 CACTGAGATGGCAGAAGAGAGGG + Intergenic
1009649666 6:66458665-66458687 TACTCTGATGTGAGTAGAGAGGG - Intergenic
1012349772 6:98235857-98235879 CACTATCATGGGAGCAGCGTGGG + Intergenic
1013661906 6:112306623-112306645 CACTGTGCTGGGCACAGAGCAGG + Intergenic
1014873886 6:126631533-126631555 CAATGTGATGAGAGCACAGCTGG - Intergenic
1015431873 6:133141365-133141387 CACTGAGTTGGGAGCTAAGAAGG - Intergenic
1015802681 6:137076671-137076693 CAATGTGCTGGGCACAGAGATGG - Intergenic
1016279685 6:142401220-142401242 CACTTTGTAGGGAGCAAAGAAGG + Intronic
1016764968 6:147782473-147782495 CACTGCACTAGGAGCAGAGATGG - Intergenic
1016912659 6:149214570-149214592 CAGTGTGACTGGAGCACAGAGGG - Intergenic
1017877478 6:158536652-158536674 CCCAGTGCTGGGAGAAGAGAGGG + Exonic
1018788221 6:167125448-167125470 CTCTGTGGTGGTAGCAAAGAGGG - Intronic
1018845386 6:167551961-167551983 CACAGAGATGGTAGCAGACACGG + Intergenic
1018902014 6:168056394-168056416 GGCTGAGATGGGAGCAGAGTCGG + Exonic
1019159526 6:170059851-170059873 AAGTGTGTTGAGAGCAGAGACGG + Intergenic
1019722191 7:2579418-2579440 CACTGTAATGGGGGAGGAGAAGG + Intronic
1020701449 7:11489001-11489023 CAATGCTATGGGAGCAGACAGGG - Intronic
1022036539 7:26539877-26539899 CACTGTGGAGGCAGCAGGGAGGG + Intergenic
1022660007 7:32358075-32358097 CACAGTGCTGGGAGCAGTGCCGG - Intergenic
1023022408 7:36021996-36022018 CACTGTGCTGGGAACACAGCGGG + Intergenic
1023034206 7:36116551-36116573 CTCTGTGAGGGGATCAGGGAGGG - Intergenic
1023346048 7:39272299-39272321 AACTGTGATGGGAGTGGAGGAGG - Intronic
1024818747 7:53302660-53302682 CACTGTGTTTGGAGCTGAGTGGG - Intergenic
1025216550 7:57061018-57061040 CCCTGTGATGGCTTCAGAGATGG - Intergenic
1025627301 7:63233468-63233490 CCCTGTGATGGCTTCAGAGATGG - Intergenic
1025654830 7:63509712-63509734 CCCTGTGATGGCTTCAGAGATGG + Intergenic
1026105358 7:67416678-67416700 CACTGTGTTAGGGGCAGAGGAGG + Intergenic
1026161924 7:67877131-67877153 CAGTGAGAAGGGAGCAGTGAAGG + Intergenic
1027544704 7:79512901-79512923 CATTAAGATTGGAGCAGAGAGGG + Intergenic
1028315201 7:89393030-89393052 CAGTGTGGTGTGAGAAGAGATGG + Intergenic
1029349920 7:100005914-100005936 AAGGGTGATGGGAGCAGAGCTGG - Intergenic
1029568620 7:101356549-101356571 CTCTGTGCTGGGTGCAGCGAAGG - Intergenic
1031256040 7:119450190-119450212 CACTGGCATGGCAGCAGTGAGGG + Intergenic
1032415010 7:131729192-131729214 CAGGGTGATGGGATCATAGAGGG + Intergenic
1033185300 7:139222308-139222330 CAATGCGATGGGAGAAGAGGAGG + Intergenic
1033445008 7:141413116-141413138 CACTGTGAGTGGCGCATAGAAGG - Intronic
1033447795 7:141437518-141437540 CCCTGGGGTGGGTGCAGAGAGGG - Intronic
1033595627 7:142856040-142856062 CCCAGGGATGGGAGGAGAGAGGG - Intronic
1034204753 7:149305606-149305628 CAATGGGAAGGGGGCAGAGAAGG + Intergenic
1034435481 7:151061024-151061046 CTGTGTGGTGGGGGCAGAGAAGG - Intronic
1034505767 7:151489507-151489529 CAGTGTGCTGGTAGCAGAGAAGG - Intronic
1035403177 7:158581401-158581423 CACTGTGAAGGGAGCACACTGGG + Intronic
1035661750 8:1353210-1353232 CCCTGTGCTGGGAGCTGAGATGG - Intergenic
1035937017 8:3852365-3852387 CACTTGGCTGGGAGTAGAGAGGG - Intronic
1036222046 8:6929322-6929344 CACTGTGCTGGGGGCAGGGTGGG - Intergenic
1036634737 8:10541065-10541087 CACAGGGATGGGAGCAGCAATGG + Intronic
1036660470 8:10705118-10705140 CACAGTGATTGGAGCAGACATGG + Intronic
1036918191 8:12825464-12825486 CACTGGGATGGGCTGAGAGAAGG + Intergenic
1037672280 8:21025318-21025340 CTCTGTGATGGGATCACAGCAGG - Intergenic
1037813129 8:22098307-22098329 CAAGGTGCTGGCAGCAGAGATGG + Exonic
1038299458 8:26329341-26329363 AACAGTGATGGGAGCTGGGAGGG - Intronic
1039742587 8:40396077-40396099 CACTCTGTTGGGAGAAGAAAGGG + Intergenic
1039846606 8:41330039-41330061 CACAGTTATGGGTACAGAGAAGG - Intergenic
1040570522 8:48605389-48605411 GACTGTGAATGGAGGAGAGAAGG + Intergenic
1040670474 8:49684185-49684207 CACAGTGCTTGGAGAAGAGAAGG - Intergenic
1040799549 8:51325630-51325652 CACTGGGGTGGTTGCAGAGAAGG - Intronic
1041415427 8:57602772-57602794 TACTGTGAAGGGAGAAGAGAGGG + Intergenic
1042400060 8:68334755-68334777 CACTTTGAGTGGAACAGAGAAGG - Intronic
1042817186 8:72890520-72890542 CAGTGTGATGGGACCGGGGAAGG - Intronic
1045743013 8:105384559-105384581 CAATGTGATGGGATCAGGAAAGG - Intronic
1046774973 8:118154261-118154283 CAGTGTGATGAGAGGACAGATGG - Intergenic
1046827185 8:118704155-118704177 CTCTGTTATGGGAAGAGAGAAGG - Intergenic
1047756451 8:127922671-127922693 CACTGTGTTGGCAGTAGAGTGGG - Intergenic
1047764957 8:127982964-127982986 CAGTGTGATGGGAGTACACAGGG + Intergenic
1047831976 8:128643338-128643360 CACTGTGATGGTTTCAGAGAAGG - Intergenic
1048195600 8:132329546-132329568 TGTTGTGATGGGAGCTGAGAAGG - Intronic
1048660786 8:136598896-136598918 CACTATGATGAGAGCAGAGCAGG - Intergenic
1049245242 8:141558932-141558954 CCCTGTGCTGGGAGCAGGGCTGG + Intergenic
1049383159 8:142327534-142327556 CTCTGTGAGGGGGCCAGAGAGGG - Intronic
1049397064 8:142405804-142405826 AGCTGTGCTGGGAGCAGAGCAGG - Intergenic
1049423647 8:142527662-142527684 CACTGTCTTGGGAGCAGTGTGGG - Intronic
1049794955 8:144493028-144493050 GGCAGTGATGGGAGTAGAGAGGG + Intronic
1050946997 9:11535998-11536020 CACTGGGAAGGAAGCAGGGATGG + Intergenic
1051095155 9:13457687-13457709 GACTGTGCTGGTAGCAGTGAAGG + Intergenic
1052379341 9:27753207-27753229 CAGTGAGATGTGAGCAGAGCAGG + Intergenic
1052971960 9:34382018-34382040 CTTTGTGATGTGAGCACAGACGG - Intronic
1054569518 9:66794904-66794926 CCCTATGATGGGAGTAGAAATGG - Intergenic
1055401109 9:75925135-75925157 AACTGTGATGGGATGAGGGAGGG + Intronic
1055890017 9:81114082-81114104 TATTGTTAGGGGAGCAGAGAGGG - Intergenic
1055951913 9:81737393-81737415 CAATGGACTGGGAGCAGAGATGG + Intergenic
1056069338 9:82969645-82969667 GGCAGTGGTGGGAGCAGAGACGG - Intergenic
1056437241 9:86586754-86586776 AAGAGTGATGTGAGCAGAGAAGG + Intergenic
1056997456 9:91476690-91476712 CTCTGTGATGGTAGCTGAAAAGG + Intergenic
1057191865 9:93092858-93092880 CACTGAGGTGGGAGCAGGGCTGG + Intergenic
1057760650 9:97871276-97871298 CACTGTGATAGGCTCAGTGATGG + Intergenic
1058407259 9:104690922-104690944 CACAGTCATGGGAGGAGACATGG + Intergenic
1059282859 9:113149656-113149678 CACTGTGATGGGGCTGGAGAGGG - Intergenic
1060085721 9:120698928-120698950 TACTGTGATGAGAGAAGACAAGG - Intronic
1061101028 9:128492574-128492596 CAGTCTGATGGGGGCAGGGAGGG - Intronic
1061203579 9:129150656-129150678 CACTGTGGTGGGAGTGGGGACGG + Intergenic
1061264971 9:129499583-129499605 CCCTGGGATGGAAGCAAAGAGGG + Intergenic
1061485134 9:130916701-130916723 CAGTGGGATGGGAGGACAGAGGG + Intronic
1061642626 9:131971255-131971277 CACTGTGAAGAGAGCACAGCTGG + Intronic
1061667373 9:132168433-132168455 CCCTGTGATGTGAGCAGAGCCGG - Intronic
1061821465 9:133229163-133229185 CTCTGTGTGTGGAGCAGAGAGGG - Intergenic
1061833973 9:133317200-133317222 CTCTGTGTGTGGAGCAGAGAGGG + Intergenic
1062237781 9:135520901-135520923 CTCTGTGTGTGGAGCAGAGAGGG + Intergenic
1185633811 X:1536863-1536885 CACTGTCAAGGGAGAAGACAGGG - Intronic
1185703473 X:2249038-2249060 CAGTGTGATAGGAGAACAGATGG - Intronic
1185896063 X:3860047-3860069 GGCTGGGAAGGGAGCAGAGAAGG - Intergenic
1185901182 X:3898473-3898495 GGCTGGGAAGGGAGCAGAGAAGG - Intergenic
1185906296 X:3936911-3936933 GGCTGGGAAGGGAGCAGAGAAGG - Intergenic
1185951300 X:4437379-4437401 CACTGTGAGGGAAACAGTGAAGG - Intergenic
1186487898 X:9947655-9947677 AACTGTGATGTGAGGTGAGAAGG - Exonic
1186557810 X:10578793-10578815 CAGCGTGATGGTAGCAGAAATGG + Intronic
1188854293 X:35173546-35173568 AGCTGTGATGGGAGCAGCCAGGG - Intergenic
1188913985 X:35887591-35887613 CACTGTGTGGACAGCAGAGAGGG + Intergenic
1189262896 X:39690273-39690295 CACTGTGGTGGGAGCTGGGCAGG - Intergenic
1189266663 X:39721973-39721995 CAGTGTGATGTGTGCTGAGAAGG + Intergenic
1190756883 X:53409046-53409068 CTCTGTGGTAAGAGCAGAGAGGG - Exonic
1191954102 X:66625314-66625336 GACTGTTATGGGAGCACAGTGGG + Intronic
1192188674 X:68977138-68977160 TACTGGGATGGTATCAGAGAAGG - Intergenic
1192571463 X:72209615-72209637 CACAGTAATGGTAGTAGAGATGG - Intronic
1192766661 X:74146778-74146800 CACTGTCATGGGAGCATTGGTGG + Intergenic
1194732210 X:97468370-97468392 CACTGTGATGGAAACATAGAAGG + Intronic
1195507301 X:105672665-105672687 CATTGGGATGGTATCAGAGATGG - Intronic
1196764024 X:119226702-119226724 AACTGTGAGGGGAGCAGAATGGG - Intergenic
1197753932 X:129982341-129982363 CACTGGGAGGGGAGGAGAGGAGG - Intronic
1198568867 X:137934175-137934197 CACTATCATGGGAACAGTGAAGG - Intergenic
1198992464 X:142530697-142530719 CACTGTGAAATGAGCAGAGTGGG + Intergenic
1199326064 X:146499817-146499839 CACTGTCATGAGAGCAGTGTAGG - Intergenic
1200072269 X:153535138-153535160 CACTGTGATGGCTGCAGAAGGGG + Intronic
1200734829 Y:6782919-6782941 CACTGGGAGGAGAGCAGAGGAGG + Intergenic