ID: 923337113

View in Genome Browser
Species Human (GRCh38)
Location 1:232979927-232979949
Sequence ATGGGGTCCCACTCCAGCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923337113_923337122 7 Left 923337113 1:232979927-232979949 CCCCAGCTGGAGTGGGACCCCAT 0: 1
1: 0
2: 3
3: 11
4: 169
Right 923337122 1:232979957-232979979 GAGCCTTTCCTGGCACCTCCGGG 0: 1
1: 1
2: 6
3: 82
4: 335
923337113_923337120 -3 Left 923337113 1:232979927-232979949 CCCCAGCTGGAGTGGGACCCCAT 0: 1
1: 0
2: 3
3: 11
4: 169
Right 923337120 1:232979947-232979969 CATCAAGATGGAGCCTTTCCTGG 0: 1
1: 0
2: 1
3: 13
4: 166
923337113_923337121 6 Left 923337113 1:232979927-232979949 CCCCAGCTGGAGTGGGACCCCAT 0: 1
1: 0
2: 3
3: 11
4: 169
Right 923337121 1:232979956-232979978 GGAGCCTTTCCTGGCACCTCCGG 0: 1
1: 0
2: 12
3: 68
4: 357
923337113_923337124 10 Left 923337113 1:232979927-232979949 CCCCAGCTGGAGTGGGACCCCAT 0: 1
1: 0
2: 3
3: 11
4: 169
Right 923337124 1:232979960-232979982 CCTTTCCTGGCACCTCCGGGAGG 0: 1
1: 0
2: 1
3: 15
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923337113 Original CRISPR ATGGGGTCCCACTCCAGCTG GGG (reversed) Exonic
904008473 1:27376252-27376274 CTGAGGTCCCTCTCCAGCTCAGG - Intergenic
904201279 1:28820889-28820911 ATGGGGTCTCAGGCCAGATGCGG - Intronic
904860467 1:33533808-33533830 GTGGGGTTCCACTCCAGGTCAGG + Exonic
905413165 1:37786072-37786094 ATAGGGTCTCACTCCAGCCCAGG - Intergenic
906798846 1:48718823-48718845 AGGGTGTCACACTCCACCTGTGG - Intronic
907475171 1:54700549-54700571 ATGATGTCTCATTCCAGCTGTGG - Intronic
910205276 1:84743305-84743327 AAGGGGGCCAACTCCAGCTCTGG + Intergenic
912864679 1:113246634-113246656 ATAGGGTTCCACTCCAGCAGAGG - Intergenic
913678649 1:121166796-121166818 ATGTGATTCTACTCCAGCTGGGG - Intergenic
914030484 1:143954446-143954468 ATGTGATTCTACTCCAGCTGGGG - Intronic
914158964 1:145113517-145113539 ATGTGATTCTACTCCAGCTGGGG + Intergenic
914902115 1:151716484-151716506 AGGGGGGCCCACTCCTGATGTGG + Exonic
917229315 1:172818975-172818997 GTTGGGTCCCTCCCCAGCTGAGG - Intergenic
917455178 1:175180009-175180031 ATGGGGTTCCCCTCCAGCTTTGG + Intronic
918155895 1:181846289-181846311 ATGGGGTCCCACTCTAGCTAAGG - Intergenic
920465949 1:206185336-206185358 ATGTGATTCTACTCCAGCTGGGG - Intergenic
922696080 1:227731766-227731788 ATGGGATTCCACCCCATCTGTGG + Exonic
923337113 1:232979927-232979949 ATGGGGTCCCACTCCAGCTGGGG - Exonic
1062768124 10:80682-80704 ATGGGGGCCCAGTCCTCCTGTGG + Intergenic
1062969175 10:1633019-1633041 AGGGAGGCCCACTCCAGCAGAGG - Intronic
1063145376 10:3290745-3290767 CTGAGGTCCCACACCTGCTGAGG - Intergenic
1064864312 10:19861753-19861775 ATGTGCTCCAACTCTAGCTGAGG - Intronic
1065603003 10:27388953-27388975 AGGGGGTCCAATTCCAGCTCTGG - Intergenic
1068949186 10:62760443-62760465 GTGAGTTCCCAGTCCAGCTGGGG - Intergenic
1070445287 10:76493399-76493421 ATGGGTTCCCACTCTGGCTCAGG + Intronic
1074443268 10:113497217-113497239 ATGGTGTCCGACTCCACCTCAGG - Intergenic
1074881690 10:117664739-117664761 ATGGGTTCCCACTCCACCTTAGG + Intergenic
1076853775 10:133105485-133105507 ATGTGGGCCAACCCCAGCTGTGG - Intronic
1077007488 11:365150-365172 ATGGGCTCCCACCCCAGCTGTGG + Intergenic
1077182772 11:1223966-1223988 CTGGGGTCTCTCTCCATCTGTGG + Intronic
1077534929 11:3119489-3119511 AAGGGGGCCCACTTCAGGTGGGG + Intronic
1079997520 11:27310372-27310394 ATGGGTTCAAATTCCAGCTGTGG - Intergenic
1080938174 11:36884481-36884503 ATGGGCTCTAACCCCAGCTGAGG - Intergenic
1083738270 11:64694126-64694148 CTGGGGTCTCAGCCCAGCTGTGG - Intronic
1083886673 11:65576506-65576528 ATGGGCCCCCACCCCAGCTTGGG + Intronic
1085203678 11:74717590-74717612 CTGGGGTCTCACTCCTCCTGGGG - Intronic
1089151584 11:116368633-116368655 ATGGAAGCCCACTCCTGCTGGGG - Intergenic
1090102153 11:123809984-123810006 ATGGCGTTGCACTCCAGCTTGGG + Intergenic
1090918068 11:131184343-131184365 ATGGGCTAACAGTCCAGCTGCGG - Intergenic
1091812348 12:3409906-3409928 ATGGGGTGCCGCTTCAGCTCAGG + Intronic
1096304257 12:50460530-50460552 CTGGGGTTCGACACCAGCTGGGG - Intronic
1101226622 12:102694205-102694227 ATGGGTTCCCTATCCTGCTGTGG - Intergenic
1101809540 12:108095764-108095786 ATGGGGTCTCACTCCAACCCAGG + Intergenic
1102020673 12:109680093-109680115 CTGGTTTCCCACCCCAGCTGTGG - Intergenic
1102133973 12:110557300-110557322 ATGGGGTCTCACTCTAGCCCAGG + Intronic
1102788602 12:115624372-115624394 TGGGAGTCACACTCCAGCTGTGG + Intergenic
1104263172 12:127204002-127204024 ATTTGGTCCCAATCCAGCTGTGG + Intergenic
1104645644 12:130495419-130495441 AGGGGGTGACACTTCAGCTGAGG - Intronic
1104662828 12:130623877-130623899 ATGGGGACTCAATCCTGCTGTGG - Intronic
1105255816 13:18743565-18743587 AGGGAGTCCCACTTCAGATGTGG - Intergenic
1106878648 13:34104982-34105004 ACGGGGTCTCACTGGAGCTGAGG - Intergenic
1122173126 14:99893339-99893361 ATGGGGCCCCAGTGCACCTGGGG + Intronic
1122425069 14:101601097-101601119 ATGGCGTCCCACTCCAGTAATGG - Intergenic
1123067801 14:105627089-105627111 CTGGAGTCCCACTGCAGGTGGGG + Intergenic
1123071820 14:105645814-105645836 CTGGAGTCCCACTGCAGGTGGGG + Intergenic
1123091484 14:105744090-105744112 CTGGAGTCCCACTGCAGGTGGGG + Intergenic
1123097253 14:105772431-105772453 CTGGAGTCCCACTGCAGGTGGGG + Intergenic
1123098258 14:105776555-105776577 CTGGAGTCCCACTGCAGGTGGGG - Intergenic
1124079026 15:26474333-26474355 ATGGGGTCCCAGTCCAGCACAGG + Intergenic
1126824942 15:52539648-52539670 ATGGGGTCCCTCTCATGATGTGG + Intergenic
1127358188 15:58221803-58221825 ATGGGGTCACTCTAGAGCTGTGG - Intronic
1131388722 15:92029775-92029797 CTGGGCTCCCAGTGCAGCTGAGG + Intronic
1131514204 15:93066479-93066501 AGGGGGTCCCATCCCAGCAGCGG + Intronic
1132358295 15:101189954-101189976 CTGGGGTCCCAACCCAGCTTTGG + Intronic
1134910255 16:18019386-18019408 TTGAGGTCCCCCTCCCGCTGCGG + Intergenic
1136571627 16:31101229-31101251 TTGGGGTCCAGCCCCAGCTGAGG - Intergenic
1137584386 16:49655520-49655542 ATGGGGTCCCCTTCCACGTGGGG + Intronic
1137610486 16:49814180-49814202 CTGGAGTCCCACTGCTGCTGAGG - Intronic
1137729221 16:50677558-50677580 GTGAGGACCCACTCCAGTTGGGG + Intronic
1141164114 16:81648917-81648939 ATGAGGGCTCACTCCTGCTGGGG - Intronic
1141895933 16:86958846-86958868 GGGGGGTCCCCATCCAGCTGGGG - Intergenic
1145962793 17:28897307-28897329 AGGGGCTCCCCCTCCCGCTGTGG - Intronic
1145993754 17:29094113-29094135 CTGGGTTCCCTCCCCAGCTGTGG + Intronic
1147877177 17:43629891-43629913 ATGAAGTCCCACTTCAGGTGAGG + Intergenic
1148742725 17:49901984-49902006 AGAGGGTGCCCCTCCAGCTGTGG - Intergenic
1148759303 17:49991284-49991306 CTGGGGTACCCCTCCAGATGTGG - Exonic
1151362358 17:73596311-73596333 CTGGGTCCCCACTCCAACTGGGG + Intronic
1152409134 17:80113097-80113119 ATGGGGTGCTTCTCCAGCAGGGG - Intergenic
1152542689 17:80984260-80984282 CTGGGATCTCACTCCAGCTATGG - Intergenic
1154221334 18:12457442-12457464 AAGGGCTCCCGCTCTAGCTGGGG - Intronic
1154435209 18:14337109-14337131 AGGGAGTCCCACTTCAGGTGTGG + Intergenic
1155423612 18:25682574-25682596 ATGGGCTTCCATTGCAGCTGAGG - Intergenic
1155675995 18:28429640-28429662 CTGTGGTACCTCTCCAGCTGAGG + Intergenic
1158147758 18:54335235-54335257 ATGCCGTCGCACTCCAGCTTGGG - Intronic
1158774115 18:60555757-60555779 ATAAGTTCTCACTCCAGCTGTGG - Intergenic
1159014658 18:63091192-63091214 AAGGGGTCCGAATCCAGCCGTGG - Intergenic
1159792352 18:72798098-72798120 ATGGGTTCCCCAACCAGCTGTGG + Intronic
1160990129 19:1857061-1857083 ACGTGGTCCCACTCCCGCCGGGG + Intronic
1162876102 19:13622181-13622203 ATGCCATCACACTCCAGCTGGGG - Intronic
1163333705 19:16658149-16658171 ATGGGGTTGCCCTCCTGCTGGGG - Intronic
1165085824 19:33346527-33346549 CTGGGGTCCCATTCTAGCAGGGG - Intergenic
1165504830 19:36219181-36219203 ATGGGGTCTCACTCTGGCTCAGG + Intronic
1165783679 19:38448349-38448371 GGTGGCTCCCACTCCAGCTGTGG - Exonic
1166517954 19:43461384-43461406 AAGGGCTGCCAATCCAGCTGTGG + Exonic
1167504705 19:49865133-49865155 CTGGGGTTTCACCCCAGCTGCGG + Exonic
1167571087 19:50289669-50289691 ACAGGGTGCCAGTCCAGCTGGGG + Intronic
925921864 2:8644040-8644062 ATGGGGTCCCACCCCAGTCTGGG + Intergenic
927044683 2:19264966-19264988 ATTGTGTCCAACTCCAGCCGAGG + Intergenic
927207081 2:20617501-20617523 ATCACGTCCCTCTCCAGCTGTGG - Intronic
932449341 2:71799566-71799588 ATAGGTTTCAACTCCAGCTGGGG - Intergenic
935354113 2:102182319-102182341 GTGGGGACCCACTCCTGCTTTGG + Intergenic
937369829 2:121289437-121289459 AAAGTGTCCCTCTCCAGCTGCGG - Intergenic
946739205 2:222785311-222785333 ATGGGGTCCACCTCCACTTGTGG - Intergenic
947638283 2:231691675-231691697 ATGCCGTTGCACTCCAGCTGGGG - Intergenic
948749756 2:240124862-240124884 ATGGGGTCCCGCACCTACTGGGG - Intergenic
1168897092 20:1331164-1331186 TGGGGCTCCCAGTCCAGCTGAGG - Intronic
1172693835 20:36808328-36808350 ATGGAGTCTCACTCCAGCCCAGG - Intronic
1174662826 20:52229012-52229034 ATTGGGTTCCACTCCAGCCTGGG + Intergenic
1175203290 20:57292377-57292399 CTGGGGTCACATCCCAGCTGGGG + Intergenic
1175829503 20:61954377-61954399 AAGGGGTCCCACTGCAGCTGGGG + Intronic
1176841829 21:13848592-13848614 AGGGAGTCCCACTTCAGGTGTGG - Intergenic
1178276929 21:31247418-31247440 ATGGGGTCCCACTGTTGCTCAGG + Intronic
1179710061 21:43208149-43208171 AGGGGGTCCCAGTTCAGCTGTGG + Intergenic
1180117991 21:45724715-45724737 ACAGAGTGCCACTCCAGCTGAGG - Intronic
1180118001 21:45724749-45724771 ACAGAGTGCCACTCCAGCTGAGG - Intronic
1180949860 22:19716090-19716112 GTGGGGACCCCCTCCTGCTGAGG + Intronic
1181038573 22:20181515-20181537 CAGGTGTCCCACTGCAGCTGGGG - Intergenic
1183269311 22:36850735-36850757 CTGGGGTCCTTCTGCAGCTGTGG - Intergenic
950368696 3:12508508-12508530 ATGGGGTCTCACCCCTGCTGTGG + Intronic
954805216 3:53215058-53215080 ATGGGGTCTCACTCTTGCTCAGG - Intergenic
955716400 3:61834785-61834807 ATGGAGTCTCACTCCAGCCCAGG - Intronic
959507900 3:107176114-107176136 AGGTGCTCCAACTCCAGCTGTGG + Intergenic
965287501 3:166835663-166835685 ATGTAGTCCCACTCCAGGTTGGG + Intergenic
969347016 4:6576050-6576072 ATGGGAACACACTACAGCTGTGG + Intronic
969531476 4:7733233-7733255 ATGGGGTCCTCCTCCAGGAGGGG - Intronic
971620446 4:28848805-28848827 GTGGGGTACCACATCAGCTGTGG + Intergenic
972023892 4:34352419-34352441 ATGGAGTCTCACTCCAGCCTGGG + Intergenic
973804972 4:54516807-54516829 ATGGCTTCCCACAACAGCTGGGG - Intergenic
974083904 4:57239449-57239471 ATGTGGCCCCCCTGCAGCTGTGG + Intergenic
977479075 4:97550999-97551021 ATGGGGTCCCCTTCCACGTGTGG - Intronic
977531675 4:98207806-98207828 ACAGGGTCTCACTCCAGCTCAGG + Intergenic
980019221 4:127689017-127689039 CTGCACTCCCACTCCAGCTGGGG - Intronic
982642453 4:157980265-157980287 ATGGGGTCACTCTGCAGCAGAGG - Intergenic
982866724 4:160522190-160522212 ATGGAGTTCCACTGCAGCTCTGG + Intergenic
988077422 5:26370254-26370276 ATGTGATCCCACTCCAGCCTGGG + Intergenic
995736225 5:115302836-115302858 ACTGGGCCTCACTCCAGCTGGGG + Intergenic
995798122 5:115962618-115962640 ATGGGGCCCCCTTCCAGCTCAGG + Exonic
997300610 5:132801237-132801259 ACAGGGTCCCACTCCCTCTGAGG + Intronic
997347361 5:133201803-133201825 ATGGGGTCCAAATCCAGCATGGG + Intronic
997464485 5:134078269-134078291 AGGGAGACCCACTCCAGCTGTGG + Intergenic
999297992 5:150472593-150472615 GTGGGTTCCCACACCACCTGTGG + Intergenic
999466860 5:151815493-151815515 TTGTGGTCTCATTCCAGCTGAGG - Intergenic
999777222 5:154821064-154821086 ATTGGGTCCTCCTCCAACTGGGG - Intronic
1002060195 5:176621208-176621230 ATGAGGACCCACCCCAGGTGAGG - Exonic
1002419241 5:179137118-179137140 ATGGGGTCCCCCTCTGGCGGAGG - Intronic
1002814822 6:669727-669749 ATGGTGTGGCCCTCCAGCTGAGG + Intronic
1004268624 6:14173351-14173373 ATGGGGTCTCACTCCTGCCCAGG - Intergenic
1006794433 6:36722593-36722615 CTGGGGTCCCCCTCCAGCCATGG - Exonic
1011650637 6:89503257-89503279 ATGGGGTCCCACTGCTTCTAAGG + Intronic
1014032611 6:116723107-116723129 ATGGGGTACCAGTCTGGCTGAGG + Intronic
1015073335 6:129124372-129124394 ATGGTGTCTCCCTCCAGATGAGG + Intronic
1018223801 6:161608130-161608152 CTGAGGTCCCACTCCTCCTGAGG - Intronic
1018718540 6:166554621-166554643 TGGGGGTCCCACTCCAGCACAGG + Intronic
1019190702 6:170249092-170249114 AGGGGGTCTCACTCCCTCTGGGG + Intergenic
1019540862 7:1550430-1550452 ATGGGGTCCCGGTGCAGCTCAGG - Intronic
1024242807 7:47448341-47448363 CTGGGATCCCACCCCACCTGGGG - Intronic
1026805692 7:73428831-73428853 ATGGGGGCCCACTCCAGGGCAGG + Intergenic
1029345629 7:99976453-99976475 TGAGGGTCCCACCCCAGCTGGGG - Intergenic
1029559017 7:101290185-101290207 TGAGGGTCCCACCCCAGCTGGGG - Intergenic
1031484437 7:122310708-122310730 ATGGGTTGCCAGACCAGCTGGGG - Intergenic
1031995854 7:128230479-128230501 CTGGGGTCCCATTTAAGCTGTGG - Intergenic
1032848882 7:135775428-135775450 ATGTGGTACCATTCCTGCTGTGG + Intergenic
1033525474 7:142209354-142209376 ATGCCCTCCCACTCCAGTTGAGG - Intronic
1034913430 7:155017137-155017159 ATGGGGTCTCAGACCAGCTACGG + Intergenic
1035232273 7:157472494-157472516 ATGGGCTCCCTCTCCTGCAGAGG - Intergenic
1035967807 8:4213757-4213779 ATGGGGTTCCCTGCCAGCTGTGG + Intronic
1038317716 8:26501942-26501964 ATGGGGACCCCTTCCTGCTGTGG + Intronic
1039821234 8:41137268-41137290 ATGGGGCCCAAGGCCAGCTGGGG - Intergenic
1040357787 8:46636488-46636510 ATGAGGTCACTCTCCAGCTTTGG + Intergenic
1048436655 8:134424609-134424631 AGGGGGACCTACCCCAGCTGGGG - Intergenic
1049432443 8:142571583-142571605 AGGGGGTCACTCTCCACCTGGGG + Intergenic
1050204876 9:3186063-3186085 TTGGGGTCCAGCTCCAGCTGAGG + Intergenic
1052969752 9:34370260-34370282 ATTTGGTCCCAGTCCAGCTGGGG - Exonic
1060191500 9:121596373-121596395 ATGTGGTGCCACTGCACCTGTGG + Intronic
1060206269 9:121684569-121684591 TTCGGGTCCCTCTACAGCTGGGG - Intronic
1189313410 X:40035869-40035891 ATGGGCTGGGACTCCAGCTGGGG - Intergenic
1191059339 X:56278208-56278230 ATGGGGAGACACTCCAGCTGAGG - Intronic
1196856651 X:119991051-119991073 ATGGGGTCCCAGCCCAGATCCGG + Intergenic
1198275503 X:135094924-135094946 ATGGGGCCTCTCTCCACCTGGGG + Intergenic
1199541250 X:148960066-148960088 TTGGGGTCCACCCCCAGCTGAGG + Intronic
1202170539 Y:22039054-22039076 ATGTGATTCCACTCCAGCAGAGG + Intergenic
1202220825 Y:22547319-22547341 ATGTGATTCCACTCCAGCAGAGG - Intergenic
1202322288 Y:23648344-23648366 ATGTGATTCCACTCCAGCAGAGG + Intergenic
1202548482 Y:26021712-26021734 ATGTGATTCCACTCCAGCAGAGG - Intergenic