ID: 923339615

View in Genome Browser
Species Human (GRCh38)
Location 1:232996252-232996274
Sequence AGTCAGGGGGGTGTGGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 408}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923339615_923339627 19 Left 923339615 1:232996252-232996274 CCCGCAGCCACACCCCCCTGACT 0: 1
1: 0
2: 1
3: 22
4: 408
Right 923339627 1:232996294-232996316 CACAAGTCACCTGGAAGTACTGG 0: 1
1: 0
2: 0
3: 6
4: 126
923339615_923339624 10 Left 923339615 1:232996252-232996274 CCCGCAGCCACACCCCCCTGACT 0: 1
1: 0
2: 1
3: 22
4: 408
Right 923339624 1:232996285-232996307 TCCAGTCCACACAAGTCACCTGG 0: 1
1: 0
2: 0
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923339615 Original CRISPR AGTCAGGGGGGTGTGGCTGC GGG (reversed) Intronic
900331443 1:2136661-2136683 ACTCAGGAGAGTGTGGCTGGAGG + Intronic
900383344 1:2396647-2396669 ACACATGTGGGTGTGGCTGCTGG + Intronic
900981303 1:6047720-6047742 GGTCAGGGGGCAGTGGCAGCAGG + Intronic
901314781 1:8299223-8299245 AATCAGCTGGGTGTGGTTGCGGG - Intergenic
901498775 1:9638581-9638603 AGTTAGCGGGGTGTGGTGGCGGG + Intergenic
901636005 1:10670424-10670446 AGTCAGGGGCGGGCGGCTGCCGG + Intronic
901646947 1:10721909-10721931 AGACAGGTGGGAGTGGCAGCTGG - Intronic
902582776 1:17419208-17419230 AGTTAGCTGGGTGTGGCAGCGGG + Intronic
902755884 1:18548866-18548888 AGTCATGGTGCTGTGTCTGCAGG - Intergenic
902815508 1:18914221-18914243 AGTCAGGCGAGACTGGCTGCAGG - Intronic
903220437 1:21866188-21866210 AGCCATGGGGGTGGGGCTGACGG + Intronic
903995846 1:27305112-27305134 AGTAGCTGGGGTGTGGCTGCAGG - Exonic
904044652 1:27602385-27602407 AGGCTGGGGGGTCAGGCTGCTGG + Intronic
904753113 1:32753674-32753696 AGTCACGGGGAGGTGGCTGGTGG + Intronic
905356161 1:37386396-37386418 AGGCAGGGCGGTGGGGCTACTGG - Intergenic
905551618 1:38845471-38845493 TGTCAGGGGTGGGTGGCTGGGGG + Intronic
905793925 1:40804707-40804729 ACTCAGGGGGCTGAGGCTGGCGG + Intronic
905911926 1:41661484-41661506 GGTCAGGAGGGTGTGGCGACTGG - Intronic
906077352 1:43061807-43061829 AATTAGCCGGGTGTGGCTGCAGG + Intergenic
906170314 1:43719514-43719536 AATCAGGCGGGTGTGGTGGCGGG + Intronic
906177108 1:43784057-43784079 AGTGAGGGGTGTGTGGTTTCAGG - Intronic
906484790 1:46225997-46226019 ACTCAGGGGGCTGAGGCTGGAGG + Intergenic
907303398 1:53501721-53501743 AGTGAGTGGGGTGGGGCTGGTGG + Intergenic
907795073 1:57708108-57708130 AGTCAGGGAGTGGTAGCTGCAGG - Intronic
908401958 1:63779814-63779836 GTTCTGGGGGGTGTGGCTGGGGG - Intronic
909972173 1:82004000-82004022 AATCAGGGCAGTGAGGCTGCGGG + Intergenic
910401519 1:86842424-86842446 AGTTAGCTGGGTGTGGCGGCAGG + Intergenic
912258031 1:108081045-108081067 AGGCAGGAGAGTGTGGCTCCAGG - Intergenic
913278699 1:117164350-117164372 TGGCAGGGGGGTGGGGTTGCGGG + Intronic
913512413 1:119573817-119573839 CGTCAGGGGGGAGTGGCCCCAGG + Intergenic
917428174 1:174937431-174937453 AATCAGCGGGGTGTGGTGGCGGG - Intronic
917620977 1:176795334-176795356 ACTCAGGAGGAGGTGGCTGCAGG + Intronic
917882247 1:179348733-179348755 AGTCAGGGGGGTTTGCTTTCGGG + Intronic
918345773 1:183605931-183605953 ACTCAGGGGGCTGTGGCAGGAGG + Intergenic
919931180 1:202222390-202222412 AGTCAGGGTGGTGGGGCAGAGGG + Intronic
920374423 1:205499864-205499886 AGTCTTTGGGGTGAGGCTGCAGG - Intergenic
920732067 1:208496821-208496843 AGGAAGGGTGGAGTGGCTGCTGG + Intergenic
921206828 1:212856817-212856839 AGTCAGCGGGGTGAGGTTGAGGG + Intergenic
921356167 1:214286395-214286417 AGTCAGGAGGTTGATGCTGCAGG + Intronic
922277166 1:224089745-224089767 ACTCAGGAGGGTGAGGCTGGAGG - Intergenic
922731959 1:227953344-227953366 AATCAGGGGCTTGTGGCTGTGGG - Intergenic
922806866 1:228394753-228394775 AGTCATCGGGGTCGGGCTGCTGG + Exonic
923298934 1:232622639-232622661 ATTCAGAGGGGTGTGGTTCCTGG - Intergenic
923339615 1:232996252-232996274 AGTCAGGGGGGTGTGGCTGCGGG - Intronic
1062934867 10:1378166-1378188 ATCCAGGAGTGTGTGGCTGCAGG - Intronic
1063475619 10:6326278-6326300 TGTCAGGGGAGTGTGGGTGGTGG + Intergenic
1063598196 10:7456569-7456591 CGTCAGGGGTGAGTGGGTGCTGG - Intergenic
1068404735 10:56574373-56574395 AGTGATGGGGGTGCTGCTGCAGG + Intergenic
1068898391 10:62234419-62234441 ACTCAGGAGGCTGAGGCTGCAGG + Intronic
1069635613 10:69923060-69923082 AGTCAGGGCGCAATGGCTGCAGG + Intronic
1070624547 10:78041357-78041379 AGTCATGGGGCTGGGCCTGCTGG + Intronic
1070800408 10:79242019-79242041 AGGCAGGTGGGTGGGGCTGGGGG + Intronic
1071457748 10:85863726-85863748 GGACAGGAGGGTGTGCCTGCCGG + Intronic
1072617796 10:97060794-97060816 AAACAGGGGGGTGTGGCCTCAGG + Intronic
1073102338 10:101012927-101012949 AGTCAGTGGGGTGTGGCTGGTGG - Intronic
1075221434 10:120588342-120588364 AGGCAGGGGGGTGCATCTGCAGG - Intronic
1075393947 10:122113402-122113424 TGGCAGAGGAGTGTGGCTGCGGG + Intronic
1075609109 10:123836971-123836993 AGTTAGTGGGGGGTGGCTGATGG - Intronic
1076156112 10:128206982-128207004 AGTGAGGTGGGTGAGGCTGCTGG + Intergenic
1076386636 10:130061926-130061948 AGCCAGGGAGGTGGGGCTGAAGG + Intergenic
1076871509 10:133197221-133197243 AGACCGGGGTGTGGGGCTGCCGG - Intronic
1077233545 11:1469219-1469241 AGGCAGGGGGCTGAGGCAGCTGG + Intergenic
1077619666 11:3709421-3709443 AGGCAGGGCGCTGTGGCTCCTGG + Intronic
1077632443 11:3819943-3819965 AGTTAGGGCATTGTGGCTGCTGG - Intronic
1077774827 11:5259001-5259023 AGTCAGGTGGTGGTGGCTGGGGG - Intronic
1081808599 11:45903069-45903091 AGGCAGGGGGCTGGGGCCGCGGG - Exonic
1081907933 11:46680989-46681011 AGTGAGGCGGGTGCGGCGGCTGG - Exonic
1081976187 11:47236519-47236541 AACCCGGGGGGTCTGGCTGCTGG - Intronic
1083061614 11:59878709-59878731 AGTCAGCTGGGTGTGGCAGCGGG + Intergenic
1083747528 11:64744242-64744264 AGTCAGGGAGCTGGGGCCGCAGG - Intronic
1083826283 11:65205744-65205766 CATCAGGGGTGTGTGACTGCAGG - Intronic
1084194441 11:67516484-67516506 AATCAGGGCAGTGTGTCTGCTGG - Intergenic
1085454895 11:76660186-76660208 AGTCAGTGGGGTGTGGAGGAAGG + Exonic
1087582310 11:100073193-100073215 AATCAGCTGGGTGTGGCTGTGGG - Intronic
1087643250 11:100778063-100778085 ACTCAGGAGGCTGAGGCTGCAGG + Intronic
1088553680 11:111039647-111039669 AGTAAGGATGGTGTGGCTGTTGG - Intergenic
1089626423 11:119754031-119754053 GGTCATGGGGGTGAGGGTGCTGG - Intergenic
1089672112 11:120063753-120063775 AGAAAGGGGGGTGTGGCACCAGG + Intergenic
1089928157 11:122281021-122281043 AGTCAAGGGGGTGGGGGCGCTGG - Intergenic
1090269259 11:125374444-125374466 AGTCAGGGGGGTGATCCTGCTGG + Intronic
1090714268 11:129416289-129416311 AGTGAGGAGGGTGTGGCTAGGGG + Intronic
1090807245 11:130210179-130210201 AGTGAAGGTGGTGGGGCTGCCGG + Exonic
1091150861 11:133326885-133326907 AGTGAGGGAGGTGTGGGTGAGGG + Intronic
1091991591 12:4960305-4960327 AGCTGGGGAGGTGTGGCTGCAGG + Intergenic
1092340040 12:7667762-7667784 AGTCAGCTGGGTGTGGTGGCAGG + Intergenic
1092528982 12:9328622-9328644 AATGAGGGCGGTGCGGCTGCAGG + Intergenic
1094480056 12:30874535-30874557 AGTGAGTGGGGTGGGGCTGTGGG - Intergenic
1094527020 12:31238101-31238123 AGGCAGGTGCATGTGGCTGCAGG + Intergenic
1096063585 12:48722336-48722358 AGTCTGGGAGGTGAGGTTGCAGG - Intergenic
1096225926 12:49867022-49867044 AGTGTCGGGGGTGTGGCAGCTGG + Exonic
1096266094 12:50123776-50123798 ACTCAGGAGGGTGAGGCGGCAGG - Intergenic
1096604923 12:52757839-52757861 AATCAGGTGGGTGTGGAGGCAGG - Intergenic
1096647842 12:53047958-53047980 AGAAAGGGGGGTGTGGGTGGAGG + Intronic
1097184946 12:57191529-57191551 AGGCAGGAGGGTGAGGCAGCTGG - Intronic
1097961354 12:65534642-65534664 AGTCAGGGGATTAGGGCTGCAGG + Intergenic
1098975359 12:76896402-76896424 AGTCAGGCAGTAGTGGCTGCAGG + Intergenic
1099719405 12:86341809-86341831 GCTCAGGTGGGTGTGGCTGAAGG - Intronic
1099880168 12:88458509-88458531 ATTCAGGAGGCTGTGGCTGGAGG + Intergenic
1100240238 12:92703842-92703864 AGACACAGGGGTGTAGCTGCTGG - Intronic
1100552312 12:95656496-95656518 ACTCAGGAGGGTGAGGCAGCAGG - Intergenic
1101890728 12:108712423-108712445 AATCAGGTGGGCGTGGTTGCAGG + Intronic
1101920416 12:108928202-108928224 GGTCAGGGGGGTGTGGGGGTTGG - Intronic
1102119897 12:110431754-110431776 AGTTAGGGGGGCGTGGTGGCGGG + Intergenic
1102933317 12:116878722-116878744 ACCCTGGAGGGTGTGGCTGCAGG + Intronic
1103006121 12:117421876-117421898 ACTCAGGGGGCTGAGGCTGGAGG - Intronic
1104379406 12:128293994-128294016 AATCAGGTGGTTGTGTCTGCTGG + Intronic
1104580924 12:130010140-130010162 CTTCAGGGGCGTGTGGGTGCAGG - Intergenic
1106326735 13:28698484-28698506 CCTGAGGGGGTTGTGGCTGCTGG - Intergenic
1107063088 13:36182587-36182609 CTTCTGGTGGGTGTGGCTGCAGG - Intronic
1107204951 13:37773086-37773108 AGTCAGGGGCCTCTGGCTGAAGG + Intronic
1108638883 13:52363338-52363360 AGTCAGGGGGCTGAGGCAGGAGG + Intergenic
1108651059 13:52480213-52480235 AGTCAGGGGGCTGAGGCAGGAGG - Intergenic
1108782372 13:53851785-53851807 ACTCAGGGGGCTGTGGCAGGAGG + Intergenic
1109546692 13:63842281-63842303 TGTCAGGGGGGTATAGGTGCTGG - Intergenic
1110574912 13:77044252-77044274 ACTCAGGGGGCTGAGGCTGGAGG + Intergenic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1112480186 13:99768341-99768363 AATCAGCGGGGTGTGGTGGCAGG - Intronic
1113735034 13:112672440-112672462 AGTAAGGGGCGAGTGGCTGTTGG + Intronic
1115639081 14:35320578-35320600 ATGCAGGTGAGTGTGGCTGCTGG + Intergenic
1116364319 14:44040830-44040852 AGCCAGAGGGGTCTGGATGCAGG - Intergenic
1117211885 14:53509328-53509350 AGGAAGGGGGATGTGGCTGCAGG + Intergenic
1117358129 14:54945859-54945881 AGTGAGGGGCGTATAGCTGCTGG - Intronic
1117906411 14:60593115-60593137 ACTCAGGGGGCTGAGGCTGGAGG + Intergenic
1118590396 14:67396585-67396607 AGAGAGGTGGGTGTGGCTTCTGG - Intronic
1120989668 14:90364057-90364079 AATTAGCCGGGTGTGGCTGCGGG + Intergenic
1122272148 14:100573177-100573199 AGTCTGGGGGGAGGGGCTTCCGG + Intronic
1122272164 14:100573215-100573237 AGTCTGGGGGGAGGGGCTTCCGG + Intronic
1122272180 14:100573253-100573275 AGTCTGGGGGGAGGGGCTTCCGG + Intronic
1122283127 14:100635976-100635998 GCTCAGGGGGTGGTGGCTGCAGG + Intergenic
1122503270 14:102215904-102215926 AGGCAGGGGGGTAGGCCTGCGGG - Intronic
1122563763 14:102636424-102636446 AGTTAGCGGGGTGTGGTGGCAGG - Intronic
1122888100 14:104719485-104719507 AGTGAGGGGGCAGCGGCTGCTGG - Exonic
1123027934 14:105437339-105437361 CCTCATGGGTGTGTGGCTGCAGG + Intronic
1123827824 15:24101299-24101321 AGTCAGTGGGGTGTGGGTCTGGG + Intergenic
1124351813 15:28961332-28961354 CGTCAGTGGGGATTGGCTGCAGG + Intronic
1125457886 15:39879348-39879370 AGTCAAGGCTGTGTGGCTCCTGG - Intronic
1126709920 15:51443884-51443906 AGTGAGGGGCCTGGGGCTGCAGG + Intergenic
1127136266 15:55926925-55926947 AGTTAGCTGGGTGTGGCGGCAGG + Intronic
1127278377 15:57467836-57467858 AATCAGCGGGGTGTGGTGGCAGG - Intronic
1127632373 15:60839035-60839057 AGCCAGGTGGGTGTGGTGGCGGG - Intronic
1127674761 15:61228784-61228806 AGCCAGGGGGGTGAGCCCGCCGG + Intronic
1127841131 15:62833066-62833088 AGTTAGGGGGAAGGGGCTGCAGG + Intronic
1128458516 15:67847901-67847923 AGTGAGGGTGGTGTAGCAGCAGG + Intergenic
1128527346 15:68421548-68421570 AGTGAGGGGGCTGTGGCCACAGG + Intronic
1129519390 15:76176380-76176402 ACTCAGGAGGGGGTGGCTGCTGG + Intronic
1130537263 15:84796071-84796093 AGTAAGCCGGGTGTGGTTGCAGG + Intronic
1130786966 15:87109230-87109252 ACTCAGGGGGCTGAGGCTGAAGG + Intergenic
1130809164 15:87358671-87358693 AGCCAGGGGGTTGTGGATGCAGG - Intergenic
1130901007 15:88206809-88206831 AGACAGATGGCTGTGGCTGCAGG - Intronic
1132477197 16:146139-146161 TGTCATGGGAGTGTGGCTGGTGG + Intergenic
1132548758 16:545599-545621 CGCCAGCGGGGTGTGTCTGCTGG - Intronic
1132600550 16:770776-770798 GGTGAGGGGGGTGGGGCTTCTGG + Intronic
1132627232 16:897304-897326 ACACAGGGGGCTGTCGCTGCAGG - Intronic
1132868623 16:2105692-2105714 GGCCCGGTGGGTGTGGCTGCTGG + Intronic
1134522964 16:14926967-14926989 GGCCCGGTGGGTGTGGCTGCTGG - Intronic
1134549662 16:15133091-15133113 GGCCCGGTGGGTGTGGCTGCTGG + Intronic
1134710631 16:16325618-16325640 GGCCTGGTGGGTGTGGCTGCTGG - Intergenic
1134718802 16:16369906-16369928 GGCCCGGTGGGTGTGGCTGCTGG - Intergenic
1134948970 16:18343027-18343049 GGCCCGGTGGGTGTGGCTGCTGG + Intergenic
1134955954 16:18382253-18382275 GGCCCGGTGGGTGTGGCTGCTGG + Intergenic
1136233618 16:28902119-28902141 GGTTAGGGTGGGGTGGCTGCAGG + Intronic
1136235213 16:28909603-28909625 ACTCAGGAGGGTGAGGCTGCAGG + Intronic
1136631825 16:31493412-31493434 AGTGAGGGGAGTGTGGGTGGCGG + Intronic
1137001560 16:35234452-35234474 TGTCAGGGAGGTGGGGCTTCTGG - Intergenic
1137457252 16:48627369-48627391 AGTCCGGGAGGTTTGGCTCCAGG + Intergenic
1137557780 16:49483716-49483738 AGTCAGGGCACTGGGGCTGCTGG - Intergenic
1138076605 16:54049034-54049056 AGTCAGTGGCATCTGGCTGCTGG - Intronic
1138537623 16:57668241-57668263 AGCCAGAGTGGTGGGGCTGCAGG + Exonic
1139431853 16:66915058-66915080 AGGCAGGGGGCTGTGGAGGCAGG - Intronic
1139439652 16:66959689-66959711 GATCAAGGGGGTGTGGCTGGGGG + Intergenic
1139542389 16:67627944-67627966 AGTCAGCTGGGTGTGGTGGCAGG + Intronic
1140078268 16:71722283-71722305 AATCAGTGGGGTGTGGTGGCGGG + Intronic
1140379775 16:74476031-74476053 AATCAGGTGGGTGTGGTGGCAGG + Intronic
1140810103 16:78568622-78568644 AATCAGCTGGGTGTGGCGGCGGG - Intronic
1141133161 16:81448535-81448557 GGCCAGGCGGGTGAGGCTGCTGG - Intronic
1141858381 16:86700509-86700531 AAGCAGGGGAGTGAGGCTGCCGG + Intergenic
1142009874 16:87708509-87708531 AGGCAGGTGGGGGAGGCTGCGGG + Intronic
1142105346 16:88299539-88299561 AGGCATGGGGCTGTGGCTTCTGG + Intergenic
1142273953 16:89105887-89105909 AGGCAGGTGGGTGTGGGTGCTGG + Intronic
1142342537 16:89532932-89532954 AGTCAGCCGGGTGTGGTGGCAGG + Intronic
1142407761 16:89900703-89900725 ACTCAGGGAGGTCTGTCTGCTGG - Exonic
1142606444 17:1084010-1084032 AGAGAGGGGGGTGTGTGTGCTGG + Intronic
1143361027 17:6371474-6371496 AGTTAGCGGGGTGTGGTAGCAGG + Intergenic
1143524320 17:7463375-7463397 GGGCTGGTGGGTGTGGCTGCAGG + Exonic
1144793138 17:17872929-17872951 AGTCAGGGGAGTGTGGCAGTAGG + Intronic
1145777775 17:27541187-27541209 AGTCAGGGTCTTGTGGGTGCTGG + Intronic
1145840902 17:27993565-27993587 AGTTAGGGGAGTATGGCTGGAGG - Intergenic
1146074897 17:29719103-29719125 AGTCAGAGAGTTGTGGCAGCTGG - Intronic
1146245585 17:31279312-31279334 ATTCAGGGTGGTATGGCTGTAGG - Intronic
1146499791 17:33354533-33354555 AGCCATGGGGGTAGGGCTGCAGG - Intronic
1146658435 17:34648983-34649005 TGTCAGGTGGGGGTGGGTGCAGG - Intergenic
1147258559 17:39196143-39196165 AGACTGGGGGCTTTGGCTGCTGG + Intronic
1147638526 17:41979188-41979210 AATTAGCCGGGTGTGGCTGCAGG + Intronic
1148326402 17:46785769-46785791 AGTCAGAGGGAAGAGGCTGCGGG + Intronic
1148545473 17:48515601-48515623 ACTCAGGAGGCTGTGGCTGGAGG + Intergenic
1149597439 17:57872630-57872652 AGCCAGGGAGAAGTGGCTGCAGG + Intronic
1149668716 17:58385999-58386021 ACTCAGGAGGTTGAGGCTGCAGG + Intronic
1149878004 17:60257596-60257618 AGTCAGGAGGCTGAGGCTGGAGG - Intronic
1149994755 17:61400562-61400584 AGTCCGGGAGGTAGGGCTGCCGG + Exonic
1152401866 17:80071284-80071306 GGTAAAGGGGCTGTGGCTGCGGG - Intronic
1153036107 18:763970-763992 AATCAGCGGGGTGTGGTGGCGGG + Intronic
1153867386 18:9285058-9285080 AATCAGCCGGGTGTGGCCGCGGG + Exonic
1156392139 18:36660429-36660451 AGCCACTGGGGTGAGGCTGCAGG + Intronic
1157471123 18:47989748-47989770 AGTCAGAGAGGTGTGGCTGGTGG + Intergenic
1157492780 18:48136085-48136107 GGGCAGGGGGGCGTGGGTGCTGG + Intronic
1158706871 18:59800572-59800594 AGCCAGGAGGTTGAGGCTGCAGG - Intergenic
1160179509 18:76621653-76621675 ACCAAGGGGGGGGTGGCTGCTGG - Intergenic
1160531468 18:79567501-79567523 GGTCAGGGGGTGCTGGCTGCAGG + Intergenic
1160870123 19:1274179-1274201 AGTCAGGGGGCTGTGACCTCAGG - Intronic
1161062532 19:2222351-2222373 GGTCAGGGGGCTGTGCTTGCTGG - Exonic
1161169118 19:2804268-2804290 AGGTGGGAGGGTGTGGCTGCCGG + Intronic
1161582730 19:5089735-5089757 AGTCAGAGGGGTGTAGCTCTGGG + Intronic
1161644824 19:5446742-5446764 AATCAGCAGGGTGTGGCAGCAGG - Intergenic
1161718042 19:5888137-5888159 ATTCAGCGGGGTGTGGTGGCGGG - Intronic
1162978374 19:14222032-14222054 AATTAGCTGGGTGTGGCTGCAGG + Intergenic
1163020772 19:14479858-14479880 GGCCAAGGGGGTATGGCTGCTGG + Intronic
1163232831 19:16015761-16015783 AGTCAGTGAGGTGTGGATGTGGG + Intergenic
1163530686 19:17847255-17847277 ACTCAGGGGGCTGAGGCAGCAGG + Intronic
1163685411 19:18709384-18709406 CAGCAGGGGGGTGTGGCTCCTGG + Intronic
1164129870 19:22351709-22351731 TGTCAGGTGGGTGTGCCTGTGGG - Intergenic
1164223049 19:23213761-23213783 AGTCAGCCGGGTGTGGTGGCAGG - Intergenic
1164764272 19:30751730-30751752 ATTCAAGGGGGTGTGTTTGCTGG - Intergenic
1167066971 19:47193676-47193698 AATTAGCTGGGTGTGGCTGCAGG + Intronic
1167456595 19:49599556-49599578 TGGCAGGGGGCTGGGGCTGCAGG - Exonic
1167588299 19:50387601-50387623 GGTCAGTTGGCTGTGGCTGCGGG - Intronic
1167759318 19:51434979-51435001 AGTTAGCTGGGTGTGGCGGCGGG - Intergenic
1167891003 19:52539339-52539361 AATCAGACAGGTGTGGCTGCAGG - Intronic
1168047895 19:53807214-53807236 AATCAGGAGGGTGTGGTGGCGGG - Intronic
1168220986 19:54960302-54960324 AGTTAGCTGGGTGTGGCGGCAGG - Intronic
925976876 2:9147994-9148016 GGTCAAGGGGATGTGGCTGGTGG - Intergenic
927278228 2:21279742-21279764 GGTCCGGGGGCTGTGGCAGCAGG - Intergenic
929558734 2:42942396-42942418 AGGCAGGGGGTTGTGGAGGCAGG - Intergenic
930857594 2:56035649-56035671 AGTCAGGAGGGTGAGGCAGGAGG - Intergenic
931625339 2:64252035-64252057 AGTGATGGGGGTGTGGGTGGGGG + Intergenic
931855090 2:66294573-66294595 AGTCAGGGAGGTGAGGCTAGTGG - Intergenic
933314877 2:80704057-80704079 AGTGAGGAGGGTGTGGCTAAGGG - Intergenic
933824603 2:86147663-86147685 AGGAAGAGGGGTGTGGCTGAAGG + Intronic
933828272 2:86184277-86184299 ACTCAGGGGGCTGAGGCTGGAGG - Intronic
934557459 2:95294908-95294930 AGGAAGGGGGGTGTGGTGGCAGG + Intergenic
934716102 2:96545303-96545325 AGTCAGCTGGGTGTGGTGGCAGG - Intronic
934753918 2:96812059-96812081 AGTGAGAGGGACGTGGCTGCTGG + Intergenic
936464366 2:112734004-112734026 AGTCAGGGCTGTCTGGCTCCAGG - Intronic
937149839 2:119678993-119679015 ACTCTTGGGGGTGTGGCTGGGGG - Intergenic
940282311 2:152000774-152000796 GGTCAGGGGCGTGTGAGTGCTGG - Intronic
940727778 2:157354571-157354593 AATCAGGGTGGTGTTGCTGAAGG - Intergenic
941081299 2:161063787-161063809 AGTCTGGGGGGTGTGCCAACAGG - Intergenic
941444770 2:165587255-165587277 AGACAGGGAAGTGTGGGTGCAGG + Intronic
942090195 2:172482591-172482613 AGTATGGGAGGTGTGGGTGCAGG - Intronic
943927986 2:193812344-193812366 AATTAGCGGGGTGTGGCGGCGGG + Intergenic
946326163 2:218985596-218985618 AGGGAGGGGGCTGTGGCTGCTGG - Exonic
947629501 2:231642936-231642958 GCGCAGGAGGGTGTGGCTGCAGG + Intergenic
947972005 2:234332530-234332552 AGACATGGGGCTGTGGCTGTCGG - Intergenic
1171448629 20:25221472-25221494 AGTGAAGGTGGTTTGGCTGCAGG + Intronic
1171752030 20:29060943-29060965 AGTCTGGGGGCTGTGACTGGGGG + Intergenic
1172282082 20:33715071-33715093 ACTCAGGGAGGTGAGGCTGGAGG - Intronic
1172603632 20:36200296-36200318 AGTCATGGGGCTGTTGCTGTTGG + Intronic
1172626962 20:36352821-36352843 AGGCAGGGAGGTGTGGGTGACGG + Intronic
1173471475 20:43326559-43326581 AGTGGGGGAGGAGTGGCTGCAGG - Intergenic
1173500393 20:43548782-43548804 AGCCAGTGGGGTCTGGCTGGGGG - Intronic
1173614786 20:44395536-44395558 AGTGGGGTGGCTGTGGCTGCAGG + Intronic
1173915155 20:46702228-46702250 ACTCAGGGGGCTGAGGCTGAAGG - Intergenic
1175205197 20:57305936-57305958 AATCTGGGAGGTGTGGCTACTGG - Intergenic
1175302899 20:57955553-57955575 AGTCATTGGGGTGAGGCTGCAGG + Intergenic
1176204681 20:63881900-63881922 AGGCAGGATGCTGTGGCTGCAGG - Intronic
1177748080 21:25245542-25245564 AGACAAAGGAGTGTGGCTGCAGG + Intergenic
1177812338 21:25937876-25937898 AGTCAGGAGGCTGTGGTTGGAGG - Intronic
1178567174 21:33698338-33698360 TGTTAGGGGGGAGTGGCAGCAGG - Intronic
1178581090 21:33839330-33839352 GGCCAGGGGAGGGTGGCTGCAGG + Intronic
1178977518 21:37232315-37232337 AGTCCGTGGGGTCTGGCTGCTGG + Intronic
1179104173 21:38383627-38383649 ACTCCGGGGGGTGGGGCTGGAGG + Exonic
1179275477 21:39888425-39888447 AGTGGGGGGAGCGTGGCTGCTGG + Intronic
1179730627 21:43365443-43365465 AGTCACTGGAGTGGGGCTGCAGG + Intergenic
1180190954 21:46162175-46162197 AGACAGTGGGGGGTGGCGGCAGG - Intronic
1180858716 22:19064534-19064556 AGGCAGGGGGCTGGGGGTGCTGG - Intronic
1180918564 22:19506401-19506423 AGTCAGGGAGCTGAGGATGCTGG + Intronic
1181051867 22:20241750-20241772 GCCCAGGGGGGTGAGGCTGCAGG + Exonic
1181495283 22:23284123-23284145 AGTCAGGGTGGGGTCACTGCTGG - Intronic
1181584128 22:23843704-23843726 AGCCAGGGGGCTGAGGCTGGAGG + Intergenic
1182069715 22:27455016-27455038 GGTCAAGAGGGTGTGGCTGGTGG - Intergenic
1182419995 22:30244410-30244432 AGGCAGTGGGCTGTGGGTGCTGG - Intronic
1183441341 22:37824789-37824811 AGTGGGGCTGGTGTGGCTGCTGG + Exonic
1183616247 22:38947582-38947604 AGAGAGGGGGGCGTGGCTGTTGG - Intergenic
1184175904 22:42788552-42788574 GGTCGGGGTGGGGTGGCTGCAGG + Intergenic
1184309805 22:43633889-43633911 GGTCAGGGGGATGTGGCAGAGGG - Intronic
1184371002 22:44082033-44082055 GGTCAGGAGGCAGTGGCTGCTGG + Intronic
1184431033 22:44441689-44441711 AGTCAGGGTGCTGGGGCAGCAGG - Intergenic
1184803911 22:46779855-46779877 AGTCAGAGTGGTGTGGGTGTCGG + Intronic
950097142 3:10336998-10337020 AGGCTGGGAGGGGTGGCTGCGGG + Intronic
950671372 3:14527745-14527767 AATTAGGGGGGTGTGGTGGCAGG + Intronic
951448737 3:22812585-22812607 AATTAGCTGGGTGTGGCTGCGGG - Intergenic
952695813 3:36264246-36264268 GTGCAGGTGGGTGTGGCTGCAGG + Intergenic
954257295 3:49415705-49415727 AGGCAGGGTGGTGTACCTGCTGG + Exonic
954721304 3:52565899-52565921 AATTAGCGGGGTGTGGTTGCAGG + Intronic
954847032 3:53568480-53568502 AGGCAGGGGGATGTGGCAGTGGG - Intronic
954856705 3:53650035-53650057 AGTCAGATGGGCATGGCTGCTGG + Intronic
956812636 3:72879169-72879191 AGTTAAGGGTGTGTGGCTTCTGG - Intergenic
956952636 3:74299746-74299768 AGTGCTGGGGGTGTGGCTGGTGG - Intronic
956969637 3:74507778-74507800 AGTTAGCCGGGTGTGGCAGCTGG - Intronic
957081413 3:75639069-75639091 AGAGAGGAGGGTGTGGCTTCCGG + Intergenic
960955343 3:123027322-123027344 AGCCAGGTAGGTGAGGCTGCGGG - Intronic
961058254 3:123807278-123807300 AGTCAGCTGGGTGTGGTGGCAGG + Intronic
961210140 3:125119311-125119333 AGGCTGGGGTGTGAGGCTGCGGG - Intronic
962876774 3:139541273-139541295 AGGCACTGGGGTGTGGGTGCTGG + Intergenic
963138439 3:141928792-141928814 ACCCAGTGGGGTGTGGCTGGCGG + Intergenic
963198864 3:142566512-142566534 ACTCAGGGGGCTGAGGCTGGAGG + Intronic
964787588 3:160415261-160415283 AGTCAGGAGAGTGAGGCGGCAGG + Intronic
965079880 3:164021842-164021864 TGTTAGGGAAGTGTGGCTGCAGG + Intergenic
967885414 3:194330322-194330344 GTTGATGGGGGTGTGGCTGCAGG + Intergenic
968121361 3:196128230-196128252 ACTCAGGAGGTTGTGGCTGGAGG - Intergenic
969310258 4:6348824-6348846 AGTCTGGGGGGAATGGCTTCAGG - Intronic
969364645 4:6687145-6687167 AGTCAGGGGGATGTGGATGGTGG - Intergenic
969389026 4:6876934-6876956 AGTCAAGGGGGTTTGGAAGCGGG - Intronic
970300045 4:14671618-14671640 TGTCACAGGGGTGTGGATGCAGG - Intergenic
972662435 4:41129327-41129349 AGTCAGGAGGGTGTTGGTGGTGG - Intronic
972751111 4:41990390-41990412 AGTGGGGAGGGCGTGGCTGCAGG - Intergenic
973752840 4:54040727-54040749 AATTAGCTGGGTGTGGCTGCAGG + Intronic
976570504 4:86602837-86602859 AGCCAGGTGTGTGTGGCAGCAGG - Intronic
982142487 4:152339831-152339853 ACTCAGGGGGCTGTGGCAGGAGG + Intronic
983509128 4:168588548-168588570 AGTTAGCCGGGTGTGGCTGCAGG - Intronic
984981611 4:185287425-185287447 AGGCAGGGCAGTGGGGCTGCAGG + Intronic
986494822 5:8331753-8331775 ACTCAGGGAGGTGCAGCTGCAGG - Intergenic
988364159 5:30274129-30274151 AGGGAGGGTGGTGTTGCTGCTGG + Intergenic
988697259 5:33634968-33634990 AGTCAGGAGGGTGGGGCGGGAGG - Intronic
989167643 5:38446543-38446565 AGTCAGAAGGGAGTGGCTGGGGG + Intronic
989408604 5:41091103-41091125 TGTCAGGGGTGGGTGGCTGGGGG + Intergenic
989620580 5:43379969-43379991 AATCAGCGGGGTGTGGTGGCTGG + Exonic
990277723 5:54215788-54215810 AGTCAGGGGTGGGGGGCTGGGGG + Intronic
991004714 5:61816342-61816364 AGACAGCGGGGTCTGGCCGCGGG + Intergenic
991465718 5:66910247-66910269 AGTGCTGGGTGTGTGGCTGCAGG - Intronic
992693673 5:79263500-79263522 AGTCAGGAAGTTGAGGCTGCAGG - Intronic
993333859 5:86633088-86633110 AGTTAGCCGGGTGTGGTTGCAGG + Intergenic
994287736 5:97990752-97990774 ATTCAGGGTGGTATGGCTGTAGG + Intergenic
995548651 5:113257700-113257722 ATGCATGGGGGTGTGGGTGCTGG + Intronic
995740168 5:115347734-115347756 AGTCAGGGGGCTGGAACTGCCGG + Intergenic
999256041 5:150210514-150210536 AGCCAGGGTGCTGGGGCTGCGGG + Exonic
999453757 5:151697899-151697921 AGTCAGGAGGGTGAGGTGGCAGG + Intergenic
1001502489 5:172248859-172248881 AGCCTGGGAGGTGGGGCTGCAGG + Intronic
1001924200 5:175624419-175624441 GGTCCTAGGGGTGTGGCTGCTGG + Intergenic
1003669540 6:8143680-8143702 AATTAGGGGGGTGTGGTGGCGGG - Intergenic
1003707302 6:8547178-8547200 ACTCAGGAGGGTGTGGCAGGAGG - Intergenic
1004022393 6:11787457-11787479 TGTTAGGGAAGTGTGGCTGCAGG - Intronic
1004426935 6:15513128-15513150 TGACAGGAGGGTGTGTCTGCAGG + Intronic
1004619888 6:17323086-17323108 TGTTAGGGAAGTGTGGCTGCAGG + Intergenic
1006583034 6:35087597-35087619 GGACAGTGGGGTGGGGCTGCAGG - Intronic
1007019784 6:38507980-38508002 AATTAGGGGGGTGTGGTGGCGGG - Intronic
1007451843 6:41946074-41946096 TGGCAGAGGGGTGTGGCTCCAGG - Intronic
1007485613 6:42178821-42178843 AGTCATGGTGGTATCGCTGCAGG - Exonic
1008492669 6:52102559-52102581 TGGGAGGAGGGTGTGGCTGCAGG - Intergenic
1009059757 6:58384899-58384921 AGTCAGAGTGTTGGGGCTGCAGG + Intergenic
1009231154 6:61062495-61062517 AGTCAGAGTGTTGGGGCTGCAGG - Intergenic
1009685228 6:66948798-66948820 AGTCAGGGAGCTATGGATGCAGG + Intergenic
1009734848 6:67663142-67663164 AGTGATGGGGGGGTGGCTGTGGG + Intergenic
1010026753 6:71227460-71227482 ATTCAGCAGGGTGTGGCTTCAGG - Intergenic
1010365510 6:75046527-75046549 AGTTAGGCGGGCGTGGCGGCGGG + Intergenic
1012930512 6:105311338-105311360 AGTAAGGGGGGAGTGGATGAAGG - Intronic
1015792958 6:136982380-136982402 AGTCAGGGTGGTCTTCCTGCAGG - Intergenic
1016391764 6:143581720-143581742 AGTCAGGAGGGTGAGGCAGGAGG + Intronic
1018339499 6:162836327-162836349 AGTCAGAGGGCTGTGACTTCAGG + Intronic
1018909258 6:168092518-168092540 AGTCATGGGGGTGGGGCCTCAGG + Intergenic
1019436583 7:1025368-1025390 ACTCACTGGGGTGTGGGTGCTGG + Intronic
1019729213 7:2621254-2621276 GGTCAGGGGTGTGTGGCTGGAGG - Intergenic
1019744338 7:2691229-2691251 GGTCAGGTGGGTGTGGGTGCTGG + Intronic
1019783131 7:2956410-2956432 AGCCAGGAGGTTGAGGCTGCAGG + Intronic
1020073587 7:5243239-5243261 AGCCAGGGTGGGGTGGCTGAGGG - Intergenic
1020142440 7:5619943-5619965 AGTCGGGGAGGTGAGGATGCTGG + Intergenic
1020535590 7:9392038-9392060 AGTCTGGGGGGTGAGGCTGAAGG + Intergenic
1021223207 7:17998189-17998211 ACTCAGAGGGGTGTGGCAGGAGG + Intergenic
1021559556 7:21956394-21956416 AATCAGCTGGGCGTGGCTGCGGG - Intergenic
1022614488 7:31915284-31915306 AGGCATGGGGCTGGGGCTGCTGG - Intronic
1023042153 7:36181228-36181250 AGGCAGTGGGGTGTGGCGGGTGG - Intronic
1023872747 7:44271675-44271697 AGTCAGAGGAGAGGGGCTGCTGG - Intronic
1025780172 7:64594697-64594719 AGTTAGCTGGGTGTGGCAGCGGG - Intergenic
1027355096 7:77346941-77346963 AGGCAGGGGGGTGGGGCGGGGGG - Intronic
1028727971 7:94110823-94110845 AATCAGCCGGGTGTGGCGGCGGG - Intergenic
1029150905 7:98479814-98479836 ACTCAGGGGGCTGAGGCTGGAGG - Intergenic
1029197920 7:98819357-98819379 AGCCGGGTGGGTGTGGTTGCAGG + Intergenic
1029237592 7:99133970-99133992 TGCCAGGGGGGTGCGGCTGAGGG + Intronic
1029563080 7:101316773-101316795 AGTTAGGGGAGTGTGGTTGTGGG + Intronic
1029571273 7:101371196-101371218 AGGCAGGGGGCTGTGCCTGGTGG + Intronic
1034501070 7:151451486-151451508 AGTCAGCTGGGTGTGGTAGCGGG + Intergenic
1034904174 7:154929360-154929382 AGCCAGGTGGTTGAGGCTGCAGG + Intronic
1036124442 8:6049974-6049996 AGTTAGCGGGGTGTGGCGGTAGG + Intergenic
1036544321 8:9751711-9751733 AGGCAGGAGGGGGTGGATGCTGG - Exonic
1036974325 8:13394007-13394029 AGTAAGGAAGGTGTGGCTGTGGG - Intronic
1037525268 8:19718240-19718262 AATTAGAGGGGTGTGGCAGCAGG - Intronic
1037714285 8:21383767-21383789 AGCCAGGTGGGTCTGTCTGCAGG - Intergenic
1037911092 8:22743987-22744009 AGCCTGGGGGTTGTGGCTGCAGG + Intronic
1037986396 8:23293218-23293240 AGGCGAGGGGGTGTGGCTGCGGG + Intronic
1039510227 8:38085936-38085958 AATCAGGGGGCAGTGGCTTCTGG + Intergenic
1039584847 8:38698018-38698040 AGTCAGGGGAGTGGGGCTTTGGG + Intergenic
1039828652 8:41195462-41195484 AGCCTGGGTGGCGTGGCTGCAGG - Intergenic
1040309484 8:46229340-46229362 ACTCAGGGGGATGTGGAGGCAGG + Intergenic
1040333954 8:46406675-46406697 ACTCAGGGGGTTGTTGATGCAGG + Intergenic
1040339731 8:46434472-46434494 AGTCAGGGGGACGTGGAGGCAGG - Intergenic
1040410662 8:47151321-47151343 ACTCAGGAGGCTGAGGCTGCAGG + Intergenic
1041170098 8:55132689-55132711 CTTCAAGGTGGTGTGGCTGCTGG + Intronic
1041249878 8:55923686-55923708 AATCAGGTGGGTATGGCAGCAGG - Intronic
1042270024 8:66945265-66945287 AATCAGCTGGGTGTGGCTGCGGG + Intergenic
1045805093 8:106149886-106149908 GGTCAGAGGGATGTGACTGCTGG + Intergenic
1046204729 8:110978470-110978492 AGTCAGGGTGGTATGGCCGTAGG + Intergenic
1047892793 8:129331128-129331150 AGGAAGGGGGGCGGGGCTGCAGG + Intergenic
1048174904 8:132142831-132142853 GGTCATGGTGTTGTGGCTGCTGG + Intronic
1049006829 8:139860943-139860965 AGCCTGGGAGCTGTGGCTGCCGG + Intronic
1049349946 8:142159134-142159156 TGTCAGGGGGCGGTGACTGCAGG - Intergenic
1049350248 8:142160520-142160542 TGTCAGGGGGCGGTGACTGCAGG + Intergenic
1049421977 8:142521024-142521046 AGGCAGGCGGGTGTGGGGGCAGG + Intronic
1049788299 8:144461819-144461841 AAACTCGGGGGTGTGGCTGCCGG + Intronic
1052120260 9:24706033-24706055 AATCAGCCGGGTGTGGCGGCAGG + Intergenic
1052807539 9:33025743-33025765 AGGCAGGGGCGAGGGGCTGCGGG + Intronic
1052818389 9:33119605-33119627 ACTCAGGAGGCTGAGGCTGCAGG + Intronic
1053000936 9:34577119-34577141 AGTGATGGGGGCGGGGCTGCAGG - Intronic
1053188107 9:36036443-36036465 TGTCAGGGGGCCGTGTCTGCGGG + Exonic
1053241521 9:36499601-36499623 AGCCAGGCAGCTGTGGCTGCAGG - Intergenic
1053527990 9:38848910-38848932 AATCAGCGGGGTGTGGTGGCGGG - Intergenic
1054200211 9:62073343-62073365 AATCAGCGGGGTGTGGTGGCGGG - Intergenic
1054638144 9:67515021-67515043 AATCAGCGGGGTGTGGTGGCGGG + Intergenic
1054762929 9:69019461-69019483 AGTTAGCCGGGTGTGGCGGCAGG + Intergenic
1056476769 9:86960264-86960286 AATCAGTGTGGTTTGGCTGCTGG - Intergenic
1060065923 9:120501112-120501134 GGTCAGGGGGGTCTAGCTGATGG - Intronic
1060850328 9:126869527-126869549 AGGCTGAGGGGTGTGGCAGCAGG + Intronic
1061262831 9:129489476-129489498 AATTAGCCGGGTGTGGCTGCGGG - Intergenic
1061315642 9:129794175-129794197 AATCAGCTGGGTGTGGCAGCGGG + Intergenic
1061874557 9:133537286-133537308 AGCCAGGGGGCTGTGTCTTCTGG + Intronic
1062160815 9:135078733-135078755 AGCCTGGGGGGTGTGGCGGTGGG - Intronic
1062678866 9:137765634-137765656 AGTGAGGGGAGTGGGGCTGGGGG - Intronic
1062717108 9:138016559-138016581 AGTCAGGTGGGTTCGGCAGCAGG + Intronic
1185890089 X:3815587-3815609 ACTGAGGGGCGTCTGGCTGCGGG - Intergenic
1190037141 X:47036033-47036055 ATTCAGGGGGCTGAGGCGGCAGG + Intronic
1190711529 X:53075100-53075122 AGTCAGGGGAATGTGGTGGCAGG - Intronic
1194204341 X:90994449-90994471 TGTCGGGGGGGTGTGGCAGAGGG + Intergenic
1197201764 X:123754577-123754599 AGTCAGCCGGGTGTGGTGGCGGG - Intergenic
1201000387 Y:9466832-9466854 AGGCAGGGGGGTGGGGGGGCTGG + Intergenic