ID: 923340270

View in Genome Browser
Species Human (GRCh38)
Location 1:233000832-233000854
Sequence ATATTCCACTAGAAGAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 315}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923340270_923340273 7 Left 923340270 1:233000832-233000854 CCATCTTTCTTCTAGTGGAATAT 0: 1
1: 0
2: 2
3: 30
4: 315
Right 923340273 1:233000862-233000884 TCCTAGCCTAGCTGCTCTTGAGG 0: 1
1: 0
2: 0
3: 11
4: 116
923340270_923340277 22 Left 923340270 1:233000832-233000854 CCATCTTTCTTCTAGTGGAATAT 0: 1
1: 0
2: 2
3: 30
4: 315
Right 923340277 1:233000877-233000899 TCTTGAGGGCAAATCACCATTGG 0: 1
1: 0
2: 0
3: 5
4: 100
923340270_923340275 8 Left 923340270 1:233000832-233000854 CCATCTTTCTTCTAGTGGAATAT 0: 1
1: 0
2: 2
3: 30
4: 315
Right 923340275 1:233000863-233000885 CCTAGCCTAGCTGCTCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923340270 Original CRISPR ATATTCCACTAGAAGAAAGA TGG (reversed) Intronic
902679704 1:18034344-18034366 ATATTCCAGCAGGAGAAAGATGG + Intergenic
903288249 1:22290582-22290604 ATATTCCATAAGAAAAAAGAAGG + Intergenic
906018112 1:42601280-42601302 ATATTAGAAGAGAAGAAAGACGG + Intronic
907562114 1:55400525-55400547 TTTTTCCATCAGAAGAAAGAGGG - Intergenic
909272363 1:73639743-73639765 ATATTCCAGAAGAACAAAGAGGG + Intergenic
910762824 1:90751656-90751678 GTTTTCCACAAGCAGAAAGATGG + Intergenic
916497459 1:165357975-165357997 ATATGACTCCAGAAGAAAGAGGG + Intergenic
917236881 1:172903189-172903211 ATATTTCATTACAAGCAAGATGG + Intergenic
917400503 1:174643670-174643692 TTACTCCATTAGAATAAAGAAGG + Intronic
918642858 1:186864132-186864154 CTATTCAACCATAAGAAAGAAGG - Intronic
920608381 1:207412648-207412670 ATATTCAAAGAGAAGAAAGGAGG + Intergenic
921596174 1:217055871-217055893 ATATTTTACTAGAAAAGAGAGGG - Intronic
922275840 1:224077461-224077483 ATTTTTCACTAGAAAAAAAAGGG + Intergenic
923340270 1:233000832-233000854 ATATTCCACTAGAAGAAAGATGG - Intronic
924798836 1:247312297-247312319 ATTTGCCACTATAAGAAGGATGG + Intronic
1063279389 10:4608570-4608592 ATCTTTCACTAGAAAAAAAAAGG - Intergenic
1065260318 10:23917045-23917067 ATATTCTATAAGAAGAAAAAAGG - Intronic
1065360154 10:24881876-24881898 ATTATCCACTCGAAGAGAGATGG - Intronic
1065510902 10:26477483-26477505 ATAAACCACTAGGTGAAAGATGG - Intronic
1065736591 10:28758678-28758700 ACAATCCAGTAGAAGAAAAATGG + Intergenic
1066194698 10:33087848-33087870 AAATGCCATTTGAAGAAAGATGG - Intergenic
1066470416 10:35692413-35692435 ATATTGAACTAGAAGTGAGAGGG + Intergenic
1068386630 10:56337356-56337378 AAATTCCATTAGCAGAATGAGGG - Intergenic
1068982534 10:63076595-63076617 ATGTTCCTCTTGAAGACAGAAGG + Intergenic
1069072910 10:64008091-64008113 ATATTCCCCAAGAAGAACCAGGG + Intergenic
1069342135 10:67423372-67423394 ATATTGACATAGAAGAAAGAGGG + Intronic
1069533120 10:69233529-69233551 ATAGCCAACTAGAAGAAACATGG + Intronic
1069614890 10:69800941-69800963 ATATTCCACTAGAGAAAAACTGG - Intergenic
1070448377 10:76531358-76531380 TTCCTCCACTAGAAAAAAGATGG - Intronic
1071216593 10:83410432-83410454 ATCTTGAACTAGAAGAAAGTTGG + Intergenic
1071862230 10:89686072-89686094 ATATACCACCAAAAGAAAGTGGG + Intergenic
1071933705 10:90502292-90502314 ATATTCTACTAGAGGAAAGAAGG - Intergenic
1073506351 10:103995750-103995772 ATATTCTACTAAAAGAAACCAGG - Intronic
1074671257 10:115795103-115795125 ATTTTCCACTAAAAGAAACCAGG - Intronic
1075051692 10:119186995-119187017 ATATTTCACTAAAGGACAGATGG - Intergenic
1076946899 10:133657721-133657743 AAATTTTATTAGAAGAAAGAGGG - Intergenic
1079704500 11:23597102-23597124 GTATTCCAGTAGAAGAAACTGGG + Intergenic
1079893271 11:26085261-26085283 ATATTTCCCAAGAAGAAAGAAGG - Intergenic
1080112662 11:28586029-28586051 ATATACCCCCAAAAGAAAGAAGG - Intergenic
1080414174 11:32054171-32054193 ATGTTCCACTAGAAGGCAGCAGG - Intronic
1080704884 11:34681150-34681172 AAACTCCACTAGAAGATAGCAGG - Intergenic
1085846159 11:80067919-80067941 ACACTTCACTAGAAAAAAGAAGG + Intergenic
1085940562 11:81201612-81201634 ATATGACACTAGCAGAAAAAAGG + Intergenic
1087608080 11:100401587-100401609 ATGTTCCATTAGAGGGAAGATGG - Intergenic
1088161412 11:106875962-106875984 ATATTCCATTACAAGTAAAAAGG + Intronic
1088773173 11:113056064-113056086 CTATTCATCTAGAAAAAAGAAGG + Intronic
1089149496 11:116353974-116353996 TTATTTCACTAGAACAAAGAAGG + Intergenic
1089199618 11:116715908-116715930 AGTTTCCACTAGTAAAAAGAAGG + Intergenic
1089338032 11:117738945-117738967 ACAGTCCACCAGAAGACAGAGGG + Intronic
1091188266 11:133666570-133666592 ATATTCCACTTGTGGAAAAATGG + Intergenic
1092203386 12:6601077-6601099 ATATACCACAAGACCAAAGATGG + Intronic
1092386880 12:8042585-8042607 ATTTTCCAATAGAACACAGAGGG - Intronic
1093401241 12:18749226-18749248 GTATACTGCTAGAAGAAAGAAGG - Intergenic
1093945735 12:25107419-25107441 ATATCCCACAAGAATAAAGGGGG + Intronic
1094790168 12:33903522-33903544 ATATTCTACCAGAGGCAAGATGG - Intergenic
1095041153 12:37442356-37442378 AGCTTCCATTAAAAGAAAGAGGG + Intergenic
1096502555 12:52073756-52073778 AAGTTCCACTACAAGAAGGAGGG + Exonic
1097506781 12:60483619-60483641 ATCTTCCACTGGAAAAGAGAAGG - Intergenic
1099320800 12:81145959-81145981 AAAGTCCACTGGAAGGAAGAGGG - Intronic
1100012203 12:89967159-89967181 ATATACCATTAGAAAAAACAAGG - Intergenic
1101341716 12:103847922-103847944 ACATTCCACTGGAAATAAGATGG - Intergenic
1101691618 12:107087746-107087768 ATCTTACAATAGAAAAAAGAGGG + Intronic
1102170261 12:110836929-110836951 ACATTCAACCAGAAGACAGAAGG + Intergenic
1102986236 12:117280831-117280853 ATATTCCCCCAGAGGACAGACGG - Exonic
1103740707 12:123089461-123089483 ATCTCCCACTAGTAGGAAGAAGG - Intronic
1104117264 12:125761518-125761540 ATAATCAACTAGAAAAAAAATGG - Intergenic
1104168817 12:126259901-126259923 AAATGCCACTAGAGCAAAGAAGG - Intergenic
1104527342 12:129536695-129536717 ATATTCCAGTAATAGAAAGAGGG - Intronic
1107784793 13:43944032-43944054 ATGTTCCAGAAAAAGAAAGAAGG + Intergenic
1108005299 13:45940165-45940187 ATTCTCCACTAAAAGAAACAAGG + Intergenic
1108278580 13:48838062-48838084 AAATTTCACTGGATGAAAGAAGG + Intergenic
1108444199 13:50490646-50490668 AAATTCTACAAGAAGAGAGAGGG - Intronic
1109044047 13:57384830-57384852 ATATTCCAATAAAAGAAAATGGG - Intergenic
1109742924 13:66579482-66579504 ATATTCCAATGGTAGAAAAATGG + Intronic
1110478748 13:75949347-75949369 ATATTCCAGTGGGAGAAAGATGG + Intergenic
1111488594 13:88938519-88938541 ATTTTTCAGTAGCAGAAAGAAGG + Intergenic
1111675884 13:91388171-91388193 ATATTCCTCTCTAAGAAAAAAGG - Intergenic
1113870688 13:113558119-113558141 ATCTTCCGCTAGAAGAACTAGGG + Intergenic
1114412153 14:22511233-22511255 ATATCTCTCTAGAAGAAAGAGGG - Intergenic
1116249949 14:42468870-42468892 ATATTCCACCTTAATAAAGAAGG + Intergenic
1116291235 14:43044588-43044610 TTCTTTCACTAAAAGAAAGAAGG - Intergenic
1117346084 14:54834232-54834254 ATATTCTCCTAGAAGAAATGAGG - Intergenic
1117443488 14:55781112-55781134 ATATTCCAGATGAAGAAACATGG + Intergenic
1117481730 14:56152410-56152432 TTATTCTACTAAAAGGAAGATGG + Intronic
1120124070 14:80719645-80719667 AGAATTCATTAGAAGAAAGAGGG + Intronic
1120985019 14:90327132-90327154 ATTTTCCACTAAAAGAAACCAGG + Intronic
1122818609 14:104328152-104328174 ATTTTCCACTAAAGGAAACAGGG - Intergenic
1202920973 14_KI270723v1_random:30277-30299 AAATTTTATTAGAAGAAAGAGGG - Intergenic
1202923944 14_KI270724v1_random:7304-7326 AAATTTTATTAGAAGAAAGAGGG + Intergenic
1123703662 15:22935051-22935073 ATATTCCAGAAGAAAAAAAATGG + Intronic
1123775665 15:23576721-23576743 ATATTCCAGGAAAACAAAGATGG + Intronic
1124059118 15:26272005-26272027 AAAGTAAACTAGAAGAAAGAAGG - Intergenic
1125233907 15:37489608-37489630 ATATTCTACTTGAAGACTGAGGG + Intergenic
1125872693 15:43116610-43116632 ATCTCGCACAAGAAGAAAGATGG - Intronic
1126293632 15:47111382-47111404 AGTTTCCATTAAAAGAAAGAAGG - Intergenic
1126766128 15:52013057-52013079 ATATTACACAAGACTAAAGAGGG + Intronic
1127540758 15:59936646-59936668 ATATTGTACTAGAAGAGGGAGGG - Intergenic
1128366299 15:67005932-67005954 ATATTCCAGTGGAAAAAAGCCGG + Intergenic
1128440917 15:67707746-67707768 CTTTGCCACTAGGAGAAAGAGGG + Intronic
1128949988 15:71868775-71868797 ATTTACCACTAGAAGACAAAGGG + Intronic
1129085629 15:73087428-73087450 ATATTCCTCATGAACAAAGATGG - Intronic
1129862097 15:78871094-78871116 ATATTCAACTGGAATAAGGAAGG + Intronic
1131285301 15:91051975-91051997 TTATTCAACTTGAAAAAAGAAGG - Intergenic
1131773497 15:95767153-95767175 ATATTCAAATAGCAGAAATAAGG - Intergenic
1137894252 16:52194073-52194095 ATATTTAACTAGAATAAAGAGGG - Intergenic
1138836854 16:60447957-60447979 ATATTCCAAAAGCTGAAAGAAGG + Intergenic
1139159782 16:64490497-64490519 AAATGCCATCAGAAGAAAGAGGG + Intergenic
1140224710 16:73067939-73067961 ATATTCCAGTAGGAGATAGATGG + Intergenic
1140545890 16:75808610-75808632 ATATTCCACTAAAGCAAAGCAGG + Intergenic
1140591059 16:76353208-76353230 ATGATTCACTTGAAGAAAGATGG + Intronic
1141569445 16:84925412-84925434 ATATTGGACTGGAAGGAAGAGGG - Intergenic
1146524831 17:33557981-33558003 ATTTTCTACTAGAAAAAATATGG - Intronic
1147418242 17:40309032-40309054 GTAACCCACTGGAAGAAAGATGG - Intergenic
1149966427 17:61169255-61169277 ATATTCCACTTGAAACAAAATGG + Intronic
1152104408 17:78320511-78320533 AGATTCCACTAAAAAAAAAATGG - Intergenic
1152397503 17:80043292-80043314 ATTTTCCACTAACAGAAACAGGG - Intronic
1153668573 18:7388498-7388520 ACACTCTAATAGAAGAAAGAGGG + Intergenic
1153786734 18:8542210-8542232 ATGTCCCACTACAAAAAAGAAGG + Intergenic
1156048370 18:32902832-32902854 ATGTGCCACTAGGACAAAGAGGG - Intergenic
1156874250 18:41987758-41987780 ATATACATCTAGTAGAAAGAAGG - Intronic
1156978517 18:43256616-43256638 ATATTTCACTGGAAGAAAGTAGG - Intergenic
1157314721 18:46578035-46578057 ATATTCCAGTGGAAGAAATTGGG - Intronic
1158007377 18:52687861-52687883 TTATTGCACTCAAAGAAAGATGG + Intronic
1158036651 18:53039876-53039898 ACATTCCAGTAGGAAAAAGAAGG - Intronic
1160324332 18:77929220-77929242 ACATTGCACTAGGTGAAAGAAGG + Intergenic
1160380211 18:78448820-78448842 ATTCTCCAATAAAAGAAAGAGGG + Intergenic
1164050765 19:21584534-21584556 TTTTTCCACTGGAAAAAAGAAGG + Intergenic
1165908626 19:39209789-39209811 AATTGCCACTAGAAGAAAAACGG + Intergenic
925644021 2:6017670-6017692 AGAATCCACGAGGAGAAAGAAGG - Intergenic
926526009 2:13981818-13981840 ATTTTCCTCTAAAAGAAACAAGG + Intergenic
927683505 2:25155341-25155363 ATGTTCCGTTTGAAGAAAGAAGG + Exonic
931734287 2:65179936-65179958 AAATACAACTAGAAGCAAGAGGG - Intergenic
932980351 2:76657212-76657234 AAATTATACTAGCAGAAAGATGG - Intergenic
933459147 2:82557574-82557596 ATGTTCAACAAGAAAAAAGATGG + Intergenic
934127992 2:88917093-88917115 CTATTCCCCTAGAAGAAAGCAGG + Intergenic
935818872 2:106873927-106873949 AGATTCAACTTGAAGAAAGAGGG + Intronic
936393938 2:112104127-112104149 TTATTCTTCTAGAAGAAAAAAGG + Intronic
937575249 2:123412639-123412661 ATATTCCACCACAAGAAACTAGG + Intergenic
938142395 2:128806875-128806897 GAATTCCAATAGAGGAAAGAAGG - Intergenic
938576358 2:132608056-132608078 ATCTTCCAGTAGGAGAAAAATGG - Intronic
939614012 2:144342395-144342417 ATATTCTACTAAAAGAAAAGAGG - Intergenic
939936139 2:148296230-148296252 ATATTCTATAAGAAGAGAGAAGG - Intronic
940626524 2:156182163-156182185 GTATTCCACTTGAAGTAAAATGG + Intergenic
940755721 2:157680007-157680029 ATAAGCCACTAGTAGAAATAAGG + Intergenic
941036557 2:160575219-160575241 CTATTGCAGTAGAAGAAACAAGG - Intergenic
941242163 2:163052929-163052951 ACATTACACTAGAACAAAGAAGG - Intergenic
942700018 2:178696563-178696585 CTATTCCACTGGAAGAAACTAGG - Intronic
942777194 2:179596333-179596355 AAATTCCACTTGCAGAAAGCAGG - Intronic
943488505 2:188519451-188519473 TTATTGAACTAGAAGAAGGAAGG - Intronic
943785031 2:191867953-191867975 ATATTCCAATAGAATTAAAAAGG - Intergenic
944241296 2:197487661-197487683 ATACTCCACTAAAAGGAAGCAGG - Intronic
944503793 2:200389226-200389248 CTATTCCACTAGAAGCAAGATGG + Exonic
944841700 2:203630119-203630141 ACATTCTAGTAGAAGAAGGAAGG + Intergenic
945174800 2:207032431-207032453 ATATGCAAATAGAAGAAAAAAGG + Intergenic
945417826 2:209597115-209597137 AATTCCCACTAGAAGAAAGGAGG - Intronic
946117613 2:217477272-217477294 ACCATCCACTGGAAGAAAGAAGG + Intronic
946214303 2:218172062-218172084 AAATTCCACTAAAAGAGGGAAGG + Intergenic
946523037 2:220487164-220487186 AAATTCAACCAGAAGACAGAAGG + Intergenic
946536439 2:220634913-220634935 ATTTTCCAGTTGAGGAAAGAAGG - Intergenic
947955156 2:234183390-234183412 ATATTCCAGTAGAAAGGAGAAGG - Intergenic
1170954468 20:20965634-20965656 ATATTCCATTAAAAGGAAGTGGG + Intergenic
1171333473 20:24361588-24361610 AGATTCCTCCAGGAGAAAGAAGG + Intergenic
1171535742 20:25887265-25887287 AGTTTCCATTAAAAGAAAGAGGG + Intergenic
1171572116 20:26262633-26262655 AGTTTCCATTAAAAGAAAGAGGG - Intergenic
1171838703 20:30182511-30182533 AGTTTCCATTAAAAGAAAGATGG + Intergenic
1172308061 20:33895854-33895876 ATAGTCCACCAGAAGAATGGTGG - Intergenic
1173783235 20:45773817-45773839 ATTCTCCAATAAAAGAAAGAAGG + Intronic
1173783253 20:45773938-45773960 ATTCTCCAATAAAAGAAAGAAGG + Intronic
1174806202 20:53606466-53606488 ATCTACAACTAGAAGAAAGTGGG + Intronic
1177851694 21:26356829-26356851 ATATGCCAATAGAACATAGAGGG - Intergenic
1180416286 22:12718948-12718970 ATATACCAGTAAATGAAAGATGG + Intergenic
1184546248 22:45170517-45170539 AGATTCCAAAAGAAGGAAGATGG - Intronic
949144436 3:680109-680131 ATATTCCACTTGATGGAAAATGG + Intergenic
951111852 3:18813140-18813162 AGATTCCACTAGGGGAAAAATGG - Intergenic
951480456 3:23156092-23156114 CTATTCCACCATAACAAAGAAGG + Intergenic
951851597 3:27147284-27147306 ATGTTCCATCAGAAGAGAGAGGG + Intronic
953089069 3:39705572-39705594 AAATTAAACTAAAAGAAAGAGGG - Intergenic
953553025 3:43919182-43919204 AAATTGCTCTAGAAGAAAGAGGG + Intergenic
956958018 3:74363657-74363679 TCATTCCAGTGGAAGAAAGACGG - Intronic
957080560 3:75632695-75632717 AAATTTTATTAGAAGAAAGAGGG + Intergenic
958802600 3:98773905-98773927 ATATTCCGCTAGAAAACAAATGG - Exonic
959146563 3:102553155-102553177 ATGTTCCTCTGGAAGAAATAGGG + Intergenic
959305267 3:104655946-104655968 ATAATACACTATAAGCAAGAGGG - Intergenic
960104279 3:113777260-113777282 GTGTTCCACTAAAAGAAAAAAGG + Intronic
960729217 3:120706761-120706783 ATATGCCACTATAAGAGAGTGGG + Intronic
961143424 3:124574650-124574672 ATGTTCCCCCAGAGGAAAGATGG + Intronic
961708934 3:128811872-128811894 ACAGTCCACTAGAAGAAATGGGG + Intronic
963155547 3:142092163-142092185 ATAATCCACTAGGAGAAGGAGGG - Intronic
963342139 3:144049174-144049196 ATATTCCTTTAGAAGAACAAAGG + Intergenic
963885287 3:150574995-150575017 ATATTCCACAATAGAAAAGATGG - Intronic
964050785 3:152390716-152390738 ATTTGCCACTACAATAAAGAAGG - Intronic
964662196 3:159132479-159132501 AATTTCCAGTAGGAGAAAGATGG + Intronic
964698330 3:159535292-159535314 ATATACCTGTAGAAGAATGATGG - Intronic
965332603 3:167395138-167395160 TTATGCAACTAGAAGAATGAAGG + Intergenic
965367619 3:167820168-167820190 ATATACCACGTGAAGATAGAGGG - Intronic
965421378 3:168463352-168463374 AAATTACTCAAGAAGAAAGAAGG + Intergenic
965433840 3:168621995-168622017 ATTGTCCACAAGAAGAAAGCTGG - Intergenic
965674651 3:171181947-171181969 TTATTCCACAGGAAGCAAGAAGG + Intronic
967673789 3:192271590-192271612 AGATACCATTAGTAGAAAGAAGG - Intronic
967767806 3:193300939-193300961 ATATTCCAAAAGAAGAAACAGGG + Intronic
969342430 4:6550511-6550533 ATATTAAGCTAGAAGAATGAGGG - Intronic
969926514 4:10590777-10590799 ACGTTCAACTAGAGGAAAGAAGG - Intronic
970181782 4:13405206-13405228 ATACCCCAGTAAAAGAAAGAAGG - Intronic
970713345 4:18890181-18890203 ATATTCCACAATCAGAAAGAAGG - Intergenic
971167723 4:24201584-24201606 ATATGCAATTAGAAGAGAGAAGG - Intergenic
972141865 4:35970330-35970352 ATATTATTATAGAAGAAAGATGG + Intronic
972230873 4:37071491-37071513 ATCTTTCACTGGCAGAAAGATGG - Intergenic
973161889 4:47030013-47030035 AAATTCAAATAGAAGAATGAGGG - Intronic
974810625 4:66941491-66941513 ATATTCTACTACAAAACAGAAGG + Intergenic
974834578 4:67232156-67232178 AGAATACACTAGAAAAAAGATGG + Intergenic
975538668 4:75479942-75479964 TTATACCTCTATAAGAAAGAAGG - Exonic
976106962 4:81629588-81629610 GTATTACACCATAAGAAAGAAGG + Intronic
976991132 4:91367795-91367817 ATATTCCACCAAAAAACAGATGG - Intronic
977418028 4:96760169-96760191 ATATTCCATTAGCAGAATGAAGG - Intergenic
979544542 4:121924986-121925008 ATATGGCACTAGATGAAAGTAGG + Intronic
979677689 4:123427883-123427905 TCACTCCACTTGAAGAAAGAGGG + Intergenic
980392756 4:132168403-132168425 ATACTCCACAAGAAGATAAAAGG - Intergenic
981238304 4:142443799-142443821 ATATTAAAGTAGAATAAAGAGGG + Intronic
981243428 4:142506421-142506443 TTATTAGCCTAGAAGAAAGAAGG + Intronic
981553103 4:145961563-145961585 TTTTTCCACTACAAGAAAAAAGG - Intergenic
981893486 4:149767521-149767543 AAATTACACTAGACGAGAGATGG + Intergenic
984542191 4:181053042-181053064 GTATTCCATTTGAGGAAAGAAGG - Intergenic
984578889 4:181487162-181487184 ATTTTCAACTAGAAGATAGAGGG + Intergenic
984784849 4:183558054-183558076 AAATTCCAATAGAAGTAACAGGG + Intergenic
985450356 4:190058520-190058542 AAATTTTATTAGAAGAAAGAGGG - Intergenic
986575560 5:9208997-9209019 ATATTCCCCAGGAAGAAGGAAGG - Intronic
987909551 5:24123701-24123723 ATAGTATAGTAGAAGAAAGAAGG - Intronic
989195298 5:38710535-38710557 ATATTCCACAAGAAGACAAATGG - Intergenic
989953491 5:50329795-50329817 ATATTGCATGATAAGAAAGATGG - Intergenic
990095725 5:52109964-52109986 ATATTCCAGTACAAGCAGGATGG + Intergenic
991080830 5:62597291-62597313 ATTTTCAAGTAGAAGAAAGTAGG + Intronic
991469552 5:66953614-66953636 ATATTCCCCGAGAAGAAATGTGG + Intronic
992306012 5:75438562-75438584 CTCTTCCACAAGAAAAAAGAAGG + Intronic
993790536 5:92203936-92203958 ATATTCCAGTAGATTAAATATGG - Intergenic
995840436 5:116438699-116438721 ATCTTCCAGTAGGAGACAGAAGG - Intergenic
996208435 5:120773711-120773733 AATGTCCACTAGAATAAAGATGG + Intergenic
998384911 5:141751520-141751542 ATAATTTACTAGAAGGAAGATGG + Intergenic
998506453 5:142676118-142676140 ATCTTCCCCTGGAAGAAAAAAGG + Intronic
999999791 5:157126851-157126873 ATATTACATTAAAAGAATGAAGG + Intronic
1000673585 5:164092522-164092544 ATATTCCACAATGGGAAAGACGG + Intergenic
1002827797 6:789470-789492 ATATTTCCCTGGAAAAAAGAAGG - Intergenic
1004137449 6:12981448-12981470 ACATTCTAATAGGAGAAAGAAGG - Intronic
1004284620 6:14309585-14309607 ATATTACACTAAAGGGAAGACGG - Intergenic
1004484547 6:16053666-16053688 ATATAAGACTAGAAGGAAGATGG - Intergenic
1006530615 6:34649919-34649941 TTAATGCACTAGAAGAAAAATGG + Intronic
1008596617 6:53048651-53048673 ACAATGCACTAGAAAAAAGAAGG + Intronic
1009291098 6:61883549-61883571 AAATAACACTAGAAGAAGGATGG + Intronic
1009348178 6:62643283-62643305 ATATTTTACTTGAAGACAGAGGG - Intergenic
1009448666 6:63775126-63775148 AAATTCCATTAGAACACAGATGG + Intronic
1009491028 6:64290958-64290980 ATGTTCCAGTAGATGCAAGAGGG + Intronic
1009566355 6:65316065-65316087 ATAATGCAATAGAAAAAAGAAGG - Intronic
1010247899 6:73678982-73679004 GTATTCCACTAGAAGGAAAGAGG + Intergenic
1011245860 6:85320602-85320624 ACATTACATTAGAAGAAAGACGG - Intergenic
1011284757 6:85711169-85711191 ATGTTCCACTAAAAGAAAGCAGG - Intergenic
1011742042 6:90371808-90371830 ATTTACCAATAGAAGAAATACGG + Intergenic
1013327938 6:109066972-109066994 ATATTGCACCAGAAGAACCAGGG - Intronic
1014410840 6:121118158-121118180 ATATCAAACTAGAAGCAAGATGG + Intronic
1015445858 6:133304062-133304084 ATATTCCACTTGAAGGAACAAGG + Intronic
1016471953 6:144383933-144383955 ATATTCCCCTATAAGACAAATGG - Intronic
1017556311 6:155574618-155574640 AGATTAATCTAGAAGAAAGAGGG - Intergenic
1017752358 6:157499771-157499793 ATATTTCACTTGAAGAAGTAGGG + Intronic
1018577792 6:165277539-165277561 ATAATGCATTATAAGAAAGAGGG - Intergenic
1020365611 7:7377880-7377902 ACATTCCAGAAGAAGAATGAGGG + Intronic
1020720232 7:11735072-11735094 ATAATCAACTAGAAGTTAGAAGG - Intronic
1020926935 7:14340381-14340403 ACATTCCACTTGAAGACAGTGGG - Intronic
1020937593 7:14486593-14486615 CAACTCCACTAGAAGAAAGAGGG + Intronic
1020962801 7:14827077-14827099 ATGGTCTACAAGAAGAAAGAAGG + Intronic
1021398999 7:20187779-20187801 AGATTCCACAAGAAGGGAGAGGG - Intronic
1021836779 7:24684551-24684573 ATCTCCCACTAAAAGAAACAAGG - Intronic
1023366538 7:39469975-39469997 ATATTATACTATAAGAAACATGG - Intronic
1024714746 7:52064845-52064867 ATTTTCCACTGAAAGAAGGAAGG - Intergenic
1024898721 7:54292791-54292813 AAATTCAACTGGAAGCAAGAAGG + Intergenic
1025217869 7:57074657-57074679 AGATTCCCCTAAAAGAAATAAGG + Intergenic
1025287210 7:57673966-57673988 AGTTTCCATTAAAAGAAAGAGGG + Intergenic
1025628780 7:63248295-63248317 AGATTCCCCTAAAAGAAATAAGG + Intergenic
1025653483 7:63495803-63495825 AGATTCCCCTAAAAGAAATAAGG - Intergenic
1026504585 7:70971381-70971403 ATTTCCAAATAGAAGAAAGAAGG - Intergenic
1027768007 7:82370110-82370132 ATATTCCACTTAAAGACAAAAGG + Intronic
1027865841 7:83645608-83645630 ATATTCAGTTAGAAGAGAGAGGG + Intronic
1027895749 7:84042321-84042343 AAATTCCACTAAAAGAAAACAGG + Intronic
1027945318 7:84737666-84737688 ATATTCCAATAAAAGAAACCAGG - Intergenic
1030412225 7:109195441-109195463 ATATAGCACAAGAATAAAGATGG - Intergenic
1030883411 7:114910017-114910039 CTATTCCAATAGAAGACAAATGG - Intergenic
1031801488 7:126252192-126252214 ATATTCCACTAGAATTAGGAAGG - Intergenic
1032243126 7:130181712-130181734 TTGATCCACTAGAAGAAATAAGG + Exonic
1032564169 7:132924061-132924083 CAATTCAACTAGAAGAAAAATGG + Intronic
1032685801 7:134232194-134232216 ATTTTCTACTCAAAGAAAGAAGG - Intronic
1033168612 7:139063989-139064011 ATAATTCACTAGAAGAAGGGGGG - Intronic
1035179378 7:157078158-157078180 TTGTTCCACCAGAAGAAAGGAGG - Intergenic
1037519470 8:19665960-19665982 ATCTTCAACTAGAAAAAAGATGG - Intronic
1037712008 8:21362335-21362357 ATGTTCCAAGAGAAGGAAGAGGG - Intergenic
1038936490 8:32257394-32257416 ATTTTCCAATAAAAGAAATATGG - Intronic
1039097561 8:33903210-33903232 ATTTTCCACATGAAGAAACATGG + Intergenic
1039667729 8:39553965-39553987 ATTTTCCACTAAAAGAAATATGG + Intergenic
1040701105 8:50066928-50066950 AAACTCCACTGGAAAAAAGAAGG + Intronic
1040831192 8:51679154-51679176 ATTTTCAACTAAAAGGAAGAAGG - Intronic
1042237024 8:66623455-66623477 TTATTCCGCAAGAAGAAAGTAGG - Intergenic
1043014171 8:74917843-74917865 ATATTTCTGGAGAAGAAAGAAGG + Intergenic
1046444638 8:114301870-114301892 AAAACACACTAGAAGAAAGAGGG - Intergenic
1048218833 8:132522465-132522487 ATCTTCCAACAGAAAAAAGAAGG + Intergenic
1050351872 9:4747869-4747891 ATATTCCACTAAAGGAAACCAGG - Intergenic
1050439424 9:5645338-5645360 ATATTCCACTTAAACAAAAATGG - Intronic
1050765830 9:9132481-9132503 ATATTAAACTAGATGAAACATGG + Intronic
1050803641 9:9646593-9646615 ATATTCAACTAGATGATAGCTGG - Intronic
1050933236 9:11358056-11358078 AGATTCCAGGAAAAGAAAGATGG + Intergenic
1051313901 9:15808398-15808420 ATATTAGACAAGAAGACAGAGGG + Intronic
1051760607 9:20459166-20459188 ACATTCCACAAGCAGAAATATGG + Intronic
1052004312 9:23328408-23328430 ATATTGCACCTGAAGAAAAATGG - Intergenic
1052137404 9:24930319-24930341 GCAATCCAGTAGAAGAAAGATGG - Intergenic
1052484468 9:29079226-29079248 ATATACCATAAGTAGAAAGAAGG - Intergenic
1052602604 9:30655110-30655132 ATATCTCAGTAGAAGAAAGAAGG - Intergenic
1052910331 9:33875360-33875382 ATTTTCCACAAGAAGTAAAAGGG - Intronic
1055760211 9:79599019-79599041 ACATACCACAAGAGGAAAGATGG - Intronic
1056175620 9:84032080-84032102 ATTTTCCACTAAAAGAAGTAAGG - Intergenic
1056227764 9:84512992-84513014 AGATGCCAACAGAAGAAAGAGGG + Intergenic
1056372713 9:85973350-85973372 ATATACCACCAGAAGGCAGAAGG - Intronic
1056494071 9:87138731-87138753 ATTTTCCCCTAGAAGGTAGAGGG + Intergenic
1057238752 9:93390097-93390119 ATATTCCAGAAGAAAACAGAGGG - Intergenic
1058544759 9:106049149-106049171 ATTATCCACTAGGACAAAGAAGG + Intergenic
1058754922 9:108075402-108075424 ATATTCCATTAGGAGAGAGTTGG + Intergenic
1059903778 9:118958703-118958725 ATATTCACCTACAAGAGAGATGG + Intergenic
1203655356 Un_KI270752v1:18791-18813 ATACTCCAATAGAAGAGAGCAGG - Intergenic
1185860102 X:3569887-3569909 ATTTTCCTCTAAAGGAAAGAAGG + Intergenic
1186100639 X:6152504-6152526 GTTTTCCAGTAGGAGAAAGATGG + Intronic
1186394964 X:9198713-9198735 TTATTTCATTTGAAGAAAGAGGG - Intergenic
1187722698 X:22167919-22167941 ACATTCCAGGAGAAGAAACAGGG - Intronic
1187918462 X:24177738-24177760 ATATTGCACCAGAACAAAAAGGG + Intronic
1187940056 X:24372650-24372672 AACTTCCACTGGAAGTAAGAAGG + Intergenic
1189570615 X:42292059-42292081 GTAGTCCACTAAGAGAAAGAAGG - Intergenic
1189967710 X:46391583-46391605 ATATTTAATTGGAAGAAAGAAGG - Intergenic
1191158971 X:57306598-57306620 AGGTTCAACTAAAAGAAAGAAGG - Intronic
1191879750 X:65833609-65833631 ATATTTGAATAGAAGCAAGATGG + Intergenic
1192917389 X:75666964-75666986 AAATTCCACTGGAAAAATGAAGG - Intergenic
1193420162 X:81273066-81273088 ATATTGAACTAGAACAATGAAGG - Intronic
1193448237 X:81632912-81632934 ATATTCCACCATAAGAAACTGGG - Intergenic
1193655681 X:84194433-84194455 ATATTCAACAAGAACAAAGCTGG - Intergenic
1193822868 X:86187814-86187836 AGATTCCACTATAAGAAAGGAGG + Intronic
1194060383 X:89189387-89189409 ATTGTCCACTGGCAGAAAGAAGG + Intergenic
1195282697 X:103351716-103351738 ATATTCCAGAATAAGGAAGAAGG - Intergenic
1196064626 X:111449590-111449612 ATGTTACATTAAAAGAAAGAAGG + Intergenic
1197009504 X:121544419-121544441 TTATTCCCCAAGATGAAAGATGG + Intergenic
1197263395 X:124339865-124339887 GTATTCTATTAGAAGAAATAAGG + Intronic
1197313859 X:124939694-124939716 ATATTTAATTAGCAGAAAGAGGG - Intronic
1197572917 X:128171467-128171489 ATATTTTACCAGAAGAAACAGGG + Intergenic
1198040511 X:132847000-132847022 ATAGTCCATCAGAAGCAAGAGGG + Intronic
1198181564 X:134214932-134214954 AAAATCCACTAGAATCAAGATGG - Intergenic
1201771619 Y:17621773-17621795 AAATTGTATTAGAAGAAAGAGGG - Intergenic
1201829936 Y:18284213-18284235 AAATTGTATTAGAAGAAAGAGGG + Intergenic