ID: 923344302

View in Genome Browser
Species Human (GRCh38)
Location 1:233036139-233036161
Sequence CGCCATGACGTGGAAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923344302_923344310 22 Left 923344302 1:233036139-233036161 CCTGCAGCTTCCACGTCATGGCG 0: 1
1: 0
2: 1
3: 4
4: 124
Right 923344310 1:233036184-233036206 CTACCCACACTCATTTTCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 102
923344302_923344308 20 Left 923344302 1:233036139-233036161 CCTGCAGCTTCCACGTCATGGCG 0: 1
1: 0
2: 1
3: 4
4: 124
Right 923344308 1:233036182-233036204 TTCTACCCACACTCATTTTCCGG 0: 1
1: 0
2: 1
3: 8
4: 154
923344302_923344309 21 Left 923344302 1:233036139-233036161 CCTGCAGCTTCCACGTCATGGCG 0: 1
1: 0
2: 1
3: 4
4: 124
Right 923344309 1:233036183-233036205 TCTACCCACACTCATTTTCCGGG 0: 1
1: 0
2: 1
3: 20
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923344302 Original CRISPR CGCCATGACGTGGAAGCTGC AGG (reversed) Intronic
904466579 1:30711680-30711702 CGCCATGGCCTGGGAGCTGGCGG - Exonic
907951778 1:59190077-59190099 GGCCAAGAGGTGGAAGCAGCTGG + Intergenic
912746539 1:112249953-112249975 GGGCATGATGGGGAAGCTGCTGG - Intergenic
915233705 1:154465137-154465159 CAAGAAGACGTGGAAGCTGCGGG + Exonic
915304168 1:154968510-154968532 GGCCATGAGGTTGAGGCTGCTGG + Exonic
915661519 1:157409414-157409436 GGCCATGATGTTGAAGCTTCTGG - Intergenic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
920001501 1:202803082-202803104 GCCCAAGAAGTGGAAGCTGCAGG + Intronic
921924231 1:220698356-220698378 CGACATGAAGTTGAAGCTTCAGG - Exonic
922901811 1:229143006-229143028 CACCATGATCTGGTAGCTGCTGG - Intergenic
923344302 1:233036139-233036161 CGCCATGACGTGGAAGCTGCAGG - Intronic
1067497967 10:46775817-46775839 GGCCATGCTGTGGAAGCAGCCGG + Intergenic
1067596681 10:47564597-47564619 GGCCATGCTGTGGAAGCAGCCGG - Intergenic
1071475854 10:86024556-86024578 CACCATGACGTGGATGGTGCCGG + Intronic
1075533464 10:123250206-123250228 CTCTTTGACGTGGAAGCTGCTGG - Intergenic
1076655431 10:132020445-132020467 CACCAAAACTTGGAAGCTGCTGG - Intergenic
1076694783 10:132242247-132242269 GGCCATGAGCTGGGAGCTGCTGG + Intronic
1077422945 11:2461451-2461473 CCCCAGGCCATGGAAGCTGCAGG - Intronic
1077633194 11:3824786-3824808 CCCCCTGAAGTGGAAGCGGCAGG + Intronic
1079163142 11:18012887-18012909 CGCCGAGATGTGGGAGCTGCTGG - Intronic
1080574313 11:33584340-33584362 CACCATGATGGAGAAGCTGCAGG + Intronic
1082641413 11:55665876-55665898 CACCGTGAGGTGGGAGCTGCAGG - Exonic
1083863172 11:65436919-65436941 CTCCTTGAGGTGGAAGCTGGGGG - Intergenic
1084182332 11:67453081-67453103 ACCCAGGAGGTGGAAGCTGCAGG - Intronic
1084390095 11:68869774-68869796 TGACATCAAGTGGAAGCTGCAGG + Intergenic
1085027992 11:73249691-73249713 GGCATTGACGTGAAAGCTGCAGG - Intergenic
1085218053 11:74849550-74849572 CGCCATCACTTGGCAGCTGGCGG + Intronic
1085242622 11:75071337-75071359 CACCAGGAGGTGGGAGCTGCAGG + Intergenic
1085582139 11:77661857-77661879 GAGCATGACGTGCAAGCTGCTGG + Exonic
1090731344 11:129575545-129575567 AGTCATGGTGTGGAAGCTGCAGG - Intergenic
1098227388 12:68338845-68338867 TGCTATGACCAGGAAGCTGCTGG - Intergenic
1103380610 12:120491368-120491390 CTCCATGGGGTGGAAGCTTCCGG + Intronic
1103609396 12:122113342-122113364 GTCCAGGAGGTGGAAGCTGCAGG - Intronic
1104194386 12:126519039-126519061 GGCCATGAGGTCGAGGCTGCAGG - Intergenic
1106132326 13:26950786-26950808 CGCCAGGAGGTGGAGGATGCAGG - Intergenic
1107884998 13:44867783-44867805 AGCCATGAAGTGGAGGCTGTGGG - Intergenic
1117767754 14:59100592-59100614 CGCCATGAGGTAGAATCCGCAGG + Intergenic
1118471206 14:66076948-66076970 AGCCATGACCTGGAAGCTGCTGG - Intergenic
1124002098 15:25768144-25768166 CGGCATGACGAGGAAACCGCTGG + Intronic
1129203738 15:74022948-74022970 CGCCATGACGCAGGCGCTGCAGG + Exonic
1129689041 15:77702804-77702826 AGCCATGCCGCTGAAGCTGCTGG - Intronic
1132580947 16:684386-684408 TGCCACGACGACGAAGCTGCCGG - Exonic
1132975337 16:2708357-2708379 CGACATGCCGTGGGAGCTGCTGG + Exonic
1138201797 16:55094220-55094242 AGGCAGGAAGTGGAAGCTGCTGG - Intergenic
1141378852 16:83557270-83557292 CGCCATAATGTGGAATCTGTGGG - Intronic
1143111485 17:4555368-4555390 TGCCCTGACCTGGAAGCGGCTGG - Exonic
1147226033 17:38978331-38978353 GGCCATGAGGTGGAAGCCACAGG - Intergenic
1147897317 17:43759034-43759056 CGCCAGCACGTGGGAGGTGCCGG - Intergenic
1147973024 17:44229988-44230010 GGCCATGAGGTTGAGGCTGCTGG + Intergenic
1148008361 17:44453600-44453622 GGCCATGAAGTTGAGGCTGCAGG - Intronic
1148477981 17:47941672-47941694 CCCCATGACGTGCTGGCTGCGGG + Exonic
1151921071 17:77155958-77155980 CGCCATGGAGAGGAGGCTGCAGG - Intronic
1151979118 17:77498552-77498574 CGCCTCGAAGTGGATGCTGCTGG - Exonic
1152074514 17:78150660-78150682 CCCCATGACATGAAGGCTGCCGG + Intronic
1152174434 17:78778221-78778243 ACCCAGGAGGTGGAAGCTGCAGG + Intronic
1152566692 17:81103483-81103505 TGCCCTGAAGTGGAAGCAGCAGG - Exonic
1154908645 18:20613874-20613896 CGTCTTTTCGTGGAAGCTGCAGG + Intergenic
1154909160 18:20622034-20622056 CGTCTTTTCGTGGAAGCTGCAGG + Intergenic
1154909590 18:20628621-20628643 CGTCTTTTCGTGGAAGCTGCAGG + Intergenic
1154910792 18:20647558-20647580 CGTCTTTTCGTGGAAGCTGCAGG + Intergenic
1154910951 18:20650114-20650136 CGTCTTTTCGTGGAAGCTGCAGG + Intergenic
1154913083 18:20683590-20683612 CGTCTTTTCGTGGAAGCTGCAGG + Intergenic
1154923355 18:20842773-20842795 CGTCTTTTCGTGGAAGCTGCAGG + Intergenic
1154923561 18:20846176-20846198 CGTCTTTTCGTGGAAGCTGCAGG + Intergenic
1154923765 18:20849578-20849600 CGTCTTTTCGTGGAAGCTGCAGG + Intergenic
1154924017 18:20853464-20853486 CGTCTTTTCGTGGAAGCTGCAGG + Intergenic
1154924454 18:20860442-20860464 CGTCTTTTCGTGGAAGCTGCAGG + Intergenic
1154925066 18:20920180-20920202 CGTCTTTTCGTGGAAGCTGCAGG + Intergenic
1154925270 18:20923583-20923605 CGTCTTTTCGTGGAAGCTGCAGG + Intergenic
1158532251 18:58274032-58274054 AGGCAGGAAGTGGAAGCTGCCGG - Intronic
1160942163 19:1625453-1625475 AGCCAGGACCTGGAAGGTGCGGG + Intronic
1160957426 19:1699982-1700004 CACCAGCACGTGGAAGCTGGTGG + Intergenic
1163045450 19:14638271-14638293 CGCCTTCACCTGGATGCTGCTGG - Exonic
1163059689 19:14751602-14751624 CACCTTGACCTGGATGCTGCTGG - Exonic
1167915134 19:52734512-52734534 CGGCATGAGGAGGAAGGTGCGGG + Intronic
924972556 2:142272-142294 TGCCATCACGTGGCAGATGCTGG + Intergenic
924982722 2:237914-237936 TGCCATGCAGGGGAAGCTGCGGG + Intronic
925164541 2:1708041-1708063 CGCCCAGGCCTGGAAGCTGCAGG + Intronic
927666350 2:25035635-25035657 GGCCATGAAGTGGATGCAGCTGG + Intergenic
931277316 2:60755231-60755253 GTCCAGGACGTGGAGGCTGCAGG - Intergenic
932814140 2:74848534-74848556 TGCCATAACATGGAAGATGCTGG + Intronic
938959917 2:136331641-136331663 CTCCATGGTGTGGAAGGTGCTGG + Intergenic
939070109 2:137529088-137529110 CTCCATGAAGTGGAAGATCCTGG - Intronic
943739462 2:191395615-191395637 CGCCCTGGAGTGGAGGCTGCTGG - Intronic
946722384 2:222623678-222623700 CGACATGACATGGCAGCCGCTGG - Exonic
949063706 2:241976307-241976329 AGCGAAGACGTGGAAGCTGAGGG - Intergenic
1173820183 20:46014364-46014386 CGCCTTCACGTCGAACCTGCGGG - Exonic
1174123619 20:48286769-48286791 GGCCATGAGGTGGCAGCTCCAGG - Intergenic
1175815665 20:61882015-61882037 CGCCAGGAGGTGGAAGAGGCAGG + Intronic
1180559312 22:16602289-16602311 CGCCAAGGCGTGGAGGCCGCGGG - Intergenic
1183417839 22:37692710-37692732 CGCCCTGATGTGGGAGCTCCTGG + Exonic
952845902 3:37688009-37688031 CTCCAGGATGAGGAAGCTGCTGG + Intronic
953322779 3:41987060-41987082 CCCCAGGAGGTGGAGGCTGCAGG + Intergenic
953993253 3:47499932-47499954 CACCAGGACTCGGAAGCTGCAGG - Intronic
961178786 3:124859333-124859355 CCTCAGGACATGGAAGCTGCTGG + Exonic
961558951 3:127715689-127715711 CGGCATGACGAGGAAGCAGTGGG + Intronic
962846451 3:139278441-139278463 GGCCATGACTTGGGAGATGCTGG + Intronic
963267933 3:143257697-143257719 CCCCATTATCTGGAAGCTGCTGG - Intergenic
968191034 3:196667365-196667387 GCCCAGGAGGTGGAAGCTGCAGG + Intronic
973547418 4:51995724-51995746 TACGATGACATGGAAGCTGCGGG - Exonic
975610630 4:76199248-76199270 TGCCATGGGGTGGCAGCTGCTGG - Intronic
975720567 4:77244948-77244970 TGCCATGACAGGGATGCTGCTGG + Intronic
991341271 5:65612740-65612762 AGCCAGGAAGTGGAGGCTGCAGG + Intronic
993880079 5:93351459-93351481 GGGCATGATTTGGAAGCTGCAGG - Intergenic
999240316 5:150124004-150124026 CACCATGGTCTGGAAGCTGCTGG + Intronic
999461593 5:151761402-151761424 GGCTATGAAGTGGAAGCTGAGGG + Intronic
1000337466 5:160252503-160252525 CTCCAAGACGTGGAATCTTCCGG + Exonic
1013355482 6:109342521-109342543 CGCGAGGATGTGGAAGCAGCAGG + Intergenic
1017338656 6:153292818-153292840 CCCCATGATGTGGAACCTGTTGG - Intergenic
1018605822 6:165596651-165596673 GCCCATGAGGTGGAGGCTGCAGG + Intronic
1020006163 7:4784736-4784758 GGCCGTGATGGGGAAGCTGCCGG + Intronic
1022739693 7:33109332-33109354 CGCGAGGACGTGGGGGCTGCGGG - Exonic
1024671766 7:51602216-51602238 CTCCATGACCTGCAGGCTGCTGG + Intergenic
1026360413 7:69597984-69598006 CGCCAGGGCGTGGAAGCCGCCGG - Intergenic
1043968880 8:86508615-86508637 CGCCATGACCTGCAACTTGCGGG + Exonic
1047208348 8:122820938-122820960 CTCCCTGACATGGAAGCAGCAGG + Intronic
1047422926 8:124722013-124722035 CTCCATGCCCAGGAAGCTGCTGG + Intronic
1049671144 8:143870388-143870410 GGCCATGAGGCAGAAGCTGCTGG - Exonic
1054918458 9:70518072-70518094 ATCCATGAGGTGGAAGTTGCTGG + Intergenic
1061788198 9:133043610-133043632 GGCCATGTGGTGGAGGCTGCAGG - Intronic
1061891424 9:133622935-133622957 GGCCATGACGGTGGAGCTGCAGG + Intergenic
1062529908 9:136995277-136995299 CGCCAGGCTGGGGAAGCTGCGGG + Exonic
1185603838 X:1355686-1355708 GGCCAGGAAGTGGAAGCTTCAGG + Intronic
1187019615 X:15366839-15366861 AGCCATGAAGCTGAAGCTGCAGG - Intronic
1191740665 X:64433112-64433134 AACCATGACGTTGAGGCTGCTGG - Intergenic
1191770790 X:64756148-64756170 TGCCATGAAGTGTGAGCTGCAGG - Intergenic
1202174114 Y:22081803-22081825 CGCCATGCCAAGGAAGCAGCAGG + Intronic
1202217246 Y:22504579-22504601 CGCCATGCCAAGGAAGCAGCAGG - Intronic
1202325940 Y:23691480-23691502 CGCCATGCCAAGGAAGCAGCAGG + Intergenic
1202544831 Y:25978574-25978596 CGCCATGCCAAGGAAGCAGCAGG - Intergenic