ID: 923349515

View in Genome Browser
Species Human (GRCh38)
Location 1:233089925-233089947
Sequence CAAGAGAGACAGGTTTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 371}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923349507_923349515 19 Left 923349507 1:233089883-233089905 CCCTGAGACCCAAGAGCTGAGTC 0: 1
1: 0
2: 2
3: 9
4: 189
Right 923349515 1:233089925-233089947 CAAGAGAGACAGGTTTGGCCTGG 0: 1
1: 0
2: 3
3: 51
4: 371
923349508_923349515 18 Left 923349508 1:233089884-233089906 CCTGAGACCCAAGAGCTGAGTCA 0: 1
1: 0
2: 4
3: 17
4: 210
Right 923349515 1:233089925-233089947 CAAGAGAGACAGGTTTGGCCTGG 0: 1
1: 0
2: 3
3: 51
4: 371
923349510_923349515 10 Left 923349510 1:233089892-233089914 CCAAGAGCTGAGTCAATGAACTG 0: 1
1: 0
2: 0
3: 7
4: 141
Right 923349515 1:233089925-233089947 CAAGAGAGACAGGTTTGGCCTGG 0: 1
1: 0
2: 3
3: 51
4: 371
923349506_923349515 25 Left 923349506 1:233089877-233089899 CCAGATCCCTGAGACCCAAGAGC 0: 1
1: 0
2: 3
3: 11
4: 273
Right 923349515 1:233089925-233089947 CAAGAGAGACAGGTTTGGCCTGG 0: 1
1: 0
2: 3
3: 51
4: 371
923349509_923349515 11 Left 923349509 1:233089891-233089913 CCCAAGAGCTGAGTCAATGAACT 0: 1
1: 0
2: 0
3: 11
4: 123
Right 923349515 1:233089925-233089947 CAAGAGAGACAGGTTTGGCCTGG 0: 1
1: 0
2: 3
3: 51
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923349515 Original CRISPR CAAGAGAGACAGGTTTGGCC TGG Intronic