ID: 923351027

View in Genome Browser
Species Human (GRCh38)
Location 1:233106840-233106862
Sequence TGTAAGTTAGATATCCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923351027 Original CRISPR TGTAAGTTAGATATCCAGAG AGG (reversed) Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
904999778 1:34659114-34659136 TGTCAGTTGGATTTCCAAAGGGG - Intergenic
908651996 1:66344005-66344027 TATGAGTGAGAGATCCAGAGTGG - Intronic
909468298 1:75999388-75999410 TCTAAGTTTGAGATACAGAGAGG - Intergenic
911264470 1:95726823-95726845 TGAAGGTAAGATTTCCAGAGAGG - Intergenic
912623527 1:111189419-111189441 TGGAACTGAGATCTCCAGAGGGG - Intronic
916117089 1:161494797-161494819 AGTAAGATAAATATCTAGAGTGG - Intergenic
917410349 1:174753962-174753984 TATAGGTCTGATATCCAGAGAGG - Intronic
917563257 1:176182137-176182159 TGTAACTTACATATCCATTGTGG - Intronic
919221869 1:194640033-194640055 TGTAAGTCCAAAATCCAGAGAGG - Intergenic
919409607 1:197227346-197227368 TGCAAGTTCGAAATCCAGAAGGG + Intergenic
921030286 1:211330252-211330274 AGTAAGTGAGATATCCTGGGAGG - Intronic
921610470 1:217207032-217207054 TGCAAGTTAGAAATTCAGTGAGG - Intergenic
921894391 1:220384262-220384284 TGTATGCCAGATATACAGAGAGG + Intergenic
922709065 1:227813550-227813572 TGCAAGTCAGAAATCCAGCGGGG + Intergenic
923351027 1:233106840-233106862 TGTAAGTTAGATATCCAGAGAGG - Intronic
1064918496 10:20489062-20489084 TGTAGGTTAGATATCTAAAATGG + Intergenic
1065353882 10:24820432-24820454 TTTAAGTTTGAGTTCCAGAGAGG + Intergenic
1068304681 10:55192161-55192183 TTAAACTTAGATATTCAGAGTGG - Intronic
1069733673 10:70636974-70636996 TGAAATTTGGATACCCAGAGAGG + Intergenic
1069834692 10:71301192-71301214 TGAAAGTCTGATATCCTGAGAGG + Exonic
1071214237 10:83380310-83380332 GGTAAGTGAGATATCCAAAAGGG + Intergenic
1073387114 10:103134910-103134932 TGCAAGTTTGAAATCCAGTGGGG - Intronic
1075517225 10:123118676-123118698 TGTGATTTAGATGTCCAGATTGG - Intergenic
1077426145 11:2478974-2478996 TGCAAGTTCGAAATCCAGTGGGG + Intronic
1079644407 11:22844872-22844894 TGCAAGTCTGAAATCCAGAGCGG - Intergenic
1081101334 11:39006535-39006557 TGCAAGTTTGAAATCCAGCGAGG + Intergenic
1082959897 11:58908249-58908271 AGTAAGCTAGATAGCCATAGGGG + Intronic
1083518529 11:63283751-63283773 GGTAAGTTAGAGATCCCCAGTGG - Intronic
1086564268 11:88207271-88207293 GGTATGTTAGAGATCCATAGGGG - Intergenic
1086840419 11:91677059-91677081 TGCAAGTCCGAAATCCAGAGGGG - Intergenic
1087551441 11:99655431-99655453 TAAAAGTTAGATATGCAGACTGG + Intronic
1090647103 11:128775141-128775163 TGCAGGGCAGATATCCAGAGTGG + Intronic
1092662591 12:10755108-10755130 TGCAAGTCTGAAATCCAGAGGGG + Intergenic
1095623287 12:44283497-44283519 TGTAAGTCTGAAATCCAGTGGGG - Intronic
1095680395 12:44967910-44967932 TTTAAAGTATATATCCAGAGGGG - Intergenic
1096738036 12:53671630-53671652 TGTAAGCTGGCCATCCAGAGTGG - Intronic
1096960170 12:55569601-55569623 TGTAAGTTTGAAATCCAGAGGGG + Intergenic
1098055972 12:66505507-66505529 TATAAGTTAGAAATCCAGGCAGG - Intronic
1098349051 12:69538287-69538309 GGTAGGTTAGATGTCCAGACTGG - Intronic
1099668520 12:85660555-85660577 TGCAAGTCTGAAATCCAGAGAGG - Intergenic
1099840181 12:87955071-87955093 TGTTAGCTAGATAGCAAGAGAGG - Intergenic
1101233576 12:102766315-102766337 TGTGAGTTAGATATTGGGAGGGG + Intergenic
1106919202 13:34544921-34544943 TGCAAGTTAGATAGCCATTGTGG - Intergenic
1108927473 13:55770382-55770404 TGCAAGTTTGAAATCCAGTGAGG - Intergenic
1111421976 13:88023485-88023507 TTTCAGTTGGATATCAAGAGAGG - Intergenic
1111432641 13:88163523-88163545 TGTAAGTTTGAAATCCAGGAAGG + Intergenic
1111606586 13:90547105-90547127 TGTAAGTCTGAAATCCAGTGAGG + Intergenic
1111939439 13:94594463-94594485 TCTGAGTTGGATATCCACAGTGG + Intronic
1112969342 13:105240454-105240476 TTTATGTTAGATTTCCTGAGTGG - Intergenic
1113095594 13:106660735-106660757 TGAAAGAGAGATACCCAGAGAGG + Intergenic
1113096921 13:106675763-106675785 TATTAATTAGATAACCAGAGTGG + Intergenic
1114075816 14:19160617-19160639 TGTATCTTAGATATCCAGATAGG + Intergenic
1114086347 14:19238955-19238977 TGTATCTTAGATATCCAGATAGG - Intergenic
1114748793 14:25180886-25180908 TGAGAGTTAGATCTACAGAGGGG + Intergenic
1115898827 14:38121795-38121817 AGGAAGCTAGAAATCCAGAGTGG + Intergenic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1116095366 14:40360125-40360147 TGCAAGTTCGAAATCCAGAGGGG - Intergenic
1118070965 14:62246183-62246205 TGCAAGTTTGAAATCCAGTGGGG - Intergenic
1118224849 14:63889289-63889311 TGTAAGTTAGATATACTGTAAGG - Intronic
1122331294 14:100916403-100916425 TGCAAGTCTGATATCCAGTGGGG + Intergenic
1202897890 14_GL000194v1_random:20574-20596 TGTATCTTAGATATCCAGATAGG - Intergenic
1125246547 15:37647425-37647447 TGCAAGTCAGAAATCCAGTGGGG - Intergenic
1126805444 15:52344021-52344043 TGGAAGTAAGATACCCATAGAGG + Intronic
1127474539 15:59320754-59320776 TCCAAGATTGATATCCAGAGTGG - Intronic
1128855058 15:71003505-71003527 TGTGAGTCAGATTTCTAGAGTGG - Intronic
1131767858 15:95700254-95700276 TGCAAGTCTGAAATCCAGAGGGG + Intergenic
1134331906 16:13259181-13259203 TGCAAGTTCGAAATCCAGTGGGG + Intergenic
1134900183 16:17931224-17931246 TGTAAGTTAGAGATTAAGGGTGG + Intergenic
1143987835 17:10930437-10930459 TGTCAGTGGGATATCCAGTGAGG + Intergenic
1144547199 17:16208360-16208382 TGTGAGTTAGAAATACAGAACGG - Intronic
1145820257 17:27827658-27827680 TGGAACTTAGATATGCAGAAGGG - Intronic
1150183760 17:63157410-63157432 ATTTAGTTAGATATCCAAAGGGG + Intronic
1155842822 18:30667742-30667764 TGCAAGTTTGAAATCCAGCGGGG + Intergenic
1155970814 18:32082000-32082022 TGTAAGTTTGAAATGCTGAGTGG + Intergenic
1156788282 18:40941623-40941645 GGCAAGTTAGTTACCCAGAGGGG + Intergenic
1158833333 18:61303907-61303929 TGCAAGTCAGAAATCCAGTGGGG - Intergenic
1160096515 18:75878301-75878323 TGTAAGTCCAAAATCCAGAGAGG - Intergenic
1160596270 18:79976583-79976605 TGTAAGTCAGACATCCAGGCAGG - Intronic
1164851095 19:31484923-31484945 TGCAAGTCAGAAATCCAGTGGGG + Intergenic
1165022312 19:32935012-32935034 GTTGAGTTAGATAACCAGAGTGG + Intronic
1166900523 19:46058267-46058289 TGCAAGTTAGAAATCCAGCAGGG + Intronic
1167322330 19:48804936-48804958 TGTTGCTTAGATGTCCAGAGTGG + Intronic
1168070498 19:53947754-53947776 TGTAAGTTGAATCTCAAGAGTGG - Intergenic
1168071076 19:53952168-53952190 TGTAAGTTGAATCTCAAGAGTGG + Intergenic
926438892 2:12866608-12866630 TGGAATTCAGATAGCCAGAGTGG - Intergenic
926580193 2:14626378-14626400 TGTAAGATGAATAGCCAGAGAGG + Intergenic
928911341 2:36424784-36424806 TGTAAGTGAGATATCCATTGAGG - Intronic
929018199 2:37523271-37523293 TGTAAATTAGATCTCTACAGAGG + Intergenic
929437577 2:41940109-41940131 TGTAAATTAAATGTGCAGAGAGG - Intronic
931704616 2:64937198-64937220 TGTAAGAGAAATATGCAGAGTGG - Intergenic
931916087 2:66958111-66958133 AATAAGTTAGATTTTCAGAGAGG - Intergenic
933006765 2:77004891-77004913 TGCAAGTCAGAAATCCAGCGGGG - Intronic
935198163 2:100832814-100832836 TGTGAGTTAGGTGTCCAAAGTGG + Intronic
936813578 2:116432722-116432744 TGCAAGTCAGAAATCCAGTGGGG + Intergenic
937762994 2:125627994-125628016 TGCAAGTTTGAAATCCAGTGGGG - Intergenic
938490410 2:131758135-131758157 TGTATCTTAGATATCTAGATAGG + Intronic
939078240 2:137628617-137628639 TGGCAGTGGGATATCCAGAGTGG - Intronic
941072557 2:160970922-160970944 TGAAAGTTGGATATCCCTAGGGG + Intergenic
941123811 2:161562085-161562107 TGCAAGTTTGAAATCCAGTGGGG - Intronic
943006482 2:182392752-182392774 TGCAAGTTTGAAATCCAGTGGGG + Intronic
943072118 2:183153518-183153540 TGCAAGTTCAAAATCCAGAGGGG + Intronic
943998140 2:194797538-194797560 TGTAAGTCTGATATCCAGCAGGG - Intergenic
944258183 2:197646505-197646527 TGCAAGTTACCTATACAGAGTGG - Exonic
946646549 2:221843547-221843569 TGTAAGTCAGAAGTCCAGAAGGG + Intergenic
947938567 2:234028093-234028115 TGTCAGTTGGATAAGCAGAGAGG - Intergenic
1171399509 20:24863250-24863272 TGTCAGTTATATATAGAGAGAGG - Intergenic
1174184438 20:48696309-48696331 GGTCAGTTTGATATCCAGTGGGG - Intronic
1176617572 21:9036563-9036585 TGTATCTTACATATCCAGATAGG - Intergenic
1177317383 21:19478988-19479010 TGCAGGTTCGAAATCCAGAGGGG + Intergenic
1177669039 21:24201434-24201456 TGTAAGTTAGCTATCCACTTGGG - Intergenic
1180291516 22:10853781-10853803 TGTATCTTAGATATCCAGATAGG + Intergenic
1180494321 22:15883203-15883225 TGTATCTTAGATATCCAGATAGG + Intergenic
1183303179 22:37068594-37068616 TGTAAGTCACACAGCCAGAGAGG - Intronic
951854150 3:27176373-27176395 TGTAAGTTAGCCAACCAGGGTGG - Intronic
952435177 3:33266651-33266673 TGCAAGTCTGAAATCCAGAGGGG + Intergenic
953533778 3:43761349-43761371 TGTCAGAAAGATCTCCAGAGAGG + Intergenic
953731197 3:45449484-45449506 TGTGGGTTAGTTATCAAGAGTGG - Intronic
954043807 3:47911586-47911608 TTTAAGTCTGATATCCAAAGGGG + Intronic
955537357 3:59938462-59938484 TGTATGTTAGATCTCTAGACTGG - Intronic
957388461 3:79529745-79529767 TGCAGGTAAGATATACAGAGGGG + Intronic
957420826 3:79967578-79967600 TGTAGGTAAGAAATCCAGAATGG - Intergenic
957490863 3:80925156-80925178 TGAAAGTTAGATAGATAGAGAGG - Intergenic
957654800 3:83060755-83060777 TGCAAGTTCGAAATCCAGTGAGG + Intergenic
957669332 3:83280665-83280687 TGCAAGTTCGAAATCCAGTGGGG + Intergenic
957949594 3:87107606-87107628 TGCAAGTCTGATATCCAGTGGGG - Intergenic
959416493 3:106081710-106081732 TGTAAGTTTGAAATCTACAGTGG + Intergenic
960626443 3:119686400-119686422 TGCAAGTTTGAAATCCAGTGGGG + Intergenic
963207187 3:142648880-142648902 AGTTAGTTAGATTTCCAAAGTGG - Intronic
963652457 3:147998504-147998526 TGCAACTTAGATATGCAGAAAGG - Intergenic
964560090 3:157985271-157985293 TGTAAGTTATATATCCAATAAGG - Intergenic
965224633 3:165972444-165972466 TGCAAGTTTGAAATCCAGTGGGG - Intergenic
965548592 3:169940133-169940155 TGTGGGTCAGAAATCCAGAGTGG - Intergenic
967695668 3:192528287-192528309 TGTAAGTCCGAAATCCAGTGGGG + Intronic
968176537 3:196554755-196554777 TGTAAATTTGTAATCCAGAGTGG + Exonic
971598897 4:28568042-28568064 TGCAAGTTTGAAATCCAGAAGGG + Intergenic
971910662 4:32792869-32792891 TGTAACTTAGATAACCAGAATGG - Intergenic
972087889 4:35242314-35242336 TGCAAGTCTGAAATCCAGAGGGG - Intergenic
973147350 4:46843998-46844020 TGCAAGTTATATCACCAGAGAGG + Intronic
974125744 4:57693440-57693462 TGTAAGTCCGAAATCCAGTGGGG - Intergenic
974322572 4:60369868-60369890 TGAAAGTCTGAAATCCAGAGGGG - Intergenic
974339066 4:60590331-60590353 GGTAAGATAGAAATCCAGAAAGG + Intergenic
975012110 4:69368662-69368684 TGTATGTTATATTTCCAGAATGG + Intronic
975310996 4:72903864-72903886 TGGAAATTAGATATGCACAGAGG - Intergenic
975312093 4:72914057-72914079 TGTAAGTCCGAAATCCAGTGGGG - Intergenic
977022102 4:91771843-91771865 TGAAAGTTGGAAATCCAGTGGGG + Intergenic
979464582 4:121021869-121021891 TGCAAGTTTGAAATCCAGTGGGG + Intergenic
980376539 4:131957128-131957150 TGCAAGTCAGAAATCCAGAGGGG + Intergenic
981881900 4:149624056-149624078 TGCAAATTAGATATGCAGAAAGG - Intergenic
982595772 4:157381411-157381433 TTTATGTAAGATCTCCAGAGTGG + Intergenic
982620696 4:157700806-157700828 GGTAAATTAAATATCCAGGGTGG - Intergenic
983180325 4:164640862-164640884 TGTATTTCAGATATCCGGAGAGG - Intergenic
983641561 4:169948109-169948131 TGTAAGTTAGATTTGGAAAGGGG + Intergenic
984232057 4:177111820-177111842 TGTAAGTTTGATATCCAGCAGGG + Intergenic
985094940 4:186403854-186403876 TGCAAGTCAGAAATCCAGTGGGG + Intergenic
985201496 4:187489298-187489320 TGCAAGTCAGAAATCCAGTGGGG - Intergenic
985809271 5:2071086-2071108 TGCAAGTCAGAAATCCAGTGGGG - Intergenic
987599522 5:20048653-20048675 TACAACTTAGATATCCAGGGGGG - Intronic
990264667 5:54062063-54062085 TGTAAGTCCGAAATCCAGTGGGG - Intronic
991204617 5:64036572-64036594 TTTCAAATAGATATCCAGAGTGG - Intergenic
991483902 5:67113962-67113984 TGTAAGTTACTTATGCAGAAAGG - Intronic
993117588 5:83735915-83735937 TGCAAGTCAGAAATCCAGAGGGG - Intergenic
996246512 5:121271024-121271046 TGTAAGTCTGAAATCCAGAGGGG + Intergenic
999933566 5:156460207-156460229 TGTAATTTATAAAGCCAGAGAGG + Intronic
1001139029 5:169127921-169127943 TGTAAGTTAGATTCCCAAAGTGG - Intronic
1004639029 6:17496101-17496123 TATAAGTGAGACAACCAGAGAGG + Intronic
1006724874 6:36191393-36191415 TTTAAATTAGCTATCCAGTGTGG - Intergenic
1008064471 6:47032714-47032736 TGCAAGTAAGGTACCCAGAGTGG + Intronic
1009383698 6:63063602-63063624 TGTGAGTTAGAAATCCAGCAGGG - Intergenic
1012224214 6:96686424-96686446 TGCAAGTCAGAAATCCAGAGGGG - Intergenic
1012681468 6:102187720-102187742 TGAAATTTAGATTTCCAAAGAGG + Intergenic
1012732337 6:102899087-102899109 TGCAAGTTTGAAATCCAGTGGGG + Intergenic
1014863168 6:126496199-126496221 TGTAAGTCCGAAATCCAGAGGGG + Intergenic
1018489776 6:164279992-164280014 TGCAAGTCTGAAATCCAGAGGGG - Intergenic
1022078194 7:26994058-26994080 TGAAAGTTAGGAATCCAGGGAGG - Intronic
1023765686 7:43508406-43508428 TTTAAATTAGATACTCAGAGGGG - Intronic
1026278745 7:68903191-68903213 TGCAAGTCTGAAATCCAGAGGGG - Intergenic
1031674297 7:124589674-124589696 TGTAAGTTTGAAATCCAGCAGGG - Intergenic
1033065724 7:138152127-138152149 TTTAAGTTAAATATGCACAGGGG + Intergenic
1034794091 7:153996792-153996814 AATAAGATAGATATTCAGAGTGG + Intronic
1037517874 8:19651843-19651865 TGTAAATTAGTTAACCACAGTGG - Intronic
1039657203 8:39423039-39423061 TGTAAGTTTGAAATCCAGCAGGG + Intergenic
1042923210 8:73940394-73940416 TGCAAGTCAGAAATCCAGTGGGG - Intronic
1043834637 8:85032815-85032837 TGCAAGTTCGAAATCCAGCGGGG + Intergenic
1045524886 8:102933197-102933219 TGTAAGTTAAAGAGCCAAAGAGG - Intronic
1045569274 8:103352774-103352796 CCTAAGCTAGAAATCCAGAGAGG + Intergenic
1047468759 8:125146287-125146309 TGGCAGTTAGAAAGCCAGAGTGG + Intronic
1047557093 8:125944117-125944139 TAAAACTAAGATATCCAGAGTGG - Intergenic
1047562461 8:126002715-126002737 TGTCAGTTTGACATCCGGAGGGG - Intergenic
1047602791 8:126443314-126443336 TGTGAATTACATATCCATAGAGG + Intergenic
1047692673 8:127372385-127372407 TGTAAGTTAGAAATCAGGAATGG + Intergenic
1049076378 8:140399538-140399560 TGTAAGTCCGAAACCCAGAGGGG - Intronic
1049449032 8:142649005-142649027 TGCAAGTTTGAAATCCAGCGGGG - Intergenic
1053641587 9:40087810-40087832 TGCAAGTCCGAAATCCAGAGGGG + Intergenic
1053764548 9:41377654-41377676 TGCAAGTCCGAAATCCAGAGGGG - Intergenic
1054322475 9:63685199-63685221 TGCAAGTCCGAAATCCAGAGGGG + Intergenic
1054325788 9:63711724-63711746 TGTATCTCAGATATCCAGATAGG + Intergenic
1054349990 9:64012552-64012574 TGTATCTTAGATATCCAGATAGG - Intergenic
1059156927 9:111998281-111998303 TGGAAGTGAGAGATGCAGAGAGG - Intergenic
1059906962 9:118997894-118997916 TGTAAGTGAGATAAACACAGAGG - Intergenic
1060755955 9:126213682-126213704 TGTAAGTTAGAAATCTGGATGGG + Intergenic
1186684270 X:11908360-11908382 TGGAAATTAGAGATCCATAGAGG - Intergenic
1187326329 X:18294385-18294407 GGTAAGTGAGAGATCCACAGTGG + Intronic
1190001231 X:46689495-46689517 TCTAAGGTAAATACCCAGAGTGG + Intronic
1194077634 X:89416618-89416640 TGCAAATTAAATATCCAAAGAGG - Intergenic
1194226560 X:91266980-91267002 TGTAAATAAGATAGCCACAGTGG - Intergenic
1194526955 X:94989115-94989137 TGCAAGTTTGAAATCCAGTGGGG + Intergenic
1194662192 X:96639606-96639628 TGCAAGTTTGAAATCCAGCGGGG - Intergenic
1196316423 X:114230529-114230551 TCTTAGTTTGATATACAGAGTGG + Intergenic
1196391411 X:115210877-115210899 TGCAAGTTTGAAATCCAGTGGGG - Intronic
1196664766 X:118304730-118304752 TGTAAGTCTGAAATCCAGTGGGG + Intergenic
1196861297 X:120030145-120030167 TGTAAGTTATATATTCAAAAGGG - Intergenic
1197016492 X:121632177-121632199 TGCAAGTCCGAAATCCAGAGAGG + Intergenic
1197126165 X:122948715-122948737 ACTGAGGTAGATATCCAGAGAGG - Intergenic
1198882461 X:141295868-141295890 TGAAAGTGAGAACTCCAGAGAGG + Intergenic
1198941657 X:141963559-141963581 TGAAAGTTTGAAATCCAGTGGGG + Intergenic
1200430284 Y:3072162-3072184 TGCAAATTAAATATCCAAAGAGG - Intergenic
1201150966 Y:11095401-11095423 TGTATCTTAGATATCCAGATAGG - Intergenic