ID: 923354644

View in Genome Browser
Species Human (GRCh38)
Location 1:233142370-233142392
Sequence TAAATGAATTTGTAGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 442}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923354644_923354647 -4 Left 923354644 1:233142370-233142392 CCCTCCAACTACAAATTCATTTA 0: 1
1: 0
2: 1
3: 31
4: 442
Right 923354647 1:233142389-233142411 TTTATACTCATATCTACTACTGG 0: 1
1: 0
2: 0
3: 8
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923354644 Original CRISPR TAAATGAATTTGTAGTTGGA GGG (reversed) Intronic
900953344 1:5871959-5871981 CACATGAATTTGGAGTTTGAAGG - Intronic
901662502 1:10807327-10807349 TGAATGAATTGGTGGGTGGATGG - Intergenic
902603911 1:17558245-17558267 TGAATGAATGAGTAGGTGGATGG - Intronic
904185768 1:28703287-28703309 TAAATGAATAAATAATTGGAGGG - Intronic
905181270 1:36168507-36168529 TAAAGGAGTTTGCAGTTGGCTGG + Intronic
908261431 1:62342318-62342340 TAGATGGATGTGTAGATGGATGG - Intergenic
909071436 1:70998658-70998680 TAAATCAATTTGAATTAGGATGG - Intronic
909584852 1:77278638-77278660 TATATGAAATTGTTGTTAGATGG - Intergenic
911742113 1:101397842-101397864 TATTTGAATTTTTAGTTGGTTGG + Intergenic
912002655 1:104854556-104854578 TAAATGAGTTGGTAGGTGGAAGG - Intergenic
912196375 1:107401925-107401947 TAAATGAATTAGTACATGTAAGG + Intronic
912257519 1:108076022-108076044 TAAAAGAATTTGCAGATGGTGGG - Intergenic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
916564078 1:165958014-165958036 TAAATGAATTTATTTTTTGAAGG + Intergenic
916867259 1:168873722-168873744 TAGGTGAATTTGTAATTTGAGGG - Intergenic
918582048 1:186142828-186142850 TAGATGCATTTTTAATTGGAGGG - Intronic
919055755 1:192567772-192567794 AAAATTAAATTGAAGTTGGAAGG + Intergenic
919503905 1:198373734-198373756 TAAATGAATATATGGATGGAAGG + Intergenic
921479672 1:215649495-215649517 TAAAATAATTTATATTTGGAGGG - Intronic
921516569 1:216099633-216099655 TAACTGAATTAGTAATTGAAAGG + Intronic
922500024 1:226090315-226090337 TAAATAAATGTGTTGTTTGAAGG - Intergenic
922652833 1:227355902-227355924 TATATGAATGTGGAGTTGGCTGG - Intergenic
923002220 1:230016741-230016763 TAAATGAGTTGGTAGTTTGTGGG + Intergenic
923081507 1:230660881-230660903 TAAAGGAATTTTTTTTTGGAAGG - Intronic
923099804 1:230803339-230803361 TAAATGAAATTGTAAGTAGAAGG + Intergenic
923324362 1:232868185-232868207 TTAATGAATTTGTATTTTGAAGG - Intergenic
923354644 1:233142370-233142392 TAAATGAATTTGTAGTTGGAGGG - Intronic
923835594 1:237607609-237607631 TAATAGAATTTGTAGATGAATGG + Intronic
924143801 1:241053005-241053027 TAAAGGAATATGAATTTGGAAGG + Intronic
924146067 1:241075993-241076015 CAAATGAATTTGGAGTAGAATGG - Intronic
1062953511 10:1523959-1523981 TGAATGAATGAGTAGATGGATGG - Intronic
1064319169 10:14286163-14286185 TAAATGGATTTGTGTTTGGCTGG + Intronic
1065236713 10:23659754-23659776 TATATGCACTTGTATTTGGAGGG - Intergenic
1066956176 10:42175738-42175760 CTATTGAATTTGTAGTTGCATGG - Intergenic
1067896950 10:50192711-50192733 TAAATGAATTTTTACTTTCAGGG - Exonic
1067952021 10:50749322-50749344 TAAATGAATTTTTACTTTCAGGG + Exonic
1068506663 10:57908627-57908649 TAAATGAATTTTGAATTGGATGG - Intergenic
1068694598 10:59953065-59953087 TACATGAATATGTAGTTCAAGGG + Intergenic
1068936838 10:62643983-62644005 TAAATGAATGGGTAGTTCAAGGG + Intronic
1070204915 10:74248316-74248338 CAAATGAATCAGTAGATGGAGGG + Intronic
1070841635 10:79491635-79491657 TAAATGAACTTGTACTGTGAGGG - Intergenic
1072979940 10:100091763-100091785 TAAATAAATTTGCAGATAGAAGG + Intergenic
1076867573 10:133175572-133175594 TAAATGGATGGGTAGATGGATGG + Intronic
1077294841 11:1821450-1821472 TAGATGAATGTGTGGATGGATGG + Intergenic
1077304128 11:1860806-1860828 TAAATGAATGTATTGATGGAAGG + Intronic
1077537565 11:3131785-3131807 TGAATGAATGGGTAGGTGGATGG - Intronic
1078299302 11:10109510-10109532 CAAATGTATTTGTATTTGAATGG - Intronic
1079928397 11:26525242-26525264 TAAATGGATGTATAGATGGATGG + Intronic
1080179684 11:29410001-29410023 TAAATGAATGTGTAGTTTTGGGG + Intergenic
1080870030 11:36229011-36229033 TAATTGTCTTTGTACTTGGAGGG + Intronic
1086339222 11:85830397-85830419 TCAATGAATGTGTAGTGGCATGG - Intergenic
1087590065 11:100175996-100176018 TAATTGACTTTATAGTTGAAGGG + Intronic
1087852026 11:103042759-103042781 TAAAGGAATTTATACATGGAAGG - Intergenic
1089580100 11:119476324-119476346 TAAATGAATGGATAGATGGATGG + Intergenic
1090107929 11:123871396-123871418 TGATGGACTTTGTAGTTGGAAGG + Intergenic
1090698500 11:129272898-129272920 TAATTGATTTAGTAGATGGAAGG - Intronic
1091111517 11:132973282-132973304 TAAGTGATTTTGGAGGTGGAAGG - Intronic
1091117845 11:133031356-133031378 TAGATGAATGAGTAGGTGGATGG + Intronic
1092395798 12:8124876-8124898 TATATGTATTTGTATGTGGAAGG - Intronic
1093057006 12:14566046-14566068 TAAGTGTTTTTGTAGGTGGAGGG - Intronic
1093153864 12:15656680-15656702 TATATGAATTTGGAGTTCAATGG - Intronic
1094137794 12:27147520-27147542 TAAATGAATTTGTAACTTGTAGG + Intergenic
1094187120 12:27656594-27656616 TAAATGAATTTGTAACTTGTAGG + Exonic
1095126429 12:38483678-38483700 TAGATGAATATGTGGTGGGAGGG + Intergenic
1095733961 12:45536036-45536058 TGAATGAATGAGTAGATGGATGG - Intergenic
1096021356 12:48328426-48328448 TAAATGAATTTGGCATTAGAGGG - Intergenic
1096128000 12:49134152-49134174 TATAAGAATTTGCAGTTGGTGGG + Intergenic
1096628701 12:52911556-52911578 TAAATGAATTAATATTTGTAAGG - Intronic
1096835439 12:54347823-54347845 TGGATGAAATTGTAGATGGAGGG + Exonic
1097137792 12:56873575-56873597 TAAATGAATTTTTATTGGGAAGG - Intergenic
1098555137 12:71810256-71810278 TAAAGGAATGGGTAGTTGGGTGG + Intergenic
1098867110 12:75775572-75775594 TAAATGAGTTTCTAGATGTAAGG - Intergenic
1098949125 12:76620930-76620952 TACATGAATTTTTATTGGGAAGG - Intergenic
1099044606 12:77700252-77700274 GAAATGACCTTGGAGTTGGAAGG + Intergenic
1099240999 12:80138857-80138879 TAAATGAATTGGTGGATGGATGG + Intergenic
1100949782 12:99834070-99834092 AAATTAAATTTTTAGTTGGAGGG - Intronic
1101184574 12:102261499-102261521 TACATGAATTTGGAGTTCAAGGG + Intergenic
1101764474 12:107685426-107685448 AAAATGAATTTGTCGTTTCACGG - Intergenic
1102021114 12:109683617-109683639 TAAATGAGTTGATAGGTGGATGG + Intergenic
1102506928 12:113389601-113389623 TAAATGGATAGGTAGATGGATGG - Exonic
1102507030 12:113390206-113390228 TGAATGGATAGGTAGTTGGATGG - Exonic
1102507077 12:113390422-113390444 TAAATGGATAGGTAGGTGGATGG - Exonic
1102507129 12:113390687-113390709 TAAATGGATAGGTAGGTGGATGG - Exonic
1102507178 12:113390905-113390927 TAAATGAATAGGTAGGTGGATGG - Exonic
1102599848 12:114021465-114021487 AAAATGGTTTTGGAGTTGGATGG - Intergenic
1104224890 12:126821958-126821980 TAGATGGATGTGTAGGTGGATGG - Intergenic
1104567567 12:129899102-129899124 TGAATGAATATGCAGATGGATGG + Intronic
1104765895 12:131330039-131330061 TAAATGAATGGGGAGATGGATGG - Intergenic
1104813346 12:131631649-131631671 TAAATGAATGGGGAGATGGATGG + Intergenic
1104813374 12:131631831-131631853 TAAATGAATGGGGAGATGGATGG + Intergenic
1107525921 13:41231162-41231184 TAAATGACTTAGCAGCTGGAAGG + Intronic
1108287836 13:48926347-48926369 GAAATGTACTAGTAGTTGGAGGG + Intergenic
1108748082 13:53416078-53416100 TATCTGAATTTGTAGCTGGTTGG - Intergenic
1109817017 13:67598118-67598140 TAACTGAATATGTAAATGGATGG + Intergenic
1109859243 13:68175658-68175680 TTCACGAATCTGTAGTTGGATGG + Intergenic
1111311469 13:86492910-86492932 TAAATGAATTTTTTGAAGGAGGG + Intergenic
1111577537 13:90175986-90176008 AAAATGACTTTGCAGTTGGCTGG - Intergenic
1112036334 13:95500065-95500087 TACATGAATTGGTAGGTGGGTGG - Intronic
1112863591 13:103866018-103866040 CATATGAATTTGAAGTGGGATGG - Intergenic
1112926230 13:104678586-104678608 TAAATCCATTTGTAGGTTGAAGG - Intergenic
1113819429 13:113202349-113202371 TAAATGCATGTGTAGTTGTATGG - Intronic
1116509210 14:45722810-45722832 TGAATGAATTTCTAGTTTCAAGG - Intergenic
1117815356 14:59592491-59592513 CAAATGCGTTCGTAGTTGGAGGG - Intergenic
1119047466 14:71332128-71332150 CAAATGAATTTGTATCTGCAAGG + Intronic
1119626521 14:76181678-76181700 TAAAAGAATTTATATTTGTAAGG - Intronic
1120342099 14:83234593-83234615 TACATAAATTTGGAGCTGGAAGG - Intergenic
1120573809 14:86155501-86155523 TAAGTGAATCTGTTTTTGGATGG + Intergenic
1121434224 14:93908460-93908482 TAAATGGATGTGTGGATGGATGG - Intergenic
1121597842 14:95179475-95179497 TAAATGAATTACAAGTTAGAAGG - Intergenic
1121733530 14:96202731-96202753 TAAATGAGTGTGTGGGTGGATGG + Intergenic
1121941166 14:98072464-98072486 TAAATGGATGGGTAGGTGGATGG - Intergenic
1122598833 14:102910877-102910899 TCATTGAATTTGCTGTTGGAGGG - Exonic
1202936816 14_KI270725v1_random:95640-95662 CTATTGAATTTGTAGTTGCATGG + Intergenic
1125294716 15:38190315-38190337 AATATGAATTTGTAGCTGGAAGG - Intergenic
1126281882 15:46962474-46962496 TAGATCAACTTGTAGATGGATGG + Intergenic
1127530538 15:59839345-59839367 TAAATAAATTTGAAGTTGAGAGG + Intergenic
1130230223 15:82091361-82091383 TACATGAATTTCTAATTGGGTGG - Intergenic
1130414244 15:83676357-83676379 CATATGAATTTGGAGGTGGATGG - Intronic
1131020131 15:89090484-89090506 TAAATGAATTTGGGGGTGGGGGG - Intronic
1131652596 15:94417431-94417453 AAATTGAATTTGTAGTTGCTGGG + Intronic
1133111705 16:3551779-3551801 TAAATGAATGAGTGGATGGATGG - Intronic
1133204750 16:4226620-4226642 TAAATAAATGGGTAGATGGATGG + Intronic
1133898279 16:9949690-9949712 TAAATGGATGGGTGGTTGGATGG + Intronic
1134450305 16:14359299-14359321 TAAATGAATTAATAGATGGATGG + Intergenic
1134663757 16:16003621-16003643 TAAATGAATTGGTGGGTGGGTGG + Intronic
1134663791 16:16003750-16003772 TAAATGAATTGGTGGGTGGGTGG + Intronic
1135181551 16:20278943-20278965 TAAATGAATTATTACATGGAGGG - Intergenic
1135269855 16:21059947-21059969 TAAATGAATTATTAATTGGAAGG + Intronic
1135892969 16:26374035-26374057 TGAATGAATGAATAGTTGGATGG + Intergenic
1135942826 16:26837563-26837585 TAAATGAATTTATGGATGGATGG - Intergenic
1137511213 16:49102372-49102394 TAAATAAATATGAAGTTTGACGG - Intergenic
1137910374 16:52372349-52372371 TCAATGAAGTTCTACTTGGAGGG + Intergenic
1138495647 16:57407604-57407626 TAGATGGATGTGTGGTTGGATGG - Intronic
1138495690 16:57407867-57407889 TAGATGGATGTGTAGATGGATGG - Intronic
1138495725 16:57408075-57408097 TAAATGGATGGGTAGATGGATGG - Intronic
1139364148 16:66423357-66423379 TAAATGCATGTGTAGGAGGATGG + Intergenic
1139628890 16:68215121-68215143 AAAATGAATCTGGATTTGGAAGG + Intronic
1140438206 16:74966093-74966115 AAAATGAATGTGTACTTGGGAGG - Intronic
1140650120 16:77079088-77079110 TGAATGAATTAGTAGATGGATGG + Intergenic
1140853270 16:78954405-78954427 TGGATGAATGAGTAGTTGGATGG + Intronic
1141178028 16:81733491-81733513 TAAATGAATGGGTGGGTGGATGG - Intergenic
1141483736 16:84325019-84325041 TAGATGAATATGTGGATGGATGG - Intronic
1142096707 16:88243951-88243973 TAAATGTATGTGTGGATGGATGG + Intergenic
1145309878 17:21695477-21695499 TGAATGAATGGGTAGATGGATGG - Intronic
1147510146 17:41061191-41061213 AAAATAAATTTAGAGTTGGAAGG + Intergenic
1147615499 17:41824947-41824969 CAAATGAATTTCAAGTTTGATGG + Intergenic
1148236092 17:45970232-45970254 TGTATGAATGTGTAATTGGATGG - Intronic
1148869516 17:50648045-50648067 AAAAAAAAATTGTAGTTGGAAGG + Intronic
1150054555 17:62001762-62001784 TAAATGAAATTGTAGTCTAATGG - Intronic
1150687661 17:67333532-67333554 TATATCAATTTGTCATTGGAAGG + Intergenic
1151267834 17:72970234-72970256 AAAATGAATTTGTTTCTGGAGGG - Intronic
1152312534 17:79559734-79559756 TGAATGAATGGGTAGATGGATGG + Intergenic
1153478573 18:5524027-5524049 TAAATGAATTATTATTTGTAGGG - Intronic
1153651590 18:7245758-7245780 CAAATGAAGAAGTAGTTGGATGG - Intergenic
1154097833 18:11435315-11435337 AAAATGATTTGGTAGTTTGATGG - Intergenic
1154402182 18:14050712-14050734 TAAATTAGTCTGTAGTTTGATGG + Intergenic
1154461627 18:14595405-14595427 GAGATGAATTTATAGTTGGGAGG + Intergenic
1155387163 18:25290888-25290910 TAAATGAATTAATGGATGGATGG + Intronic
1155726229 18:29087555-29087577 TTACTGAATTTGAAGTTTGAGGG - Intergenic
1155930964 18:31708221-31708243 TTAATGAATTTGTTGTTGACAGG + Intergenic
1156487225 18:37474181-37474203 CAAATGAATTTCTAAGTGGAAGG + Intronic
1157701817 18:49765930-49765952 TAAATAAATTTTAAGTTGGCTGG - Intergenic
1160229213 18:77033846-77033868 TAAATGGATATGTGGATGGATGG - Intronic
1160253141 18:77221517-77221539 TAAATGGATATGCAGATGGATGG - Intergenic
1161246425 19:3254936-3254958 TACATGAATTAATAGATGGATGG - Intronic
1161287418 19:3476086-3476108 TGAATGAATGTATAGGTGGATGG + Intronic
1162483064 19:10940733-10940755 AAAATGAATTTCTAATTTGATGG - Intergenic
1164650986 19:29891034-29891056 TAGATGCATTGGTAGATGGATGG - Intergenic
1164651019 19:29891188-29891210 TAGATGCATTGGTAGATGGATGG - Intergenic
1164734270 19:30529195-30529217 AAAATGATTTTGTACTTGAAGGG - Intronic
1166201432 19:41240060-41240082 TAAATGGATGGGTAGATGGATGG + Intronic
1166201461 19:41240193-41240215 TAAATGGATGGGTAGATGGATGG + Intronic
1167113563 19:47475727-47475749 TAAGCGAATTTCTAGTGGGAGGG + Intronic
925734365 2:6948423-6948445 TAAATGAATTTCCATTTGCATGG + Intronic
925807346 2:7663821-7663843 TAAATGACTTGGTGGTTGTATGG - Intergenic
926024340 2:9527435-9527457 GAAATTAATTGGTAGTAGGAGGG - Intronic
926030670 2:9584622-9584644 TAAGTGAATTTTTATTGGGAGGG + Exonic
927855692 2:26526344-26526366 TAAATGAATTGATAAATGGATGG + Intronic
928871186 2:35982307-35982329 GAAATTAATTTCTAGTTTGAAGG + Intergenic
929717007 2:44322430-44322452 TAAATGAATTAATAATTGTATGG + Intronic
929791452 2:45025974-45025996 TAAATGAATGGATAGATGGATGG - Intergenic
930132639 2:47868435-47868457 TACATGAATTTGCAATTGGAAGG - Intronic
930165119 2:48196868-48196890 AAAATGACTTTGAACTTGGAGGG + Intergenic
931073641 2:58684422-58684444 TAAGTAAATCTGTACTTGGAAGG - Intergenic
932160459 2:69455098-69455120 TATATGTATATGTAGCTGGAAGG + Intergenic
932388133 2:71357530-71357552 AAGGTGAATTTTTAGTTGGATGG + Intronic
932551523 2:72774865-72774887 CACTTGAATTTGTAGTTGGCTGG - Intronic
933238406 2:79891176-79891198 CAAATGAATTTATAGTTGGGAGG + Intronic
933443579 2:82347816-82347838 AAAATGAATTAGTAGATGAATGG - Intergenic
933582505 2:84143512-84143534 AAATTGAATTTGGAGTGGGAGGG + Intergenic
934304107 2:91807689-91807711 CTATTGAATTTGTAGTTGCATGG - Intergenic
934329148 2:92045061-92045083 CTATTGAATTTGTAGTTGCATGG + Intergenic
934467366 2:94274983-94275005 CTATTGAATTTGTAGTTGCATGG + Intergenic
936393667 2:112100124-112100146 TAAATGAATTTTTACTTTAATGG + Intronic
937185768 2:120039959-120039981 TCAGTGAATTTGAACTTGGAAGG + Intronic
937508351 2:122562725-122562747 TAAATGAAGACGTAGTTGAAAGG + Intergenic
937977091 2:127588862-127588884 TAAATGGATGTGTGGTTGGTTGG + Intronic
939900894 2:147848084-147848106 TGAATGTATGTGTGGTTGGAGGG + Intronic
941733713 2:168948728-168948750 TAACTGAATTTCTAGTTATATGG - Intronic
942159670 2:173170162-173170184 TAAATGAAATTTTAGTTAAACGG - Intronic
942162064 2:173200385-173200407 TAAAAGAATTAGAAGTTGAAGGG - Intronic
942476525 2:176330269-176330291 TAAATGTACTTGTATTTTGAAGG + Intronic
945345721 2:208713148-208713170 GAACTGAAATTGTAGTTGGGAGG - Intronic
945427393 2:209723476-209723498 TAAATAAATGTGTAGGTGGAAGG + Intronic
946169161 2:217884196-217884218 TGAATGAATATGTGGATGGATGG + Intronic
947193474 2:227536388-227536410 AAACTGAATGTGTAGTGGGAAGG - Intronic
948068688 2:235102366-235102388 CAATTGCATTTGTAGATGGAGGG - Intergenic
948375485 2:237517872-237517894 TAAATGGATAGGTAGGTGGATGG + Intronic
948700208 2:239754905-239754927 TAAATGGATAGGTAGGTGGATGG + Intergenic
1169095560 20:2895378-2895400 TAAAAGAATATGTAGTAGGCTGG - Intronic
1169531183 20:6486763-6486785 TAAATGATTTTGGTGTTGGATGG + Intergenic
1169716958 20:8630587-8630609 TATATGAATGGATAGTTGGATGG + Intronic
1171942062 20:31340326-31340348 TGAATGGATTTGTAGTTTGACGG + Intergenic
1173110023 20:40178120-40178142 CAAATGAGCTTGTATTTGGACGG - Intergenic
1173262583 20:41450148-41450170 TTAATGATTTTGTAGTTGTTGGG - Intronic
1174146124 20:48453896-48453918 TACATGAATATGTGGATGGATGG - Intergenic
1174291536 20:49512366-49512388 TAAATGAATGGGTAGATGGGTGG + Intronic
1175082226 20:56430292-56430314 AAAATGAATATGCATTTGGAAGG - Intronic
1176586496 21:8593338-8593360 CTATTGAATTTGTAGTTGCATGG - Intergenic
1176743195 21:10626044-10626066 CTATTGAATTTGTAGTTGCATGG - Intergenic
1177359762 21:20052854-20052876 AAAATGAATTTTTAATTGTAGGG + Intergenic
1177422634 21:20880865-20880887 TAAAGGAATGTGTAATTGAATGG + Intergenic
1177762768 21:25420587-25420609 TTATTGAATTTGTATTTGAAAGG + Intergenic
1178010225 21:28276272-28276294 TATATGAATTTGGAGTAGGAGGG + Intergenic
1178164667 21:29960051-29960073 TAAATTAATTTTTATTTGAATGG - Intergenic
1179054020 21:37915262-37915284 TGAATTATTTTGTAATTGGAAGG - Intronic
1179483595 21:41694230-41694252 TAAATGGATGGGTAGGTGGATGG - Intergenic
1179549117 21:42132150-42132172 TGAATGAATGGGTAGATGGATGG - Intronic
1180269304 22:10570241-10570263 CTATTGAATTTGTAGTTGCATGG - Intergenic
1181443352 22:22949994-22950016 TAAATGAACATGTAGGTGAATGG + Intergenic
1181754468 22:25013516-25013538 GAAATCTATTTGTACTTGGAGGG + Intronic
1181900153 22:26147143-26147165 TAAATGAATGGGTGGATGGATGG + Intergenic
1182071976 22:27470164-27470186 TGAATGAATGGGTAGATGGATGG + Intergenic
1183077941 22:35438519-35438541 TGGATGAATATGTAGATGGATGG - Intergenic
1183078075 22:35439183-35439205 TGGATGAATTTGTGGGTGGATGG - Intergenic
1183972816 22:41491073-41491095 GAAATGTATTTGGAGTTTGATGG + Intronic
1184311293 22:43645191-43645213 TAAGTGAATTTTTATTGGGAAGG - Intronic
1203302827 22_KI270736v1_random:88960-88982 AAAAGGAATTTGTAGTTGAATGG + Intergenic
949192453 3:1266789-1266811 TAAATGCAGTTGTTCTTGGAAGG + Intronic
949444843 3:4122945-4122967 TGAATGGATTTGTTGTTGAATGG - Intronic
949851279 3:8422802-8422824 TAAATGAATTTGTGAATGAATGG - Intergenic
950144867 3:10641850-10641872 TAAATGAGTGGGTAGGTGGATGG - Intronic
950711101 3:14813454-14813476 TAAATTAAGATGTAATTGGAAGG + Intergenic
952960352 3:38585533-38585555 TAAATGAGTGAGTAGTTAGATGG + Intronic
953234396 3:41093525-41093547 TAAATGAGTTAGTACATGGAAGG - Intergenic
953371354 3:42391232-42391254 TATGTGAATTTGGAGTTTGAGGG + Intergenic
953715130 3:45311174-45311196 TTCATGAATTTATACTTGGAAGG + Intergenic
954549417 3:51468136-51468158 TAAAAGAATTAGTTGATGGAAGG + Intronic
954679714 3:52336965-52336987 AAAATGACTTGGTAGTTTGATGG + Intronic
955731287 3:61990061-61990083 TAAATGAGTTAGTAGATGTAAGG + Intronic
957237552 3:77614172-77614194 TAGATGAATTTGTAAGTGGTGGG + Intronic
957243234 3:77685802-77685824 TAAAAGAATCTATAGTTTGAAGG + Intergenic
957918185 3:86713571-86713593 TGAAGGAATTTCTAGTTGGGGGG + Intergenic
957966964 3:87334502-87334524 TAAATGAATATATAATTTGAAGG - Intergenic
958054498 3:88392048-88392070 CAAAAGAATTTGTAGTTAGTTGG + Intergenic
958633076 3:96705531-96705553 TAAATGAGTTTGTTGTAGGATGG - Intergenic
959000385 3:100957460-100957482 TAAATGGATCTGAAGTTGAAGGG + Intronic
959165862 3:102777234-102777256 GAAAGTAATTTGTAGTTTGATGG + Intergenic
960216638 3:115046948-115046970 TAATTAAATTTTAAGTTGGAAGG - Intronic
960572169 3:119196047-119196069 ATGATGAATTTGTAGTTGGTAGG - Intronic
962953825 3:140246075-140246097 AAAATAAATTTCAAGTTGGAAGG - Intronic
963100586 3:141599605-141599627 TAAGTGAATTTTTATTGGGAAGG + Intronic
963182011 3:142367821-142367843 TAAAAGTATTAGTAGTTGGCTGG - Intronic
963557310 3:146808759-146808781 TCAATGAATTTGTAGTTTTTAGG + Intergenic
963583670 3:147157617-147157639 TGAATGACTTTGAAGTTTGAAGG + Intergenic
963884992 3:150571678-150571700 TTAATAAATTTGTTTTTGGAAGG - Intronic
965074673 3:163960551-163960573 TATATGAATTTGTATTTATAGGG - Intergenic
965423563 3:168493396-168493418 AAAATGCATTTGTAGTTGTGTGG - Intergenic
965473933 3:169130699-169130721 TAGAATATTTTGTAGTTGGAAGG - Intronic
966930801 3:184674377-184674399 TAAATGACTATGTGGATGGATGG + Intronic
968924776 4:3541485-3541507 TGAATGAATTGGTAAGTGGATGG + Intergenic
968924821 4:3541658-3541680 TGAATGCATTGGTAGGTGGATGG + Intergenic
968924919 4:3542069-3542091 TGAATGGATTGGTAGGTGGATGG + Intergenic
968924945 4:3542237-3542259 TAAATGGATTGGTAGGTGAATGG + Intergenic
968924977 4:3542377-3542399 TAAATGGATTGGTAGGTGAATGG + Intergenic
968925007 4:3542509-3542531 TAAATGGATTGGTAGGTGAATGG + Intergenic
968925037 4:3542641-3542663 TAAATGGATTGGTAGGTGAATGG + Intergenic
968925068 4:3542777-3542799 TAAATGGATTGGTAGGTGAATGG + Intergenic
968925099 4:3542913-3542935 TAAATGGATTGGTAGGTGAATGG + Intergenic
969410747 4:7026453-7026475 TAAATGGCTTTATAGTTGGTTGG + Intronic
969502500 4:7561672-7561694 TAAATGGATGGGTAGGTGGATGG - Intronic
969802785 4:9582651-9582673 TAATTGTATTGGTGGTTGGAGGG - Intergenic
970336266 4:15047003-15047025 TAAATGGATTTCTAGTTGGAGGG - Intronic
970405643 4:15760604-15760626 TAAATGAATTAATAGTTGTCTGG + Intergenic
970962883 4:21893790-21893812 TACATGAAGCTGTAGTTGCATGG + Intronic
971822920 4:31582129-31582151 TAAATGAATTTCCAGTAGGATGG + Intergenic
973059835 4:45708929-45708951 TAAATAAATATGTAATTGAACGG + Intergenic
973181785 4:47277509-47277531 TAATTGAATTTGTAATTCAAAGG + Intronic
973285700 4:48413776-48413798 TAAGGGAAGTTGTAGTTTGAAGG + Intronic
973577355 4:52303447-52303469 TAAATCCATCTGTAGTTGGAAGG - Intergenic
973578397 4:52315685-52315707 TTAATGAAATTGCAGTTAGAAGG + Intergenic
973739694 4:53907836-53907858 AAAGTGAGTTTGTATTTGGAAGG - Intronic
975355727 4:73401170-73401192 TAAATGGATTGCTAGATGGAGGG + Intronic
975612888 4:76218768-76218790 TAATAGAATGTGTGGTTGGAGGG + Intronic
976358554 4:84150002-84150024 TAAATGAACTTTTATTTGTATGG - Intergenic
977003630 4:91536524-91536546 GAAATCAATTAGAAGTTGGAGGG - Intronic
977028048 4:91846066-91846088 AAAAAGAATTTGTAGTAGAAGGG + Intergenic
977304809 4:95309947-95309969 TAAATGAATCAGTATTTGAAAGG + Intronic
978759988 4:112346539-112346561 TCAATGAAATTGTATGTGGATGG + Intronic
979187822 4:117820653-117820675 TAAATGCATTTGAAGATTGAAGG + Intergenic
979806363 4:124976955-124976977 TAACTGCATTTGAAGTTGGCAGG + Intergenic
979826295 4:125237294-125237316 TAAATTAATTTTTAATTTGATGG - Intergenic
980341232 4:131549663-131549685 TACATGACTTTGCAATTGGAGGG + Intergenic
980342015 4:131562850-131562872 AAAATGAATTGGTTCTTGGATGG - Intergenic
980953145 4:139401366-139401388 TAAATGAATTTGGGGTTTAAAGG + Intronic
981868933 4:149462922-149462944 AAAATGGATTTGTAGGAGGAAGG + Intergenic
982176456 4:152709674-152709696 TAAATGAATATTTAGATGGATGG - Intronic
982191194 4:152857134-152857156 TAAAACAATATGTAGTTGAAGGG + Intronic
982493096 4:156054266-156054288 TGAATGAATAAGTAGATGGATGG + Intergenic
983020015 4:162664682-162664704 TAAATACATTTGTATTTTGATGG - Intergenic
983124522 4:163933893-163933915 TAAGTGAATTTTTATTGGGAAGG - Intronic
983197870 4:164827423-164827445 TTAATTAATTTATAATTGGAAGG + Intergenic
984264750 4:177484619-177484641 TAAATGAGTTAATAGTTGTAAGG + Intergenic
984630249 4:182053218-182053240 TATAGGAATTTGCAGTTGGAGGG + Intergenic
985139833 4:186828622-186828644 TAAATGAATATGTAGGGGGAGGG - Intergenic
987174119 5:15289449-15289471 TATATGAATTTGGAGGTGGGGGG + Intergenic
988297591 5:29385828-29385850 TAACTGAATTTGAAATTAGATGG + Intergenic
989199445 5:38749150-38749172 TAAATGAATGAGTACATGGACGG - Intergenic
989734723 5:44690037-44690059 TAAATGAATGAGTGGATGGATGG - Intergenic
991319876 5:65360637-65360659 TTAATGAAATTGTAGATTGAAGG + Intronic
993181448 5:84558948-84558970 TAAATGAATTCATAGATTGAAGG + Intergenic
993241404 5:85391796-85391818 TAAATTAATTTCTAGTAGGCTGG - Intergenic
993527274 5:88981069-88981091 TAACTGAATGTATAGATGGATGG - Intergenic
993898451 5:93567944-93567966 TATAACACTTTGTAGTTGGATGG - Intergenic
994100859 5:95891079-95891101 TAAATGGATTTGTAACTAGATGG - Intronic
994777333 5:104050717-104050739 TTAATGAATTTGTAGCTTGAAGG - Intergenic
996418069 5:123231265-123231287 AAAATGAATTTTTTGTTGAATGG - Intergenic
996750355 5:126882310-126882332 TAACTGAATGTTTAGTTGGCTGG + Intronic
997075723 5:130673929-130673951 TTAATTAATTGATAGTTGGACGG - Intergenic
997741386 5:136258039-136258061 TGAATGAATTTGGAGTTTGGAGG + Intronic
997759532 5:136431693-136431715 TAAATGAAGTTTTATTTGGAAGG - Intergenic
998051534 5:139040197-139040219 TAAATGGATTTGAAATTGGTTGG - Intronic
998125193 5:139614489-139614511 TAAATGAATTTGGATTAGAAGGG + Intronic
998795451 5:145813310-145813332 TAAATGAATGGGTAATGGGATGG - Intronic
999095761 5:148976705-148976727 TAAATGAACTCAGAGTTGGAAGG + Intronic
999681795 5:154067505-154067527 GAAATCAATTTGTAGCTGGTAGG + Intronic
1000346516 5:160319066-160319088 TAAATGAATTTCTTCTGGGATGG - Intronic
1002362480 5:178683730-178683752 TAAATGAAGTGTTAGCTGGAGGG + Intergenic
1002368915 5:178734192-178734214 TAAATTAAATTGCAGTTAGATGG - Intergenic
1004213594 6:13679329-13679351 TAAATGAATAGGTACTTTGAAGG - Intronic
1004618192 6:17310342-17310364 TAAATGAATTTATATTGGGGGGG - Intergenic
1005504828 6:26460514-26460536 TAAATGCATTTTTATGTGGAAGG - Intronic
1005717631 6:28566673-28566695 AAAATAAATATGTAGTAGGATGG - Intergenic
1006962821 6:37950904-37950926 AAAATGTCTTTGTAGTTTGATGG + Intronic
1007090283 6:39180073-39180095 TGAATGAATGTGGAGTGGGAGGG + Intergenic
1007515818 6:42410640-42410662 TAAATGAATGTGGTGATGGAGGG - Intronic
1007876543 6:45109393-45109415 CAATTGAATTTGTAGTTTTATGG - Intronic
1008159507 6:48060162-48060184 TAAATGAATGTGTATGTGAATGG + Intronic
1008372640 6:50751748-50751770 TATATGAATTTGGAGTGGGGTGG + Intronic
1008427578 6:51377462-51377484 TAAATGAGTTAGTATTTGTAAGG + Intergenic
1008833669 6:55801045-55801067 TAAATGAATTAATAGATAGATGG - Intronic
1010265842 6:73865517-73865539 TAGATGAATTTCTAGTTTAATGG + Intergenic
1010290417 6:74130451-74130473 TAAAGAAATTTGCAGTAGGATGG + Intergenic
1010436142 6:75833447-75833469 TAAATGGAGTTGTTGTTGCATGG - Intronic
1013843081 6:114421246-114421268 GAAATGAATGTGAAGGTGGAGGG + Intergenic
1014080130 6:117276332-117276354 TCAATTACTTTGGAGTTGGAGGG + Intergenic
1015125644 6:129751212-129751234 AAAATGAATTTTTTGTTTGAAGG + Intergenic
1015144470 6:129970356-129970378 TAAATGTCTTTTTAGTAGGAAGG - Intergenic
1017367928 6:153667134-153667156 TAAGTGCATTAGTAGGTGGACGG - Intergenic
1018832441 6:167453978-167454000 TAAATGAATGTGTGGATGAATGG - Intergenic
1019026447 6:168968643-168968665 TAAATTAAGTTGAAGTTTGATGG + Intergenic
1020179616 7:5911846-5911868 TAAATGTATTTGCAGTTAGCAGG + Exonic
1020303321 7:6813030-6813052 TAAATGTATTTGCAGTTAGCAGG - Exonic
1020908707 7:14100478-14100500 TAACTGAATCTGCAGTTTGAAGG - Intergenic
1021005911 7:15394631-15394653 TAAATAAAGCTATAGTTGGAAGG - Intronic
1021019479 7:15578724-15578746 TAACTGGATTTGTAAGTGGACGG - Intergenic
1021566802 7:22024220-22024242 TAGATGGATGTGTAGATGGATGG - Intergenic
1021745495 7:23736883-23736905 TAAATGAATTTGTTTTTATAGGG + Exonic
1022681448 7:32550491-32550513 TAAATGATTTTATACTTTGATGG + Intronic
1022767588 7:33431421-33431443 TATATGAATTTGGGGTTGGTGGG - Intronic
1024086934 7:45901409-45901431 TAAAGGATTTGGTAGTTGTAGGG + Intergenic
1025858726 7:65306797-65306819 TGCATGAATTTGTACTTGCATGG - Intergenic
1028387990 7:90281094-90281116 TAAATGACTTAATACTTGGAAGG - Intronic
1030306529 7:108024765-108024787 TAAATGAATGTATAGATAGATGG - Intronic
1032503440 7:132417399-132417421 TGACTGAATATGTAGTTTGAGGG - Intronic
1032681330 7:134186932-134186954 TGAATGAGTTTGTAGTTGGGAGG - Intronic
1032757522 7:134905320-134905342 TAAATGAACTAATAGTTGCACGG - Intronic
1032760529 7:134936965-134936987 TAAATGAATTTGTAGGTATTTGG - Intronic
1033068928 7:138183717-138183739 TAAATGCATTTGTAATTTGGGGG + Intergenic
1034301564 7:150020047-150020069 CAATTAACTTTGTAGTTGGATGG - Intergenic
1034804482 7:154077221-154077243 CAATTAACTTTGTAGTTGGATGG + Intronic
1036539221 8:9687604-9687626 GAAATGAATTTTTAGTAGAAGGG + Intronic
1037031707 8:14114967-14114989 TGAATGAATATGTGGTTTGATGG + Intronic
1038071935 8:24026936-24026958 TATATGAATTTGAAGGTGAAAGG + Intergenic
1038541301 8:28392254-28392276 TCATTGAATTTGTAGTTGAGTGG - Intronic
1039968638 8:42302647-42302669 TAAATGATTTTATAGTCTGATGG - Intronic
1040905025 8:52459679-52459701 GACATGAATTTGTATTTGGTTGG - Intronic
1041463448 8:58136370-58136392 TAAATGAATGTGGAGTTCAAGGG - Intronic
1041871941 8:62644743-62644765 GAAATTAATATGTATTTGGAAGG + Intronic
1042797951 8:72685197-72685219 GAAATGAATTTGTATCTGAAAGG + Intronic
1044034410 8:87282143-87282165 TAATTAAATTTGTAATTTGAAGG + Intronic
1044361353 8:91288306-91288328 TGAATGAATTTGTCGTTCCAAGG + Intronic
1044923702 8:97191196-97191218 TAAATGACTTTGAGGTTGGTGGG + Intergenic
1045347648 8:101308777-101308799 TAAATGTAATTGTAGTTACAAGG + Intergenic
1047230278 8:122992256-122992278 TAAATGAATGGGTAGATAGATGG + Intergenic
1047683462 8:127278768-127278790 TTAATGAGTTTGTATTAGGAGGG + Intergenic
1049005177 8:139850663-139850685 CATATGCATTTGTAGATGGATGG - Intronic
1049348345 8:142150942-142150964 TGAATGAATATGTAGGTAGATGG + Intergenic
1049348368 8:142151082-142151104 TGAATGAATATGTAGGTAGATGG + Intergenic
1051389272 9:16546371-16546393 TAAAAGCATTTCAAGTTGGATGG - Intronic
1051580273 9:18665451-18665473 TCACTGAGTTTGAAGTTGGAAGG - Intronic
1053697785 9:40653080-40653102 CTATTGAATTTGTAGTTGCATGG + Intergenic
1053799849 9:41757460-41757482 TGAATGAATTGGTAAGTGGATGG + Intergenic
1053799867 9:41757531-41757553 TGAATGCATTGGTAGGTGGATGG + Intergenic
1053799966 9:41757942-41757964 TGAATGGATTGGTAGGTGGATGG + Intergenic
1053799993 9:41758110-41758132 TAAATGGATTGGTAGGTGAATGG + Intergenic
1053943795 9:43283265-43283287 CTATTGAATTTGTAGTTGCATGG + Intergenic
1054145192 9:61556721-61556743 TAAATGGATTGGTAGGTGAATGG - Intergenic
1054145220 9:61556889-61556911 TGAATGGATTGGTAGGTGGATGG - Intergenic
1054145317 9:61557300-61557322 TGAATGCATTGGTAGGTGGATGG - Intergenic
1054145362 9:61557473-61557495 TGAATGAATTGGTAAGTGGATGG - Intergenic
1054188257 9:61969514-61969536 TGAATGAATTGGTAAGTGGATGG + Intergenic
1054188299 9:61969679-61969701 TGAATGCATTGGTAGGTGGATGG + Intergenic
1054188397 9:61970090-61970112 TGAATGGATTGGTAGGTGGATGG + Intergenic
1054188422 9:61970258-61970280 TAAATGGATTGGTAGGTGAATGG + Intergenic
1054309076 9:63452488-63452510 CTATTGAATTTGTAGTTGCATGG + Intergenic
1054407870 9:64776606-64776628 CTATTGAATTTGTAGTTGCATGG + Intergenic
1054441017 9:65260436-65260458 CTATTGAATTTGTAGTTGCATGG + Intergenic
1054452017 9:65408372-65408394 TGAATGAATTTGTGGGTGGCTGG - Intergenic
1054464892 9:65487674-65487696 TAAATGGATTGGTAGGTGAATGG - Intergenic
1054465001 9:65488157-65488179 TGAATGCATTGGTAGGTGGATGG - Intergenic
1054465107 9:65488590-65488612 TGAATGAATTAGTAAGTGGATGG - Intergenic
1054489260 9:65761054-65761076 CTATTGAATTTGTAGTTGCATGG - Intergenic
1054650103 9:67618363-67618385 TAAATGGATTGGTAGGTGAATGG - Intergenic
1054650128 9:67618531-67618553 TGAATGGATTGGTAGGTGGATGG - Intergenic
1054650257 9:67619062-67619084 TGAATGAATTGGTAAGTGGATGG - Intergenic
1055609778 9:78009745-78009767 TAAATGAATCTGATCTTGGAAGG + Intronic
1058255966 9:102764013-102764035 TTCCTGAATTTGTAGTTTGATGG + Intergenic
1058657280 9:107234868-107234890 AAAATGAAGTTGTAATTAGATGG + Intergenic
1059416429 9:114165466-114165488 TAGATGAATTGGTAGATAGATGG - Intronic
1059416477 9:114165747-114165769 TAGATGAATTGGTAGATGGATGG - Intronic
1059416527 9:114166013-114166035 TAGATGAATTGGTGGATGGATGG - Intronic
1059894114 9:118840894-118840916 TTAAGTAATTTGGAGTTGGAAGG - Intergenic
1059998637 9:119938433-119938455 GAAATGGATTTGTTCTTGGAGGG + Intergenic
1061218015 9:129232930-129232952 TGAATGAATGAGTAGGTGGATGG - Intergenic
1062246859 9:135573451-135573473 TAAATGGATTGATAATTGGATGG - Intergenic
1202780164 9_KI270717v1_random:26480-26502 CTATTGAATTTGTAGTTGCATGG + Intergenic
1203586930 Un_KI270747v1:11842-11864 CTATTGAATTTGTAGTTGCATGG + Intergenic
1203616401 Un_KI270749v1:70847-70869 CTATTGAATTTGTAGTTGCATGG - Intergenic
1185495178 X:549307-549329 TGAATGAATGAGTAGATGGATGG - Intergenic
1185495204 X:549486-549508 TGAATGAATGAGTAGATGGATGG - Intergenic
1185495349 X:550254-550276 TGAATGAATAAGTAGATGGATGG - Intergenic
1185583155 X:1226455-1226477 TAAATGAATGGGTGGTTGGTGGG + Intergenic
1185632556 X:1525647-1525669 TAAATGAATTCATGGGTGGATGG - Intronic
1185958685 X:4521524-4521546 TAGATGAATATCTAGATGGATGG + Intergenic
1186116821 X:6312653-6312675 TAAATTAATTTGTAAATTGAAGG + Intergenic
1186319696 X:8410928-8410950 TAGATGAATAGGTAGATGGATGG - Intergenic
1186387530 X:9125228-9125250 TAAATGAATTTTCAGTTAGAGGG + Intronic
1187277181 X:17826488-17826510 TCAATGAATATTTATTTGGAGGG + Intronic
1187817641 X:23250030-23250052 GAAATCTATTTGTAGTTAGAGGG - Intergenic
1188346986 X:29079243-29079265 TTAATGAATGGGTAGATGGATGG - Intronic
1188547467 X:31325012-31325034 GAAATGGATTTGTATTTGGCCGG + Intronic
1188656946 X:32709156-32709178 TTATTGTATTTGTAGTTGGGAGG - Intronic
1189029210 X:37432652-37432674 GAAATGAAGTGGTTGTTGGATGG - Intronic
1189833140 X:44995349-44995371 TAAATAATTTTGTATTAGGAAGG + Intronic
1191568429 X:62571816-62571838 GAAAGGCATTTGTAGTTTGATGG + Intergenic
1191802528 X:65097169-65097191 TAGATGAATTTGTAATTAGTAGG - Intergenic
1194691432 X:96990964-96990986 TAAATAAACTTGCAGGTGGAAGG + Intronic
1194738551 X:97544187-97544209 CACATGAAATTGTAGCTGGAAGG + Intronic
1195060586 X:101190467-101190489 TAAGTGAATTTTTATTGGGAAGG + Intergenic
1195918216 X:109956697-109956719 CATATGAATTTGGGGTTGGAGGG - Intergenic
1196091776 X:111751740-111751762 TAAATGTATTTGTATGTGTAGGG + Intronic
1196191730 X:112801817-112801839 TAAGTGACCTTGTAGTTAGAAGG + Intronic
1198003467 X:132465664-132465686 AATATGCATTTGTATTTGGAGGG - Intronic
1198088645 X:133305691-133305713 AAAATGAATTTTTAGCTGGAAGG - Intronic
1199720959 X:150542506-150542528 TAAATGAATGAGTATGTGGATGG + Intergenic
1200873731 Y:8129377-8129399 TAAGTGCAAGTGTAGTTGGAAGG + Intergenic
1200952053 Y:8907341-8907363 TACCTGAAAGTGTAGTTGGAAGG + Intergenic
1201059528 Y:10033402-10033424 TACATGCAAGTGTAGTTGGAAGG - Intergenic
1201305905 Y:12550381-12550403 TACATGCATGTGTAGATGGATGG + Intergenic
1201502413 Y:14659618-14659640 TAAATGCATTTCTAGTATGAAGG + Intronic
1201619479 Y:15940146-15940168 GAAATGAAGTTCTAGATGGATGG + Intergenic
1202027910 Y:20543771-20543793 TAAATGAATTTCTTATGGGAAGG - Intergenic
1202188129 Y:22210164-22210186 TAAGTGCAAGTGTAGTTGGAAGG + Intergenic
1202197705 Y:22311629-22311651 TACATCCAATTGTAGTTGGAAGG + Intronic