ID: 923355389

View in Genome Browser
Species Human (GRCh38)
Location 1:233150015-233150037
Sequence CAATGAAAGAAACACATAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 380}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923355389_923355394 -7 Left 923355389 1:233150015-233150037 CCCCCTATGTGTTTCTTTCATTG 0: 1
1: 0
2: 3
3: 30
4: 380
Right 923355394 1:233150031-233150053 TTCATTGTACTTTCTTCCGTGGG 0: 1
1: 0
2: 0
3: 7
4: 173
923355389_923355393 -8 Left 923355389 1:233150015-233150037 CCCCCTATGTGTTTCTTTCATTG 0: 1
1: 0
2: 3
3: 30
4: 380
Right 923355393 1:233150030-233150052 TTTCATTGTACTTTCTTCCGTGG 0: 1
1: 0
2: 1
3: 8
4: 215
923355389_923355396 16 Left 923355389 1:233150015-233150037 CCCCCTATGTGTTTCTTTCATTG 0: 1
1: 0
2: 3
3: 30
4: 380
Right 923355396 1:233150054-233150076 ATGAATGACCATCTCTCCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 154
923355389_923355397 17 Left 923355389 1:233150015-233150037 CCCCCTATGTGTTTCTTTCATTG 0: 1
1: 0
2: 3
3: 30
4: 380
Right 923355397 1:233150055-233150077 TGAATGACCATCTCTCCAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923355389 Original CRISPR CAATGAAAGAAACACATAGG GGG (reversed) Intronic
900749116 1:4382951-4382973 CAAAGAAAGAGACACAGAGTTGG - Intergenic
900886976 1:5422088-5422110 GAACGAAGGAAACACAGAGGTGG - Intergenic
901035322 1:6332895-6332917 AAATGAGAGAAACACAGAGAAGG + Intronic
901078890 1:6572578-6572600 CAAGGAAAGACTCTCATAGGAGG - Intronic
902973331 1:20070922-20070944 CACAGAAAGAAACCCAGAGGAGG + Intronic
903790192 1:25887492-25887514 AAATAAGAGAAATACATAGGTGG + Intronic
904738504 1:32653250-32653272 CAATGCAAAAAACAAAGAGGAGG + Intronic
905748022 1:40436168-40436190 CAAAGAAAGAATCACAAAGGAGG + Intergenic
905761519 1:40562190-40562212 CAATGAAACAAACACCTACTTGG - Intergenic
907695419 1:56722056-56722078 CAATAAAAAACACACAGAGGTGG + Intronic
907851695 1:58260836-58260858 CAAATAAAGAAACACAGATGAGG - Intronic
908541031 1:65122138-65122160 AAATAAAAGAATCACATAGTTGG - Intergenic
909073603 1:71026324-71026346 AAACGGAAGCAACACATAGGTGG + Intronic
909169380 1:72275144-72275166 CAATTAGAAAAACACATGGGTGG - Intronic
909839502 1:80301432-80301454 CAATGAAAGAACAATCTAGGAGG - Intergenic
910222340 1:84899874-84899896 AAAAGAAAGAAAGAAATAGGAGG + Intergenic
911354119 1:96795302-96795324 CAAAGTAAGAAACAAATATGGGG + Intronic
913048229 1:115091101-115091123 CAATGAAATAAAGACAAAGATGG + Intergenic
913241278 1:116832100-116832122 AAATGAGAGAACCAGATAGGGGG - Intergenic
915036562 1:152932499-152932521 CAATGAAAGAAAAAAGAAGGTGG + Intergenic
915640172 1:157218740-157218762 CAACTAGAGAAACACAGAGGTGG - Intergenic
915847447 1:159282190-159282212 GAATGAAAAAAATAAATAGGTGG + Intergenic
916220259 1:162437152-162437174 CAATAAAAGATATAAATAGGCGG + Intergenic
917776294 1:178338842-178338864 AAATGAAAAAAGCACATAAGTGG + Intronic
918759903 1:188391001-188391023 CAATAAAAGACATACATTGGAGG + Intergenic
919966704 1:202534070-202534092 GAATGAAAAAAATAAATAGGAGG - Intronic
920683475 1:208090902-208090924 CAATGAAAGAATCGCTTAGAGGG - Intronic
920741948 1:208589160-208589182 CAATGAAAGGAAATAATAGGAGG - Intergenic
921831503 1:219732777-219732799 AAATGAAGGATACACATATGAGG - Intronic
922193242 1:223338377-223338399 AAATGAAAGAAACAAAATGGGGG + Intronic
922272647 1:224048396-224048418 AAATGAAAAAAACTCAAAGGGGG + Intergenic
923355389 1:233150015-233150037 CAATGAAAGAAACACATAGGGGG - Intronic
1063865796 10:10363911-10363933 CAATGAAATGACCACATTGGAGG - Intergenic
1064874416 10:19976867-19976889 CACTGAAAGAAAAAAATAAGGGG - Intronic
1065384241 10:25117807-25117829 AAATGAAAGAAACGAAAAGGCGG + Intergenic
1065428413 10:25629682-25629704 CAATGAAAGGAAAAAATAAGAGG + Intergenic
1066332522 10:34440213-34440235 CAGTGAAAAAAACACATTGTAGG + Intronic
1069746279 10:70716885-70716907 CAATGCAAAAGACATATAGGAGG - Intronic
1070644734 10:78193980-78194002 CAAAGACAGAAACACATAGAGGG - Intergenic
1072475323 10:95754377-95754399 CAATGAGAGACACACTTTGGTGG - Intronic
1074847639 10:117412439-117412461 CAGTGAAAGACTGACATAGGGGG - Intergenic
1075186601 10:120264887-120264909 CAATGGCAGAAACACAAAGTGGG + Intergenic
1075206614 10:120454730-120454752 CAAAGAAAGAAAAAAATAAGGGG - Intergenic
1076336106 10:129707372-129707394 CGATGAAGGAAACACAGAGTAGG + Intronic
1076686256 10:132199718-132199740 CGATGCAGGAAACACATAGAAGG - Intronic
1077060661 11:616522-616544 CAATGTAAAAAACCCAAAGGGGG - Intergenic
1079671392 11:23175729-23175751 CTATGAAAGAGACTAATAGGAGG + Intergenic
1080039174 11:27740750-27740772 AAATGGAAGAAGCACAGAGGTGG - Intergenic
1080112007 11:28578815-28578837 CAAGGAAAGATACAGAAAGGAGG + Intergenic
1084448236 11:69216778-69216800 CAAAGAAACAAACACCTTGGTGG + Intergenic
1085420062 11:76349413-76349435 CAATGAAGGAAACACAAAGCTGG - Intergenic
1085823498 11:79818192-79818214 CAAAGAAAGACACACACAGAGGG - Intergenic
1086773746 11:90802441-90802463 CAATGAAATATGCAGATAGGTGG + Intergenic
1088572615 11:111238008-111238030 CACTGATATAAACACTTAGGGGG + Intergenic
1089127638 11:116188174-116188196 CAATGAAAGAATCAAACATGGGG - Intergenic
1090867802 11:130717474-130717496 CAAGGACACAAACTCATAGGAGG + Intergenic
1091058554 11:132441077-132441099 GAAGGAAAGAAAGACAGAGGTGG + Intronic
1091826050 12:3513692-3513714 ACATGAAAGAACCACATAGCTGG - Intronic
1092147907 12:6227523-6227545 CAATGAATGACACACAAAGAAGG - Intronic
1092569966 12:9710691-9710713 CAGGGAGAGGAACACATAGGTGG + Intergenic
1092858460 12:12696999-12697021 CAGTTAATGAAACTCATAGGTGG + Intergenic
1092878411 12:12868294-12868316 CAAGGAAAGACATACTTAGGGGG - Intergenic
1094608473 12:31970437-31970459 CAATGAATAGAACAAATAGGTGG - Intronic
1095710292 12:45281021-45281043 CAGTGAAAGAAAAACACAGGAGG - Intronic
1095743854 12:45635682-45635704 CTGTGAAGGAAACACATTGGAGG + Intergenic
1096660160 12:53119162-53119184 CAAAGACAGGAACACAGAGGCGG - Exonic
1097101884 12:56595659-56595681 CTATGACAGGAACACAGAGGTGG + Exonic
1097165055 12:57079930-57079952 CAATGAAACAAACAAATAGCTGG - Intronic
1097514968 12:60593835-60593857 CAAAGACAGAGACACACAGGAGG + Intergenic
1097967680 12:65598066-65598088 AAATGAAACAAACACAAAGAAGG + Intergenic
1098192242 12:67961875-67961897 CGATGAAGGAAACACATAGATGG - Intergenic
1099496365 12:83351724-83351746 AAAAGAAAGAAAAACAAAGGAGG - Intergenic
1100157521 12:91818197-91818219 CAATGAAGGAAAGACATTGAAGG - Intergenic
1100176969 12:92041956-92041978 CAATGGAAGGCACACACAGGTGG + Intronic
1101092115 12:101297920-101297942 CAGAGAAAGAAACACAGAAGTGG - Intronic
1102502358 12:113361087-113361109 AGATGAAAGAAAGCCATAGGGGG + Intronic
1102826136 12:115949334-115949356 CAAGGAAAGAGACACAGAGAAGG + Intergenic
1103022791 12:117549741-117549763 CACAGAAACAAAAACATAGGAGG + Intronic
1103070247 12:117935419-117935441 CCATGAAATGAACACATTGGAGG - Intronic
1103259273 12:119572626-119572648 CAAGTAAAGAAAAACAGAGGAGG + Intergenic
1104150319 12:126075747-126075769 GAATGAAAGAGCCACAGAGGAGG - Intergenic
1104207437 12:126653326-126653348 CAATGAGAAAAACACATATTTGG - Intergenic
1105540385 13:21311241-21311263 AAGTCAGAGAAACACATAGGGGG + Intergenic
1106566854 13:30893110-30893132 CAATGGAAGAAGCACAAGGGTGG + Intergenic
1106697923 13:32198080-32198102 AAATGAAAGAAACCCAGAGGAGG - Intronic
1106799075 13:33237463-33237485 CAATGGCAGAAACAAAAAGGAGG - Intronic
1107819146 13:44270648-44270670 CAATGAAAGAACCCCTTATGGGG + Intergenic
1107913365 13:45125620-45125642 CCATTAAAGAGACACAAAGGGGG - Intronic
1108013089 13:46041763-46041785 CAATGAAAGCAAAACACATGGGG - Intronic
1108145743 13:47474683-47474705 TAATGTAAGAATCAGATAGGAGG - Intergenic
1108440110 13:50443812-50443834 GAAAGAAAGAAACTCAGAGGAGG - Intronic
1109148382 13:58812272-58812294 TATTGAAAGAAAAACATATGAGG - Intergenic
1111583770 13:90258519-90258541 TGATGAAAGAAACACATATAGGG - Intergenic
1111684044 13:91480349-91480371 CACTGAAAGAAACCCATAGCAGG - Intronic
1111697869 13:91648029-91648051 TAAAGAAAGCAACACAGAGGAGG - Intronic
1112197253 13:97238049-97238071 CAATGGCATAAACACACAGGAGG + Intronic
1112215750 13:97430225-97430247 CAATAAAAGAAACGTATGGGTGG - Intergenic
1112429207 13:99335604-99335626 GAATGAAAAATACACATAGAAGG - Intronic
1112465584 13:99641996-99642018 CAATGCAGAAAACACATATGGGG + Intronic
1112940300 13:104854027-104854049 CAAGAAAAGAAACACAGAAGAGG + Intergenic
1113561041 13:111281778-111281800 CAGTGAAAGAAACACTAAGACGG - Intronic
1114168362 14:20245082-20245104 CACAGAAAGACACATATAGGAGG + Intergenic
1114824429 14:26059594-26059616 CAAAGAAAGAGACACATAAAAGG + Intergenic
1114872267 14:26672955-26672977 AAAAGAAAGAAACAAATATGCGG - Intergenic
1116384934 14:44318379-44318401 CAGAGATAGAAACACATGGGAGG - Intergenic
1117270259 14:54136311-54136333 CAATGAAAGACAAACATCAGGGG + Intergenic
1117999279 14:61507936-61507958 CCAAGAAAAAAACACAAAGGAGG + Intronic
1118114794 14:62762713-62762735 CAAACAAACAAACACAGAGGTGG + Intronic
1118713366 14:68540649-68540671 CAATTAGAGAAACACACAAGGGG + Intronic
1119124478 14:72112883-72112905 GAATATAAGAAACACACAGGGGG + Intronic
1119276515 14:73361818-73361840 CAATGAAAGAGACAGAAAAGGGG + Intronic
1120033048 14:79664422-79664444 CAATGAGAGAAAAACTAAGGTGG + Intronic
1120079349 14:80198096-80198118 AAATGAAAGAAACCCACAGAAGG - Intronic
1120599939 14:86490900-86490922 AAATGAAAGAAACTCATTGGTGG - Intergenic
1121086172 14:91147872-91147894 CAATTAAAGAAACACAGACGGGG + Intronic
1122220668 14:100237882-100237904 CTATGAAAGTGACAAATAGGGGG + Intergenic
1123163796 14:106306556-106306578 CAATGTAAGAAAGACATAAGGGG - Intergenic
1202893134 14_KI270722v1_random:178430-178452 CAAAGAAAGAAGCAAATTGGAGG + Intergenic
1124012385 15:25849209-25849231 CAGTGGATGAAACACAGAGGGGG + Intronic
1125112370 15:36047987-36048009 CAATGGAAGGAACACATATTGGG - Intergenic
1125133200 15:36309112-36309134 CAATGAAGGAACCAAAGAGGTGG - Intergenic
1126301805 15:47205312-47205334 CAAAGAAAGAAATATATAGAAGG - Intronic
1127151307 15:56078341-56078363 CAATGGATGAAACCAATAGGTGG - Intergenic
1127552960 15:60059347-60059369 CAATGGAAGAAACACAAGTGGGG - Intronic
1127951128 15:63807298-63807320 CATTGAGAGGCACACATAGGAGG + Intronic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1130088519 15:80799355-80799377 CATTGAGAGAAACACAGACGAGG - Intronic
1131045034 15:89307639-89307661 AAATGAAAGAATAACACAGGGGG - Exonic
1131898896 15:97066173-97066195 TAAAGAAAGAAAGAAATAGGAGG - Intergenic
1132296920 15:100744337-100744359 CAGTGAAAGCAACACTTAGTGGG - Intergenic
1133842034 16:9418605-9418627 CCATGAAAAAAACACATTTGAGG - Intergenic
1137048596 16:35690042-35690064 CAATGATAGGGACACATGGGTGG - Intergenic
1137861391 16:51850315-51850337 AAATGAGATAAACACACAGGAGG - Intergenic
1138963811 16:62059266-62059288 TAAAGAAAGAAACACATGGTAGG - Intergenic
1139772631 16:69291409-69291431 CATTTAAAAAAACACATAGTTGG + Intronic
1140281649 16:73560105-73560127 CAATGAAAGCAAAACAGAGAAGG - Intergenic
1140563743 16:76014876-76014898 CAATGAAATAAAAAGAAAGGCGG - Intergenic
1140582113 16:76243017-76243039 CCTTGAAAGAGAAACATAGGTGG + Intergenic
1140698204 16:77556083-77556105 AAATGAAACAAAGACAAAGGAGG - Intergenic
1141298188 16:82789581-82789603 CAAGGATAGAAACAAATGGGAGG + Intronic
1143364759 17:6399355-6399377 CAAGGAATATAACACATAGGAGG + Intronic
1143653547 17:8279393-8279415 CAATGACAGAAAGACAGAGTTGG - Intergenic
1144030564 17:11318476-11318498 CATTGAAAGAACCTCCTAGGGGG - Intronic
1144431803 17:15199056-15199078 CCCTGAAAGAAGCCCATAGGAGG + Intergenic
1145689993 17:26730634-26730656 CAATGAAAGAAACATAGACTTGG - Intergenic
1146131558 17:30281303-30281325 CAAAGAAAGAAACAGAAATGCGG + Intronic
1146661117 17:34665690-34665712 AAATGACAGAGAGACATAGGGGG + Intergenic
1147685783 17:42286274-42286296 CAATGAAAGACACAGATATTCGG + Intergenic
1149631534 17:58129183-58129205 AAATGATAGAAGGACATAGGTGG - Intergenic
1149990101 17:61378334-61378356 CAGGGAAAGCAACACAGAGGAGG - Intronic
1152234020 17:79129264-79129286 CAAGGAAAGAAACTCAGAGTGGG + Intronic
1153695180 18:7633226-7633248 CAAGGAAAGAAACATATTGCTGG + Intronic
1153818303 18:8809926-8809948 GAATGAAAGGAACTCATAGAAGG + Intronic
1155033640 18:22005547-22005569 CAATGAAAGGAAGACAAAGAGGG - Intergenic
1155074475 18:22342557-22342579 GAATGAAAGAAAGAGAGAGGCGG - Intergenic
1155662183 18:28262835-28262857 GAAAGAAAGAAAAACAAAGGGGG - Intergenic
1156132462 18:33993075-33993097 CAAGGAAAGAGACAATTAGGAGG + Intronic
1156270942 18:35531232-35531254 CAAGGAAAAAAACACATAACAGG + Intergenic
1156554734 18:38054388-38054410 CAGAGAGAGAAACACAGAGGGGG - Intergenic
1157701481 18:49763766-49763788 CAATGAAAGAGACACCTGTGTGG + Intergenic
1158152805 18:54391385-54391407 TAATTAAAGAAAAACAAAGGAGG - Intergenic
1158210176 18:55040314-55040336 GAATGAAAGAAACAAAGAGAAGG + Intergenic
1158213382 18:55074576-55074598 CCATGAGAGAGACACATGGGAGG + Intergenic
1159072695 18:63643839-63643861 CAATGAAAGAAAGATAAAGAGGG - Intronic
1160351306 18:78182288-78182310 CAATGAAAATAACACAAATGGGG - Intergenic
1163900761 19:20097951-20097973 CAATAAGAGAAACACAGAGTGGG - Intronic
1163957005 19:20652449-20652471 CAATAAGAGAAACACAGAGTGGG + Intronic
1167863228 19:52302358-52302380 CAATTACAAAAACACAAAGGGGG - Intronic
1168188723 19:54721764-54721786 CTATGAAAGTAAGAAATAGGTGG + Intergenic
925994952 2:9284678-9284700 CACTGCAAGGAACACACAGGAGG - Intronic
926342179 2:11912670-11912692 CAATGGAAGAAACACAAAATTGG - Intergenic
926726822 2:16005056-16005078 CAATCAAACAAACACATGCGGGG - Intergenic
926852301 2:17213230-17213252 AAATCAAAGACACACATAGATGG - Intergenic
927010309 2:18897238-18897260 CAATGACAGAAACTCCTATGAGG - Intergenic
927482210 2:23463063-23463085 CACTGAAAAAAAAACATGGGAGG - Intronic
928351229 2:30557241-30557263 CAATGAAATAAACACATTGTAGG + Intronic
929307959 2:40387147-40387169 CAAGGAAAGAAAGACAGAGATGG - Intronic
929510929 2:42565522-42565544 CAATTAAAGAACCACATACAAGG - Intronic
930855026 2:56006293-56006315 CAATGAAAGCAACATTTAGAGGG - Intergenic
930990980 2:57654567-57654589 TGATCTAAGAAACACATAGGTGG + Intergenic
931221574 2:60292980-60293002 CAAAGAAAAAGACACATTGGTGG + Intergenic
931977434 2:67658133-67658155 CAATGAAAGAAACATACACTGGG - Intergenic
932795563 2:74692367-74692389 CAAGGGAGGAAACACATATGGGG + Intergenic
933470580 2:82717841-82717863 CAAAGAAAGAAAAACATTGCTGG + Intergenic
935269550 2:101422109-101422131 CAAAGAAAGAAACAGATATATGG - Intronic
935723821 2:106005510-106005532 AAATGAAAAAAACACTTAGATGG - Intergenic
935863874 2:107363786-107363808 AAATGACAGAGACACATATGTGG - Intergenic
935927434 2:108085272-108085294 CAATGAAAAAAAAACATGAGTGG - Intergenic
935958253 2:108399766-108399788 CCCTGAAAGAAACAGAGAGGTGG - Intergenic
936225857 2:110650462-110650484 CCATGAAAGAAACCCACAGTGGG - Intronic
936570605 2:113610262-113610284 GATTGAAAGACACACATAGCTGG - Intergenic
936570610 2:113610355-113610377 GATTGAAAGACACACATAGCTGG - Intergenic
937558211 2:123186437-123186459 AAATCAAAGAAACAAATAGCTGG + Intergenic
938665477 2:133530969-133530991 CAACAAAAGAAATACACAGGTGG + Intronic
939185750 2:138858526-138858548 TACTGAAAGAAACACATGGGAGG + Intergenic
939476316 2:142692781-142692803 CAAAGATACAAACAAATAGGTGG - Intergenic
939558150 2:143701875-143701897 CATTCAAAGAAACAGAAAGGAGG + Intronic
941171026 2:162136625-162136647 CAATGAAGCAAACACATTTGTGG - Intergenic
942647046 2:178123607-178123629 CAATGAAGGAAACACCTATTCGG - Exonic
942658263 2:178237476-178237498 TAAGGAAAGAAACAGATGGGTGG - Intronic
942863380 2:180642749-180642771 CAATGAAAAAAAAAAAAAGGAGG + Intergenic
942912878 2:181266694-181266716 GAATGGAAGAAACACATAGATGG + Intergenic
943231039 2:185252501-185252523 AAATAAAAAAAACACAGAGGAGG - Intergenic
943528726 2:189051491-189051513 CAAAGAAAGAAACACCAAGGAGG + Intronic
943971225 2:194409114-194409136 CAATGAAAGAAAAAAATCAGGGG + Intergenic
944288443 2:197977533-197977555 CAAAAAAAGAAACAAGTAGGTGG - Intronic
944525282 2:200612588-200612610 CACTGAAAGAAACAGTTAAGTGG - Exonic
944934719 2:204555809-204555831 CTATGAAAGAAGCAGATAGGTGG - Intronic
945236308 2:207634989-207635011 CCATGAAGGAAACACAAAGAAGG + Intergenic
945357090 2:208853599-208853621 CAAAGAAAGAAAGACAAAGAAGG - Intronic
948290915 2:236823730-236823752 CATTGAAAGAAGCCCACAGGCGG - Intergenic
948798459 2:240419198-240419220 CAAAGGAAGAACCACAGAGGTGG - Intergenic
1170149230 20:13211660-13211682 TAATGAGAGAGCCACATAGGAGG + Intergenic
1170202860 20:13763261-13763283 CTATGGAAGAAAGATATAGGGGG + Intronic
1170371495 20:15653927-15653949 CAATGGAAGAAAAGCAGAGGAGG + Intronic
1170486001 20:16816879-16816901 CATTGAGAGGAACACATAGACGG - Intergenic
1172782771 20:37447105-37447127 CAGTGACACAAACACATGGGTGG - Intergenic
1173391110 20:42634328-42634350 CAAAGAAAGAGAGAAATAGGGGG - Intronic
1174083340 20:47986569-47986591 CTATGAAAGAAACATTTAGTAGG + Intergenic
1174876852 20:54235902-54235924 AAATGAAAGATAAATATAGGAGG - Intergenic
1177395243 21:20526434-20526456 CAGTGAAAGAGACACACATGCGG - Intergenic
1177608545 21:23415000-23415022 CAATAAAAGAAACGTGTAGGAGG + Intergenic
1179530435 21:42014880-42014902 CAAAGAAAGAAACAGGTAGAGGG - Intergenic
1183016594 22:34993399-34993421 CAAAGAAAGAAAAACAAATGAGG + Intergenic
1183636227 22:39064585-39064607 AAAAGAAAGAAATACATTGGTGG + Intronic
949687739 3:6596993-6597015 CATTAAAAAAAAGACATAGGAGG - Intergenic
949752874 3:7374967-7374989 AAACTAAAGAAACACTTAGGAGG - Intronic
950919918 3:16684035-16684057 CAAGGGAAGAGACACATAGGAGG - Intergenic
950988646 3:17406269-17406291 CTATGAAAGATAAACATAGATGG + Intronic
951603266 3:24400562-24400584 CAATGAAAAAAACACCTTGCAGG + Intronic
952738597 3:36714143-36714165 AAATGGAAGAAGCACAAAGGAGG - Exonic
952913547 3:38211773-38211795 AAATGAAAGAGACACTTAAGAGG - Intronic
953120730 3:40038999-40039021 CAATGAAGGAATCCCAAAGGTGG + Intronic
953590884 3:44252568-44252590 TAATGAAAGATAAACATAGCAGG + Intronic
954657226 3:52202425-52202447 CAATAAAAGAAAGAAATAAGTGG + Intronic
955159627 3:56451522-56451544 CCATGAAAGAGTCACATTGGAGG + Intronic
955267497 3:57460812-57460834 CAAGGAAACCAACATATAGGAGG - Intronic
955595261 3:60583119-60583141 TAATGAAAGAAACTGAAAGGAGG + Intronic
955671368 3:61406557-61406579 CAAGGACAGAGACACATAGAAGG - Intergenic
955866123 3:63386493-63386515 CAATTAAACAAACACAAAGCAGG - Intronic
956183406 3:66538960-66538982 AAATGAAAAGAACACAGAGGTGG + Intergenic
957175719 3:76805845-76805867 AAAGGAAAGAAATACAGAGGGGG - Intronic
957450447 3:80375004-80375026 AAATGAACTAAACACAAAGGAGG - Intergenic
957743980 3:84314791-84314813 AAAAGAAAGAAACACACAGAGGG + Intergenic
957784926 3:84870109-84870131 CAATTAAAGAAACAGATACCAGG - Intergenic
958720548 3:97837896-97837918 GTATGAAAGAAAGGCATAGGAGG + Intronic
958780155 3:98531399-98531421 AAATGAAAGAGCCACATAGATGG + Intronic
963081436 3:141398238-141398260 AAGTGAAACAAACACACAGGTGG - Intronic
963333717 3:143947179-143947201 CAATAAGGGAAACACAAAGGAGG + Intergenic
963857105 3:150266214-150266236 AAATTAAATAAGCACATAGGTGG + Intergenic
964245290 3:154644789-154644811 CTGTGAAAGCAACACACAGGTGG - Intergenic
964448914 3:156791156-156791178 GTCTGAATGAAACACATAGGTGG + Intergenic
964492285 3:157249685-157249707 CCATGAAAGAAACAGATGTGTGG - Intergenic
964692909 3:159472862-159472884 CAGTGGAAGAATCACATATGTGG + Intronic
965810509 3:172587327-172587349 CAATGGATGAAACACAGAGAAGG - Intergenic
965942607 3:174202844-174202866 CAATGAGAGATACACACAGGTGG + Intronic
967786679 3:193504532-193504554 CAAGGAAAGAAAGACATACTTGG + Intronic
968640176 4:1710747-1710769 AAAAAAAAGAAACACAAAGGTGG + Intronic
971184307 4:24358924-24358946 GCATGGAAGAAACACATAGGTGG - Intergenic
972119791 4:35686154-35686176 CAATGAAAATTCCACATAGGAGG + Intergenic
972289381 4:37677417-37677439 CAATGAATGAGACTCTTAGGAGG - Intronic
972754079 4:42026193-42026215 CAATGGAAGAAATACATACTGGG + Intronic
974571136 4:63650185-63650207 CAATGAAGGAAACAGAGAGTGGG - Intergenic
974656928 4:64837069-64837091 CACTTAAAGACACATATAGGAGG - Intergenic
974667094 4:64977125-64977147 AAATGAAAGAAAAATAAAGGGGG - Intergenic
974835154 4:67239573-67239595 CAAGGAAAGAAACAGAAAGGAGG - Intergenic
975197659 4:71544361-71544383 CAGTGAAAGAAACACATATGAGG + Intronic
975439414 4:74393968-74393990 CAATGCAATAAGAACATAGGTGG + Intergenic
975622694 4:76309622-76309644 CAATGGAAGAAGCACTTTGGTGG + Exonic
976787563 4:88838966-88838988 CAATGAAAAAAACACAAAGAAGG - Intronic
977033362 4:91916777-91916799 CAATGAATGAAACACAGACATGG + Intergenic
977633755 4:99271968-99271990 CAATGATGGAAATTCATAGGAGG - Intergenic
978907391 4:114023358-114023380 CACTGAAAGTAACAGGTAGGTGG - Intergenic
980520324 4:133923797-133923819 AAAAGAAAGAAAGATATAGGAGG - Intergenic
980736333 4:136894418-136894440 AAATGAAAGAGACACATAATTGG - Intergenic
983428764 4:167620650-167620672 CCATGAAATAAACAAATATGGGG + Intergenic
983778604 4:171640738-171640760 CATTGATAGAAACATATAGTTGG - Intergenic
983891676 4:173036189-173036211 GAATGAAACTACCACATAGGGGG - Intronic
984495327 4:180489632-180489654 CAATATAAGAAAAACATAGATGG + Intergenic
985096978 4:186422425-186422447 AAATGAGAGAAACTTATAGGAGG - Intergenic
985330980 4:188833715-188833737 CTATGGAAGAGACACAAAGGAGG + Intergenic
986817312 5:11426929-11426951 AAATCAAAGAAACACAGTGGAGG + Intronic
987072151 5:14347942-14347964 CAGAGTAAGAATCACATAGGTGG + Intronic
988024967 5:25673787-25673809 CAATGGATGAAAAACAAAGGAGG - Intergenic
988169871 5:27639582-27639604 CACTGAAAGAGACACTGAGGAGG - Intergenic
989076553 5:37569764-37569786 TAATGATAGGAACACATAAGAGG + Intronic
990035952 5:51319990-51320012 AAATGGAAGAAACAGAAAGGTGG - Intergenic
990309752 5:54526751-54526773 CAATGAAAAACAAACACAGGAGG + Intronic
990654353 5:57938196-57938218 CAAAAAAAAAAACACATATGTGG - Intergenic
990695980 5:58417589-58417611 CAATGAAAGAAGCAGAGAGGAGG + Intergenic
993771880 5:91938867-91938889 CAGTGAAAGAGAAACAAAGGAGG - Intergenic
993887299 5:93430474-93430496 TAATCAAAGAAACAAAAAGGAGG + Intergenic
993887444 5:93432461-93432483 CTAGGAAAGGAACACATAGAGGG + Intergenic
994662013 5:102665341-102665363 CAATGAAAGATGCACACAGTGGG - Intergenic
995565873 5:113433058-113433080 TACTGAAAGAAGCACATATGGGG + Exonic
996192686 5:120564659-120564681 CACTGAAAGAAGCACTGAGGAGG - Intronic
998572054 5:143270064-143270086 CAATGAAAGTAGCACTTAGATGG - Intergenic
999877481 5:155823938-155823960 AAAAGAGAGAAACTCATAGGGGG + Intergenic
1000182530 5:158825646-158825668 CAAGAAAAGAAAAACATATGGGG - Intronic
1000485335 5:161835121-161835143 CAATGAAAGAAACATCTGGGTGG - Intergenic
1001738743 5:174031575-174031597 CAGTGAAAGAAAAAAAAAGGGGG - Intergenic
1005734515 6:28733187-28733209 CCTACAAAGAAACACATAGGAGG + Intergenic
1005938325 6:30542054-30542076 CAATGAAAGAAAAAAATGGAGGG - Exonic
1006763646 6:36485790-36485812 CAAACAAAGATCCACATAGGGGG - Intronic
1006827741 6:36948592-36948614 AAAAGAAAGAAACACAGAGCTGG - Intronic
1007681663 6:43637894-43637916 CAAAAAAAGAAACAAACAGGCGG - Intronic
1008174192 6:48246530-48246552 AAATGAAAAAAACACACTGGGGG + Intergenic
1009360989 6:62813905-62813927 CAATGAAAGAAACACAAAGATGG + Intergenic
1010584213 6:77638312-77638334 CACTGAAAGAAACCCCTATGTGG - Intergenic
1011974064 6:93271017-93271039 AAAGCAATGAAACACATAGGTGG - Intronic
1014522906 6:122467030-122467052 CCTTGACAGAACCACATAGGAGG - Intronic
1015128984 6:129788557-129788579 CAATTAAAGAAATAAAGAGGAGG - Intergenic
1015352486 6:132237769-132237791 AAATGAAATAAAGAAATAGGTGG - Intergenic
1015585209 6:134769411-134769433 CAATGAAAGAAATAGAAAAGAGG + Intergenic
1016007080 6:139100091-139100113 CAATGAAGTAAACACATGGCAGG - Intergenic
1016025998 6:139287642-139287664 CAGGGAAAGTATCACATAGGAGG + Intronic
1017241035 6:152169273-152169295 TAATAAAAGAAATACATTGGTGG + Intronic
1018306777 6:162466026-162466048 CAAGGAAAGAAAAATATTGGTGG - Intronic
1019088791 6:169506569-169506591 GAATGAAAGAAAGCCATAGACGG + Intronic
1019169817 6:170126868-170126890 TAATGAAAGGAACGCTTAGGAGG + Intergenic
1020839736 7:13200753-13200775 CCTAGAAAAAAACACATAGGAGG + Intergenic
1020967870 7:14895375-14895397 CAATGAAAAAAACATAATGGAGG + Intronic
1021381058 7:19966942-19966964 TATTGAAAGAAACACATATGTGG - Intergenic
1021421732 7:20453134-20453156 GAAAGAAAGAATGACATAGGTGG - Intergenic
1024115787 7:46191779-46191801 CATTGACAGGGACACATAGGTGG + Intergenic
1024265095 7:47600294-47600316 CATTGTGAGGAACACATAGGTGG + Intergenic
1024282820 7:47733486-47733508 CAATGAAAGAACCGCATTGCAGG - Intronic
1024542633 7:50491344-50491366 CCATGAAGGAAAAAAATAGGTGG - Intronic
1025000033 7:55308182-55308204 CAAAGAAAGAAACAAAAAGCTGG + Intergenic
1026508547 7:71007691-71007713 GAATGAAAGAGACACTGAGGAGG - Intergenic
1028013892 7:85683038-85683060 TAATGAAAGAAACACATCTTAGG - Intergenic
1028691467 7:93657628-93657650 AACTGAAAGAAACACATCCGGGG - Intronic
1028872362 7:95783292-95783314 GAATAAAAGAAATACATATGGGG + Intronic
1029263123 7:99317446-99317468 GAAAAAAAGAAATACATAGGAGG + Intergenic
1029375878 7:100176777-100176799 TGAAGAAAGAAACACATAGGGGG + Intronic
1029434310 7:100553743-100553765 CCATCAAAGAAACACAGAAGGGG + Intronic
1031641063 7:124164085-124164107 CAGTGAAAAAAAGACAAAGGAGG + Intergenic
1034565152 7:151908256-151908278 AAATGAAAGAAAGAAATAGAAGG - Intergenic
1034855975 7:154547712-154547734 AAATGAAATAATGACATAGGGGG - Intronic
1036062442 8:5339065-5339087 CAATGTAAGAAACATAAACGCGG + Intergenic
1036553245 8:9833726-9833748 CAATGAAAGAAACAAGTACATGG - Intergenic
1037653790 8:20865788-20865810 TAAGGAAAGAAAAAAATAGGAGG + Intergenic
1037699980 8:21265049-21265071 CAATGAAAGACACAGATACCAGG + Intergenic
1038719521 8:30021454-30021476 AAAGAAAAGAAACACAGAGGAGG + Intergenic
1039002458 8:32996276-32996298 CACTGAAAGAAACACTGAAGAGG - Intergenic
1041339510 8:56828134-56828156 CAGTGAAAGCAATACTTAGGGGG + Intergenic
1041420361 8:57661111-57661133 CATTGAAAGGAAGACAGAGGGGG + Intergenic
1041640953 8:60201017-60201039 CAAAGATGGAAACACATAGATGG + Intronic
1042348649 8:67753142-67753164 CATTGAAAAACACTCATAGGAGG + Intergenic
1042413296 8:68490069-68490091 CAATGACAGGCACACAGAGGGGG - Intronic
1042565854 8:70110727-70110749 CCATAAGAGATACACATAGGGGG + Exonic
1043605316 8:81991888-81991910 CATTGAGAGGAACACATTGGTGG - Intergenic
1043654179 8:82641025-82641047 CATTAAAAGAAATACATAGCTGG + Intergenic
1044021200 8:87107968-87107990 AAATGAAACAAACAAATAGAGGG - Intronic
1044313239 8:90719519-90719541 AAATGAAAGAAACAGGTAGCAGG + Intronic
1045129857 8:99139198-99139220 GTAGAAAAGAAACACATAGGAGG - Intronic
1046072884 8:109279930-109279952 CCATAAAAGAAATACATAAGTGG - Intronic
1046156629 8:110298841-110298863 CAATAAAATAAAAACATAGGAGG - Intergenic
1047190855 8:122677858-122677880 CAAACAAACAAACAAATAGGTGG + Intergenic
1048114022 8:131499951-131499973 AAATGAAATAAACAAATAGTAGG - Intergenic
1048277651 8:133079098-133079120 CAAAGACAAAAACACATAGCAGG + Intronic
1049925517 9:403223-403245 CTATGAAAGATACCCATAGTGGG + Intronic
1050266210 9:3892711-3892733 CAAGGAAAGAAAAACATAGGTGG - Intronic
1050834300 9:10056394-10056416 CAATAAAAGATACCCACAGGAGG + Intronic
1051069312 9:13144467-13144489 CAATAAAAGAAAAAGATAGCGGG - Intronic
1051175232 9:14353556-14353578 CAATGAGAGAAACTGAAAGGAGG + Intronic
1051525445 9:18038126-18038148 CAGTGAAAGACACACATAATTGG - Intergenic
1052422290 9:28258943-28258965 CAAGGCAAGAAAATCATAGGAGG + Intronic
1053387182 9:37702322-37702344 CAATGTGAGAAATACAGAGGTGG + Intronic
1054152010 9:61613860-61613882 GAAGGAAAGAAACACACAGAGGG - Intergenic
1055121070 9:72661522-72661544 CCAGGAAAGCAACACAGAGGAGG - Intronic
1055129312 9:72756101-72756123 CAATGATAGCAACAAATATGTGG + Intronic
1055221767 9:73942106-73942128 TAATGAAAGAAACATAAAGATGG + Intergenic
1055763513 9:79636067-79636089 GAATGAAAGAAAGACAAATGCGG - Intronic
1056981631 9:91318028-91318050 CAATGGAAGAAAGGAATAGGAGG - Intronic
1058201772 9:102051662-102051684 CAATGAAAAAAACACAGAAATGG - Intergenic
1058636218 9:107041099-107041121 CCATGAAAGAACAAAATAGGAGG + Intergenic
1058965012 9:110029164-110029186 CAATCAAACAAACAAATAGAGGG - Intronic
1059037307 9:110768490-110768512 CAAACAAACAAACAAATAGGAGG + Intronic
1059386252 9:113966959-113966981 CAATAAAAGAGAAACAAAGGTGG + Intronic
1059387306 9:113974666-113974688 CCATCCAAGAAACACACAGGAGG - Intronic
1062120346 9:134830764-134830786 CCAGGAAAGAACCACATAGGAGG + Intronic
1186130522 X:6460932-6460954 AAAAGATAGAAACACACAGGTGG - Intergenic
1186195014 X:7101406-7101428 CAATCATAGAAACTCATAGAAGG - Intronic
1188203715 X:27325320-27325342 CAAGGAAAGAAATAAATAGAAGG + Intergenic
1188666755 X:32832409-32832431 AAATGAAAGAACCAAATAGATGG - Intronic
1189583630 X:42434404-42434426 CAGTGAAAGAAAGTCACAGGAGG - Intergenic
1189719228 X:43898063-43898085 CAATGAATGATAGAAATAGGTGG + Intergenic
1190178137 X:48168222-48168244 CAAGGAGAGAAACACATTTGTGG - Intergenic
1190190039 X:48269309-48269331 GAAGGAAAGAAACACATTTGTGG - Intronic
1190492505 X:50997046-50997068 CAAGGAAAGAAACACTTGGAAGG + Intergenic
1190628072 X:52355741-52355763 CACAGAAAGCAACACAGAGGAGG - Intergenic
1190659534 X:52642042-52642064 CAAGGAGAGAAACACATTTGTGG + Intergenic
1190665762 X:52694876-52694898 CAAGGAGAGAAACACATTTGTGG + Intronic
1190673656 X:52763534-52763556 CAAGGAGAGAAACACATTTGTGG - Intronic
1190677196 X:52792302-52792324 CAAGGAGAGAAACACATTTGTGG - Intergenic
1192241887 X:69338145-69338167 CACTGCAAGAAACACTAAGGAGG - Intergenic
1192950394 X:76010180-76010202 CAAAGAAATAAAGACACAGGAGG - Intergenic
1193320590 X:80116728-80116750 AAATAAAAGAAACAAAGAGGAGG + Intergenic
1193912245 X:87319707-87319729 CATTAAAAGAAACATATATGTGG - Intergenic
1194085209 X:89518482-89518504 GATTGAAAAAAACACATAGCAGG - Intergenic
1194191863 X:90847565-90847587 AAATGAAAGACACACTTAGGGGG - Intergenic
1194582544 X:95694322-95694344 CACAGAAAGAAACACCAAGGAGG - Intergenic
1195329052 X:103781678-103781700 AAATGAAAGAAAAACACTGGAGG + Intronic
1196644418 X:118101501-118101523 ACATGAAAGAAACACATAACAGG + Intronic
1197015536 X:121621320-121621342 CAATGAAAGCAGCCCAGAGGAGG - Intergenic
1197399857 X:125977239-125977261 CAAGGAAAGAAGCACAGAAGAGG + Intergenic
1197784592 X:130187404-130187426 GAATGAAAGAAAGAAAGAGGAGG - Intergenic
1198131086 X:133695584-133695606 AAATAAAATAAACACATAGGTGG + Intronic
1198871350 X:141179634-141179656 CAGTGAAAAAAAGAGATAGGAGG + Intergenic
1199839558 X:151630753-151630775 TTATGAAGGAAACACAAAGGTGG + Intronic
1200437855 Y:3174364-3174386 GATTGAAAAAAACACATAGCAGG - Intergenic
1200538502 Y:4430000-4430022 AAATGAAAGACACACTTAGGGGG - Intergenic
1201238050 Y:11930596-11930618 CATTGAGAGGAACACATAAGTGG + Intergenic