ID: 923356280

View in Genome Browser
Species Human (GRCh38)
Location 1:233159086-233159108
Sequence CTGGCTCCTGATTCTGTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923356280 Original CRISPR CTGGCTCCTGATTCTGTAGG TGG Intronic
901515162 1:9740393-9740415 CTGGCTCCTGATTCATCAGCTGG + Intronic
904821903 1:33250961-33250983 CCACCTCCTCATTCTGTAGGAGG - Intergenic
905241388 1:36583747-36583769 CTGAGTCCTGAGTCTGTATGGGG - Intergenic
905474727 1:38217927-38217949 CAGGCTGTTGATTCTGCAGGAGG + Intergenic
906315716 1:44785302-44785324 CTGGCTCTTCATTCTCCAGGTGG - Exonic
906691253 1:47794241-47794263 CTTGCTCCTGGCTCTGTGGGTGG + Intronic
907312296 1:53545864-53545886 CTGGCTCCAGATGCAGCAGGGGG - Intronic
907426912 1:54385533-54385555 ATGGATCCTGAGTCTGAAGGAGG + Intronic
907481953 1:54751073-54751095 CTGACTCCAGAGTCTGTAGCTGG + Intergenic
908878714 1:68706911-68706933 CTAGCCCCTGACTCTTTAGGTGG + Intergenic
912079025 1:105912398-105912420 CTATCTCCTGATTCAGTAGAGGG + Intergenic
912086485 1:106013001-106013023 TTGGCTCATGGTTCTGTAGGCGG + Intergenic
913446872 1:118959476-118959498 GAGGCTCCAGATTCTGTAGCTGG + Intronic
913556332 1:119971021-119971043 CTGGCTCATGTATCTGTAGAAGG + Intronic
914705067 1:150163505-150163527 CAGCCTCCTCATTCTGTGGGTGG - Intronic
914778361 1:150759755-150759777 CTGGCTTCAGCTACTGTAGGAGG - Intronic
915724231 1:158006592-158006614 CTGGCTGGGGATACTGTAGGAGG - Intronic
919081955 1:192877777-192877799 CTGACTCCTGCTTCTGTATGTGG + Intergenic
919841254 1:201611008-201611030 CTGGCTCCTGGCTCTGAATGGGG - Intergenic
920440342 1:205976359-205976381 CTGGCTCCTGAGTCTGAAGAAGG + Intergenic
920535583 1:206734519-206734541 TTGGCTCCTGATTCTGCATTTGG - Intergenic
922088237 1:222371084-222371106 CTGGCTGCTGATGCTGGATGAGG + Intergenic
923356280 1:233159086-233159108 CTGGCTCCTGATTCTGTAGGTGG + Intronic
923899169 1:238306284-238306306 TTGGCTCATGGTTCTGCAGGTGG - Intergenic
1064562549 10:16607283-16607305 CTGGCTCATGGTTCTGCAGGAGG - Intronic
1065013235 10:21438284-21438306 CTGGCTCAAGATCCTGTAGCTGG - Intergenic
1065889465 10:30108944-30108966 CTCTGTCCTGAATCTGTAGGAGG + Intronic
1067927524 10:50525324-50525346 CTGGCTCTAGATTGTGAAGGTGG + Intronic
1069155894 10:65030511-65030533 TTGGCTCATGGTTCTGGAGGTGG - Intergenic
1074065126 10:110007407-110007429 CTGGCTGCTGGGGCTGTAGGAGG - Intronic
1074192109 10:111147078-111147100 CTGACTCTTGAGTCTGCAGGTGG + Intergenic
1074776415 10:116771098-116771120 GTGGCTCCCGAGTCTGTAGATGG + Intergenic
1075614605 10:123882360-123882382 CTGTGTCCTGCTTCTGTGGGCGG + Intronic
1078643196 11:13114917-13114939 CTGGCTCCAGGTTCTGAAAGAGG - Intergenic
1078762732 11:14264240-14264262 TTGGGACCTGATTCTGTAGGTGG + Intronic
1079966363 11:26984908-26984930 TTGGCTCATGATTCTGGAGCTGG - Intergenic
1080922511 11:36723160-36723182 CTGGCTCCAGTTTCTGCAAGAGG - Intergenic
1081855013 11:46297389-46297411 CTGGCTCATGATACTGGTGGAGG - Intronic
1082793028 11:57360325-57360347 AATGCTCCTGATTCTGCAGGTGG - Intronic
1083583059 11:63837680-63837702 CTGGCTCAAGATGCTGTAGCTGG + Intergenic
1083966049 11:66044515-66044537 CTGGCTCCTCACTTTGTAGATGG + Intronic
1085293684 11:75418192-75418214 CTGGCCCCAGATTCTCTGGGTGG + Intronic
1086838041 11:91650623-91650645 CTGGCTCCTCATTTTGCAGAAGG - Intergenic
1087895252 11:103579193-103579215 CTGACTGGTGATTCTGTAAGGGG - Intergenic
1089970843 11:122691934-122691956 CTGGCTTCTGATCATGAAGGAGG + Intronic
1090649303 11:128792344-128792366 CAGGCTCCTGATTTTTTAGATGG - Intronic
1091085868 11:132721359-132721381 CTGTCTGCTGATTCTGCATGTGG - Intronic
1091369357 11:135045791-135045813 CTGCCTCCTGGTTCAGAAGGAGG + Intergenic
1097042397 12:56163681-56163703 CTGGCTCCTCACTGTGGAGGTGG + Exonic
1097787844 12:63780257-63780279 CTGGCTCGAGAGGCTGTAGGGGG - Intronic
1098956546 12:76694943-76694965 CTAACTCCAGATTCTGTAGAAGG - Intergenic
1099104163 12:78479396-78479418 CTGGGTCCTGGTTCTCTAGATGG - Intergenic
1102010521 12:109615774-109615796 CTGGCTGAGGATTCTGGAGGGGG + Intergenic
1104052730 12:125207008-125207030 CTGGCTCCTGATGCATTCGGTGG + Intronic
1104237991 12:126958267-126958289 CTGGCAGCTGATTCTATAGGAGG + Intergenic
1105337160 13:19483930-19483952 CTGGGGCCTGATTGGGTAGGGGG - Intronic
1107043650 13:35973829-35973851 CTGGCTCATGGTCCTGGAGGAGG + Intronic
1107146658 13:37067640-37067662 GTGTCTCCAGTTTCTGTAGGAGG + Intergenic
1108878115 13:55073426-55073448 GTGGCTTCTGGTTCTGTGGGTGG - Intergenic
1109370073 13:61412228-61412250 GTGGCTACTGATTCTCTGGGTGG + Exonic
1112092247 13:96093680-96093702 CTTGCTCTAGATACTGTAGGAGG + Intronic
1116357606 14:43949647-43949669 CTGTTTCCTGATTCTCTATGTGG + Intergenic
1118572443 14:67207210-67207232 TTGGCTCATGGGTCTGTAGGTGG + Intronic
1119734601 14:76973882-76973904 CTGGCTGCAGCTTCTGAAGGAGG + Intergenic
1122315967 14:100826323-100826345 CTGGGTCCTGCTGCTGGAGGCGG + Intergenic
1126317790 15:47388851-47388873 TTGGCTCCAGATTTTCTAGGAGG + Intronic
1128224065 15:65989453-65989475 CTCGCTGCTGCTTCTGTGGGTGG - Intronic
1129778806 15:78255502-78255524 CTGGTTCCTGGGTGTGTAGGAGG + Intergenic
1129824158 15:78623742-78623764 CTGGGTCCTGATTGTGATGGTGG + Intergenic
1130431020 15:83846764-83846786 CTGCCTTCTGACTCTGTAGTGGG - Intronic
1131403868 15:92147545-92147567 CTTGCTCCTGAATCTGTAACTGG + Intronic
1132663939 16:1073207-1073229 CTGGCTCCTGGAGCTGGAGGAGG + Intergenic
1133928749 16:10215123-10215145 CTGGCCCCTGCTTCTTAAGGAGG - Intergenic
1136126120 16:28182069-28182091 CTGGCTCTTGATTATGTCTGGGG - Intronic
1137389653 16:48070739-48070761 CTGGCTCCAGCTTCTGGATGAGG - Intergenic
1137391336 16:48083687-48083709 CTGGCGGCTGATTCTAGAGGAGG - Exonic
1138185451 16:54973137-54973159 GTGGATCCTGATTCATTAGGTGG + Intergenic
1142875782 17:2851564-2851586 CTGACTCCTGAGTCTCTAAGAGG - Intronic
1144714945 17:17427369-17427391 CTAGCTCCTGATTCAGTCGAGGG + Intergenic
1147210179 17:38868701-38868723 CTAGTTTCTGATTCTGTAAGGGG - Intergenic
1148022865 17:44565193-44565215 CTATCTCCTGATTCAGTAGAGGG - Intergenic
1148338523 17:46858562-46858584 CTGGAGCCTAATTCTGTTGGTGG + Intronic
1148563414 17:48619298-48619320 CCGACGCCTGATTCTGGAGGGGG + Intronic
1148820564 17:50357234-50357256 CCGGCTCCAGAGTCTGGAGGTGG + Exonic
1151928009 17:77213024-77213046 CAGGCTCCTGCCTCCGTAGGTGG + Intronic
1152630532 17:81408837-81408859 CAGGCTCCTGAGTCTGGGGGTGG + Intronic
1153006857 18:504763-504785 CTGGCTGCTGCTTCTGGGGGTGG - Intergenic
1155787052 18:29914422-29914444 CTATCTCCTGATTCAGTCGGGGG + Intergenic
1156479921 18:37429952-37429974 CTGTCTCCTGACTCTGAAGCAGG + Intronic
1157088301 18:44605006-44605028 CTGGCGCCTGATGCTGCCGGAGG + Intergenic
1158993085 18:62890021-62890043 CCGACTCCTTGTTCTGTAGGGGG + Intronic
1162108608 19:8387250-8387272 CTCTCTCCTGATTTTGTAGAAGG - Intronic
1163162796 19:15475625-15475647 CTGGCTCCAGCCTCTGTAGAAGG + Exonic
1164741486 19:30579380-30579402 CTTCCTCATGATTCAGTAGGTGG + Intronic
1165099116 19:33428090-33428112 CTGGCTCCTGGCTATGCAGGAGG - Intronic
1165800252 19:38545191-38545213 CTACCTCCTGGTTCTATAGGTGG - Intronic
925198163 2:1944538-1944560 CTGGCCCATTATTCTGCAGGGGG + Intronic
925414576 2:3660335-3660357 TTGGCTCATGGTTCTGCAGGCGG - Intronic
926537200 2:14127938-14127960 TTGGCTCATGCTTCTGCAGGCGG + Intergenic
926974713 2:18502921-18502943 GGTGCTCCTGACTCTGTAGGTGG + Intergenic
927789896 2:26001856-26001878 TTGGCTCCTTACACTGTAGGAGG + Intergenic
930293713 2:49528279-49528301 CTGGCTCCTGGTTTTGTTGCTGG + Intergenic
933480286 2:82848366-82848388 TTGGCTCATGGTTCTGGAGGCGG + Intergenic
935233545 2:101119370-101119392 CAGGCTCCTGAGTCAGAAGGGGG - Intronic
936042113 2:109158049-109158071 CTGGCTCCTGAGCCTGGAGCTGG + Intronic
937883155 2:126883293-126883315 CAGGCACCTGATTATGTAGGAGG - Intergenic
941015740 2:160354089-160354111 CTGACTCCTGAATCTATAGAAGG + Intronic
941394776 2:164961126-164961148 TTGGCTCATGGTTCTGCAGGAGG + Intergenic
941395033 2:164963782-164963804 CTGGCTCCAGAAGCTGGAGGAGG + Intergenic
941873597 2:170410733-170410755 CTGGCTCCTGATCTTGGTGGTGG + Intronic
946331257 2:219010377-219010399 CTGCCTCCTGAATCTGGAGGAGG + Intronic
946392060 2:219422090-219422112 CTGGTTCTTAATTCTGAAGGTGG - Intronic
946859817 2:223990071-223990093 CTGGCCCATGACTCTGTAAGGGG + Intronic
947776686 2:232717621-232717643 TTGGCTCATGGTTCTGTAGGCGG + Intronic
1169192556 20:3667396-3667418 CTCGCTCCTGATTCTGTCCCTGG + Intergenic
1172195924 20:33091441-33091463 CTGGCCCCTAATTTTGTATGGGG + Intronic
1173005028 20:39133661-39133683 CATGCTCCTGGGTCTGTAGGCGG - Intergenic
1175831514 20:61967460-61967482 CTGTCTGCTGATGCTGGAGGTGG - Intronic
1175995012 20:62808100-62808122 CTGGCTCCTCACTCTGCAGGTGG - Intronic
1177757109 21:25361277-25361299 CTTCCTCCTCATTCTGCAGGTGG - Intergenic
1178767323 21:35466610-35466632 GTGGCTTCTGCTTCTGTGGGGGG - Intronic
1179200816 21:39218633-39218655 CTAGCTCCTAATTCTTCAGGTGG + Exonic
1179640793 21:42746069-42746091 CTCACTCCTGCTGCTGTAGGTGG - Intronic
1181842066 22:25671686-25671708 CTGGCTGTAGAGTCTGTAGGAGG + Intronic
1181894067 22:26091281-26091303 CAGGCTCCTGGTTCTGAAGTTGG + Intergenic
1181948097 22:26534113-26534135 GTGGCCCCTGATTCTGTAACAGG - Intronic
1183862221 22:40678600-40678622 CTGGCTCCTGAGTCTGGCAGTGG + Intergenic
1184875679 22:47273986-47274008 CAGGCTCCTGCCTCTATAGGAGG - Intergenic
1184914054 22:47555483-47555505 TTGGCTCATGGTTCTGCAGGCGG + Intergenic
1185044122 22:48520473-48520495 CTGCCATCTGATTCTGCAGGTGG + Intronic
949529278 3:4938333-4938355 GTGGCTCATGAGTCTGTGGGTGG + Intergenic
955621296 3:60866979-60867001 CTGGCTTCTGCTCATGTAGGAGG - Intronic
956704910 3:71991410-71991432 TTGGCTCATGGTTCTGCAGGCGG + Intergenic
958864473 3:99485181-99485203 ATGCCTCCTGACTCTGTGGGGGG + Intergenic
959262016 3:104094520-104094542 TTGCCTCCTGATGCTGGAGGTGG + Intergenic
960241684 3:115349776-115349798 TTGGCTCATAATTCTGTAGCTGG - Intergenic
960806049 3:121584954-121584976 CTAGCTCCTCATACTGTTGGTGG - Exonic
962395554 3:135012717-135012739 CTGTCTCCTGCAGCTGTAGGAGG + Intronic
963761502 3:149290573-149290595 CTATCTCCTGATTCTGTTGAGGG + Intergenic
963847417 3:150173156-150173178 TTGGCTCCTGATTCTTCATGAGG - Intergenic
964091991 3:152888255-152888277 GTGGCTCCACATTCTGTTGGGGG + Intergenic
965251929 3:166353313-166353335 CTGGCAGCTGATTCTCTAGATGG + Intergenic
966050987 3:175617752-175617774 CTAGCTCCTGATTCAGTTGAAGG - Intronic
967524661 3:190477067-190477089 TTGGCTCATGATTCTGCAGGGGG - Intergenic
969244571 4:5924148-5924170 CTGGCTCCTCAGTTTGTAGATGG + Intronic
969441831 4:7221739-7221761 CGGGCAGCTCATTCTGTAGGAGG + Intronic
970528193 4:16954500-16954522 TTGGCTCATGATTCTGCTGGTGG + Intergenic
972198365 4:36681651-36681673 TTGGCTCATGATTCAGTGGGTGG + Intergenic
974308654 4:60174868-60174890 CTGCCTCCTGCTTCTGTACAGGG + Intergenic
980117274 4:128691477-128691499 CTGGCTCCTGATATTGCAGCAGG - Intergenic
980205474 4:129714413-129714435 CTGGGTCCTGATTCTGTCACTGG - Intergenic
980470672 4:133247568-133247590 GTGACTCCTGATTATGGAGGAGG + Intergenic
980849424 4:138362717-138362739 TTGGCTCATGGTTCTGCAGGGGG + Intergenic
981397181 4:144266207-144266229 CTGCCTCCTGATCCTGTATAGGG - Intergenic
981852269 4:149244707-149244729 CTGGGTCTAGAATCTGTAGGGGG + Intergenic
983209616 4:164945396-164945418 CTATCTGCTCATTCTGTAGGTGG - Intergenic
984025681 4:174540297-174540319 ATGGCTTCTCTTTCTGTAGGTGG + Intergenic
984488854 4:180406602-180406624 GTGGCCCCCGATGCTGTAGGTGG - Intergenic
988938437 5:36115681-36115703 CTGAATCCTGATTGTGTTGGTGG + Intronic
990995133 5:61725561-61725583 CTGCCTCATGATACTATAGGAGG + Intronic
990998639 5:61759229-61759251 CTGGGTCCTGATTGTGCTGGCGG - Intergenic
992753212 5:79880113-79880135 CTGTCTCCTGATTTTCTATGGGG - Intergenic
997303268 5:132821856-132821878 CTGAGTCCAGATTCTGTAGCTGG - Intergenic
998525739 5:142841686-142841708 TTGGCTCCTGCTTTTGTTGGAGG + Intronic
999357979 5:150955261-150955283 CTGGAACCTGAGTCTGCAGGGGG + Intergenic
999453392 5:151695170-151695192 ATGGCTCATGATTCTGGAGCTGG + Intergenic
1003237074 6:4304414-4304436 CTGGCACCCAACTCTGTAGGTGG - Intergenic
1003265681 6:4563443-4563465 CTGGCCTCTGATTCTGCAGCAGG + Intergenic
1004797526 6:19104007-19104029 CTGGCTAGAGATTCTGGAGGAGG - Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006094709 6:31648806-31648828 CTGGGACCTGATTTAGTAGGTGG - Intronic
1006208738 6:32374845-32374867 CTATCTCCTGATTCAGTAGAGGG + Intergenic
1007255975 6:40528979-40529001 GTGGCTCCTGCTTCTCTAGCAGG + Intronic
1009628275 6:66164118-66164140 ATGGCCCGTTATTCTGTAGGTGG + Intergenic
1010656132 6:78514060-78514082 CTTCACCCTGATTCTGTAGGGGG - Intergenic
1013302735 6:108819303-108819325 TTGGCTCATGGTTCTGCAGGCGG - Intergenic
1015182485 6:130375664-130375686 CTGGCTCCTCATTCTCTCGCAGG - Intronic
1017326733 6:153149702-153149724 TTGGCTCATGGTTCTGCAGGAGG + Intergenic
1017711290 6:157170605-157170627 ATGGCTCCAGACTCTGTAGGTGG + Intronic
1025114482 7:56245980-56246002 TTGGCTCCTGGTTCTGCAGGAGG + Intergenic
1026198831 7:68196380-68196402 TTGGCTTCTGGTTCTGTAGGCGG + Intergenic
1029877126 7:103765964-103765986 CTTGCTACTGACTCTGGAGGTGG - Intronic
1031239553 7:119219910-119219932 CTGGGGCCTGAGTCTGTTGGGGG + Intergenic
1031542568 7:123012930-123012952 CTTACTCCTCATTGTGTAGGAGG - Intergenic
1032268671 7:130385136-130385158 CTGGCTCCGGACACTGTGGGGGG - Exonic
1032452899 7:132049688-132049710 CTGTCTCCTGATGCTGCAAGCGG - Intergenic
1033583024 7:142753641-142753663 CTGGCTCCTGCTATGGTAGGTGG - Intronic
1033608035 7:142941691-142941713 CTGGCACCTGAGTCTGTTGAGGG + Intronic
1033615273 7:143008167-143008189 CTGGGTCCTGATTCTTTGGAAGG + Intergenic
1033870707 7:145750968-145750990 CTATCTCCTGATTCTGTCGAGGG - Intergenic
1034149642 7:148904320-148904342 TTGGTTGCTGATTCTGTAAGAGG + Intergenic
1034376229 7:150647147-150647169 CTGGCTTCTGCTTCTGAGGGGGG - Intergenic
1035304926 7:157925800-157925822 CTGGTTCCTGATTGTCTCGGTGG - Intronic
1035765817 8:2104633-2104655 TTGGCTCATGATTCTGGAGGCGG + Intronic
1035784259 8:2249227-2249249 CTGGCTCCTCCTCCTGGAGGTGG - Intergenic
1039642655 8:39240973-39240995 CTTGCTTCTGATTTTATAGGTGG - Intronic
1039835822 8:41255554-41255576 CTGCCTCCTGATTCTGGACTGGG - Intergenic
1039847633 8:41337018-41337040 CTGGCACCTGATTGTGTGGGGGG - Intergenic
1040394655 8:46985564-46985586 TTGGCTCATGATTCTGGAGGTGG - Intergenic
1040470405 8:47731603-47731625 CTGGCTCCCAACTCTGCAGGTGG - Intronic
1040479438 8:47810163-47810185 CTGGCTTATAATTCTGTAGCTGG - Intronic
1041985271 8:63915415-63915437 CTGTCTCCTGCCTCTGTCGGAGG - Intergenic
1042632431 8:70833166-70833188 ATGGCTCCTTATTCTGGGGGAGG - Intergenic
1043667111 8:82828025-82828047 CTGGTTTCTGATTCAGTAGAGGG + Intergenic
1045014205 8:97985102-97985124 TTGGCTCATGATTCTGCTGGCGG + Intronic
1046780123 8:118205720-118205742 CTGGCTCCTGATACTGTCAGAGG + Intronic
1047215440 8:122872385-122872407 CTTGCCCCTGAATCTGTAGATGG - Intronic
1048860884 8:138723932-138723954 AAGGCTCCTGATGCTGGAGGAGG - Intronic
1049329832 8:142044580-142044602 CTGGCTCTTGGCTCTGTGGGTGG - Intergenic
1049809010 8:144554950-144554972 CCAGCTGCTGTTTCTGTAGGGGG - Intronic
1052280588 9:26728994-26729016 CTGCCACCAGATTCTGTAAGAGG - Intergenic
1053066465 9:35072536-35072558 CTGGCTCCTGATCCGCGAGGTGG + Exonic
1053871834 9:42501113-42501135 ATGGCTTCTGCTTCTGTATGGGG + Intergenic
1056589946 9:87958835-87958857 TTGGCTCCTGTCACTGTAGGGGG + Intergenic
1056828166 9:89891063-89891085 CTGGCACCTGAGCCTGGAGGAGG - Intergenic
1057344002 9:94231297-94231319 CTGGATGCTGCTTCTGTTGGTGG + Intergenic
1057438091 9:95060786-95060808 CTGCATCCTGATCCTGGAGGTGG - Exonic
1057677354 9:97146338-97146360 TTGGCTCATGGTTCTGTAGTAGG + Intergenic
1059173714 9:112150206-112150228 CTGCTGCCTGTTTCTGTAGGTGG - Intronic
1059637489 9:116185179-116185201 CTGGGTCCTGATTCTCTATCTGG - Intronic
1060038540 9:120280431-120280453 CTGACCCCTCATTCTGTAAGAGG + Intergenic
1060407176 9:123378571-123378593 CTTGGTCCTTATCCTGTAGGAGG + Exonic
1060949901 9:127594899-127594921 CTGGGCCCTGATTCTGTAGGGGG + Intergenic
1061776334 9:132967515-132967537 CTGGATCCTGATTCTAAAAGAGG + Intronic
1190270226 X:48857368-48857390 ATGGCCCATGATTCTGGAGGGGG - Intergenic
1190278409 X:48913885-48913907 GTGGTCCCTGATTCTGGAGGGGG - Exonic
1196487496 X:116229884-116229906 TTGGCTCCTAATTCTGTTGCAGG + Intergenic
1197896044 X:131316791-131316813 CAGGCTGCTGCTTCTGTAGAGGG - Intronic
1198566690 X:137912452-137912474 ATGGCTCCTGATTTGGTGGGAGG + Intergenic