ID: 923357375

View in Genome Browser
Species Human (GRCh38)
Location 1:233172699-233172721
Sequence CAGGAGTACCTGGAGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923357375_923357379 21 Left 923357375 1:233172699-233172721 CCTGCTTCCTCCAGGTACTCCTG No data
Right 923357379 1:233172743-233172765 TAATTCCTTATTATTTTGTCAGG 0: 1
1: 0
2: 3
3: 33
4: 464

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923357375 Original CRISPR CAGGAGTACCTGGAGGAAGC AGG (reversed) Intronic
No off target data available for this crispr