ID: 923358070

View in Genome Browser
Species Human (GRCh38)
Location 1:233180763-233180785
Sequence CAGGGAGCTGAGTCTTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 459}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923358069_923358070 -7 Left 923358069 1:233180747-233180769 CCTGTAAAGCAAATTGCAGGGAG 0: 1
1: 0
2: 0
3: 9
4: 128
Right 923358070 1:233180763-233180785 CAGGGAGCTGAGTCTTCCTGAGG 0: 1
1: 0
2: 4
3: 31
4: 459
923358066_923358070 5 Left 923358066 1:233180735-233180757 CCGAGAGCAGTACCTGTAAAGCA 0: 1
1: 0
2: 0
3: 18
4: 137
Right 923358070 1:233180763-233180785 CAGGGAGCTGAGTCTTCCTGAGG 0: 1
1: 0
2: 4
3: 31
4: 459
923358062_923358070 28 Left 923358062 1:233180712-233180734 CCCCATTGTGGAAGTCTAAACGC 0: 1
1: 0
2: 0
3: 1
4: 41
Right 923358070 1:233180763-233180785 CAGGGAGCTGAGTCTTCCTGAGG 0: 1
1: 0
2: 4
3: 31
4: 459
923358065_923358070 6 Left 923358065 1:233180734-233180756 CCCGAGAGCAGTACCTGTAAAGC 0: 1
1: 0
2: 1
3: 3
4: 89
Right 923358070 1:233180763-233180785 CAGGGAGCTGAGTCTTCCTGAGG 0: 1
1: 0
2: 4
3: 31
4: 459
923358064_923358070 26 Left 923358064 1:233180714-233180736 CCATTGTGGAAGTCTAAACGCCC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 923358070 1:233180763-233180785 CAGGGAGCTGAGTCTTCCTGAGG 0: 1
1: 0
2: 4
3: 31
4: 459
923358063_923358070 27 Left 923358063 1:233180713-233180735 CCCATTGTGGAAGTCTAAACGCC 0: 1
1: 0
2: 0
3: 0
4: 28
Right 923358070 1:233180763-233180785 CAGGGAGCTGAGTCTTCCTGAGG 0: 1
1: 0
2: 4
3: 31
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923358070 Original CRISPR CAGGGAGCTGAGTCTTCCTG AGG Intronic
900396876 1:2456714-2456736 CAGGGAGCTGGGCCTTCCTCTGG + Intronic
900850820 1:5141626-5141648 CAGGCAGTGGAGTCTTCGTGGGG + Intergenic
900869757 1:5293600-5293622 AAGGGAACTGAGCCTTCCAGAGG + Intergenic
901181879 1:7347511-7347533 CAGGGAGCTAAGCCTTCCTTGGG + Intronic
901235672 1:7666399-7666421 CCGGGAGCTGAGGCGGCCTGGGG - Intronic
901639584 1:10686576-10686598 CAGTGAGCTGAGACGGCCTGGGG - Intronic
902103272 1:14011517-14011539 CAGTGAGCTCATTCTTCCTATGG + Intergenic
902111128 1:14079147-14079169 CAATGAGCTGACGCTTCCTGAGG - Intergenic
902218651 1:14950595-14950617 CTGCGAGCTGAGTTTCCCTGTGG + Intronic
902383771 1:16065038-16065060 CAGGAAGGTGAGACCTCCTGGGG - Intronic
902981501 1:20126756-20126778 CAGTGTGCTGAGTCTGGCTGGGG - Intergenic
903491873 1:23735226-23735248 GAGGAAGCTGAGACTTGCTGAGG - Intergenic
904680239 1:32223950-32223972 CAGGCTGCTGAGGGTTCCTGGGG + Intronic
904715423 1:32464371-32464393 CAGGGAGCTTAGTTCTCATGGGG - Intergenic
905649135 1:39644928-39644950 CAGTGAGCAAATTCTTCCTGAGG - Intergenic
906528264 1:46508929-46508951 CCCTGAGCTGAGTCATCCTGGGG - Intronic
906960607 1:50417390-50417412 CTGGGAGAGGAGACTTCCTGTGG - Intergenic
908026005 1:59952210-59952232 CAGTAAGCTGAGTAATCCTGAGG + Intergenic
909802746 1:79833020-79833042 CATGGGGCTGAGTATTCCTAGGG - Intergenic
910221925 1:84896756-84896778 CAGTGAGCTGAGTAGTCATGAGG - Intergenic
910345120 1:86227780-86227802 AAGGGAACTGTGTTTTCCTGAGG - Intergenic
910631086 1:89355051-89355073 CAAGGTGTTGAGTCCTCCTGGGG + Intergenic
912155329 1:106911579-106911601 CAGGGACCAGAGTTTTCTTGTGG + Intergenic
912322264 1:108725174-108725196 AATGGAGCTGGGTCTTTCTGGGG - Intronic
912706912 1:111921501-111921523 CAGGAAGCTGTGTCTACCTCAGG + Intronic
912734803 1:112141285-112141307 CAGGGAGCTCATTATTCCAGAGG - Intergenic
913074064 1:115326229-115326251 CAGGGACATGTGTATTCCTGAGG + Intronic
913724708 1:121640113-121640135 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913725032 1:121643851-121643873 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913725360 1:121647585-121647607 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913725523 1:121649450-121649472 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913725858 1:121653182-121653204 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913726020 1:121655046-121655068 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913726353 1:121658778-121658800 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913726516 1:121660644-121660666 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913726679 1:121662509-121662531 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913726844 1:121664374-121664396 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913727009 1:121666239-121666261 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913727176 1:121668105-121668127 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913727345 1:121669971-121669993 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913727510 1:121671837-121671859 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913727674 1:121673703-121673725 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913727843 1:121675568-121675590 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913728012 1:121677434-121677456 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913728181 1:121679300-121679322 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913728345 1:121681166-121681188 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913728509 1:121683032-121683054 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913730049 1:121701685-121701707 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913730360 1:121705417-121705439 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913730920 1:121712368-121712390 CAGGGAGCTGAACATTCCTTTGG - Intergenic
913735481 1:121778589-121778611 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913735609 1:121779976-121779998 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913735860 1:121782992-121783014 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913736036 1:121784857-121784879 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913736198 1:121786721-121786743 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913736842 1:121794512-121794534 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913737018 1:121796378-121796400 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913737128 1:121797652-121797674 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913737293 1:121799518-121799540 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913737378 1:121800488-121800510 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913737858 1:121805909-121805931 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913738073 1:121808433-121808455 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913738405 1:121812547-121812569 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913738616 1:121814942-121814964 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913738747 1:121816496-121816518 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913738912 1:121818362-121818384 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913740228 1:121834970-121834992 CACGGAGCTGAATATTCCTTTGG - Intergenic
913741629 1:121851539-121851561 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913743205 1:121872196-121872218 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913743654 1:121877023-121877045 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913743973 1:121880754-121880776 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913744760 1:121890087-121890109 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913747126 1:121918641-121918663 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913747292 1:121920507-121920529 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913747755 1:121925736-121925758 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913748096 1:121929510-121929532 CACGGAGCTGAGGATTCCTTTGG - Intergenic
913751303 1:121970635-121970657 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913751481 1:121972589-121972611 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913752542 1:122035149-122035171 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913753039 1:122040751-122040773 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913753203 1:122042617-122042639 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913753363 1:122044482-122044504 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913753526 1:122046349-122046371 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913754185 1:122054156-122054178 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913755127 1:122065436-122065458 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913755300 1:122067305-122067327 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913756103 1:122076633-122076655 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913757078 1:122088001-122088023 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913757560 1:122093599-122093621 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913757726 1:122095468-122095490 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913757945 1:122097847-122097869 CACGGAGCTGAATATTCCTTTGG + Intergenic
913758045 1:122099200-122099222 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913758575 1:122105340-122105362 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913759866 1:122120531-122120553 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913761055 1:122133930-122133952 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913761220 1:122135795-122135817 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913761549 1:122139529-122139551 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913761868 1:122143266-122143288 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913762356 1:122148861-122148883 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913762683 1:122152592-122152614 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913764129 1:122169387-122169409 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913764440 1:122173121-122173143 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913764632 1:122175193-122175215 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913765096 1:122180792-122180814 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913765527 1:122185882-122185904 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913765683 1:122187746-122187768 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913766671 1:122199112-122199134 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913766724 1:122199625-122199647 CACGGAGCTGAATATTCCTTTGG + Intergenic
913767317 1:122206586-122206608 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913767632 1:122210318-122210340 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913767792 1:122212184-122212206 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913767951 1:122214050-122214072 CACGGAGCTGAGGATTCCTTTGG + Intergenic
913768763 1:122223388-122223410 CACGGAGCTGAGGATTCCTTTGG + Intergenic
914928645 1:151909890-151909912 CAGGGACTTCAGTCTTCCGGGGG - Intergenic
915346952 1:155202437-155202459 CAGGGACCTGAGTTTCCCAGAGG - Intronic
915526714 1:156480609-156480631 CATGGAGCAGAGCCTCCCTGTGG - Intronic
917121949 1:171652327-171652349 CAGGGAGCTGAGTCGAGCTTTGG + Exonic
917329990 1:173870777-173870799 CAGAGAGCTAAGTCCTCCTGAGG + Exonic
917571138 1:176266674-176266696 CAGGTAGCTGAGACTTACAGGGG + Intergenic
918984775 1:191609371-191609393 CAGGAAGTTGCTTCTTCCTGGGG + Intergenic
923355986 1:233156498-233156520 CATGGAGCTCAGTCTACCTTAGG + Intronic
923358070 1:233180763-233180785 CAGGGAGCTGAGTCTTCCTGAGG + Intronic
923746884 1:236709613-236709635 CAGGGAGCTGAGACATCAAGAGG - Intronic
924510652 1:244726888-244726910 GTTGGAGCTGAGTCCTCCTGTGG - Intergenic
1063221795 10:3975700-3975722 AAGGGAGGTCAGCCTTCCTGAGG + Intergenic
1063724245 10:8619768-8619790 AAGTGAGCTTTGTCTTCCTGAGG - Intergenic
1064186569 10:13167209-13167231 CAGGGAGCTGAGTCTTTAGAAGG + Intronic
1065223126 10:23516387-23516409 TATGGAGCTGAGTCTGCATGTGG - Intergenic
1065688170 10:28306810-28306832 CTGCGATCTGGGTCTTCCTGAGG - Intronic
1066164273 10:32769435-32769457 CAGGGAACTGAGTTTTCATTTGG + Intronic
1067703112 10:48587962-48587984 CAGGGAGCTCACCCTTCTTGGGG - Intronic
1069456535 10:68558534-68558556 CAGGGAGATGGGTCTTGCTGTGG + Intergenic
1070457999 10:76636461-76636483 CAGAGAGCTGACTCTACCTGGGG - Intergenic
1070986220 10:80692464-80692486 CAGGGTGCTGAGTTTTCTTCTGG + Intergenic
1071419709 10:85479974-85479996 CAGGTAGCTGAGGCTTGCTGGGG + Intergenic
1072172443 10:92878621-92878643 CAGGAAGTTGCTTCTTCCTGGGG + Intronic
1072500677 10:96014716-96014738 TAGGGAACTAAGTTTTCCTGAGG - Intronic
1072932684 10:99680497-99680519 CAGGGAGCTCATTCTTCCCCCGG - Intronic
1074160601 10:110833699-110833721 CGGGGAGGGGAGTCTGCCTGGGG - Intronic
1074891237 10:117738103-117738125 CATGGAACTGAGTGTTTCTGAGG - Intergenic
1075075503 10:119347816-119347838 CTGGGACCTGAGTCTTCCCTGGG + Intronic
1075315877 10:121453081-121453103 CAGGGAGCAGAGTCTTTCTGTGG + Intergenic
1075451087 10:122552471-122552493 CATGGAGCTCGGTCTTCATGTGG + Intergenic
1075649560 10:124118828-124118850 CAGGGAGCTGGGTCCTGCTCAGG - Intergenic
1076247113 10:128955949-128955971 CTGGGAGCTGAGGCTTCTTAAGG - Intergenic
1076543627 10:131229466-131229488 CCAGGAGCTGAGTGTTCCAGGGG - Intronic
1076642730 10:131929718-131929740 CCGGCAGCTGACTCTCCCTGGGG + Intronic
1076849212 10:133084844-133084866 CGGGGAGCTGAGCCTCCCTGAGG + Intronic
1076946603 10:133656130-133656152 GAGGGAGCTGTGTCTGACTGGGG - Intergenic
1078663028 11:13302324-13302346 CAGAGTGCTGCGTGTTCCTGGGG + Intronic
1079468891 11:20759544-20759566 CAGGAATCTAAGTCTTTCTGGGG + Intronic
1079570011 11:21931229-21931251 CAGGGTGCTTAGTCTCCATGGGG - Intergenic
1081846356 11:46243403-46243425 CTGGGAGTTGAGTCCTGCTGCGG + Intergenic
1083198390 11:61104623-61104645 CTGGGAACTGAGTATTCCTGGGG - Intronic
1083578786 11:63812020-63812042 CAGTGGGCTGAGTCTTGCGGGGG - Intergenic
1083780927 11:64916896-64916918 CAGCGACCTGAGGCTCCCTGCGG - Intronic
1085276355 11:75302648-75302670 AAGGAAGCTGAGCCTTCCAGAGG - Intronic
1085389841 11:76176724-76176746 CAGGGATCTGATTCCTGCTGAGG - Intergenic
1085467280 11:76732783-76732805 CAGAGAGCTGATTCTTGCTCAGG + Intergenic
1085945343 11:81264176-81264198 CTGGGAGCTGAGGTTTACTGTGG - Intergenic
1088345618 11:108821090-108821112 CAGGGAGTTGAGTGTTTCAGAGG + Intronic
1089128839 11:116195945-116195967 CAGGGAGCTGACTTTTTCTTCGG - Intergenic
1091125445 11:133091488-133091510 CGTGGAGGTGAGGCTTCCTGAGG + Intronic
1091130731 11:133145018-133145040 ATGGGAGCTGAGTCTTCAGGTGG + Intronic
1091718674 12:2796541-2796563 TTGGGAGCTGAGTATTCCTCTGG - Intronic
1092163213 12:6327561-6327583 CAGGTTGGTGGGTCTTCCTGGGG - Exonic
1094461151 12:30697417-30697439 CAAGGAGCTGGTTCTTCCTGAGG + Intergenic
1094513323 12:31110216-31110238 CAGGGAAGTAAGTCTTCCTGGGG + Intergenic
1094833463 12:34311391-34311413 CAGGGAGGTCAGGATTCCTGGGG + Intergenic
1095192286 12:39271334-39271356 CAAAGATCTGAGTCTTGCTGGGG - Intergenic
1095489320 12:42716700-42716722 CATGAAGCTGTGTCTGCCTGGGG + Intergenic
1096446591 12:51698403-51698425 CAGGGATGAGATTCTTCCTGAGG + Intronic
1096504215 12:52082445-52082467 CAGGGACCTCAGTGTTCCTGTGG + Intergenic
1098036255 12:66305119-66305141 CAATGAGATGAGTCTTCCTCTGG + Exonic
1098289552 12:68944908-68944930 CAGTGAGCTGAGTCTGCCTCTGG + Intronic
1100855062 12:98750831-98750853 CCCGCAGCTGAGGCTTCCTGCGG - Intronic
1101412085 12:104478028-104478050 CAGGGAGCTGTGTGTTGATGGGG + Intronic
1102009241 12:109607815-109607837 CAGGAAACTGCGCCTTCCTGAGG + Intergenic
1102047236 12:109837093-109837115 GAGGTAGCTGAGTCCACCTGGGG - Intergenic
1102407453 12:112686100-112686122 CATGGATCTGAGTCTTTCTGGGG + Intronic
1103046937 12:117743954-117743976 AAGGGAGCTGAGAATTCATGAGG - Intronic
1104002528 12:124869192-124869214 CAGGCAGCTGCGTGTTCCGGCGG - Intronic
1104082542 12:125443116-125443138 CGGGGAGCTGTGTCTGCCTTGGG + Intronic
1106078865 13:26484229-26484251 CAGGGACCTGAGCCCTGCTGAGG - Intergenic
1107082598 13:36390913-36390935 CAAGGAGCAGATTCTTCCCGGGG - Intergenic
1108510236 13:51148909-51148931 CAGGCAGCTGCTCCTTCCTGGGG + Intergenic
1112502586 13:99954610-99954632 CAGGGAGCTCTGTCATGCTGGGG + Intergenic
1112669053 13:101613844-101613866 CAGAGTGGTGAGTCTTCATGTGG - Intronic
1113778705 13:112963524-112963546 CAGGGAGGTGAGTGGCCCTGGGG - Intronic
1114695932 14:24627828-24627850 CTGGGACCTGATTCTTCCTGTGG + Intergenic
1117963783 14:61187374-61187396 CTGGGAGCTGAGACCACCTGTGG + Intergenic
1118311149 14:64694068-64694090 CAGGGACCTGTGTCTTTCTGGGG + Intergenic
1119380003 14:74222443-74222465 CAGGGGACTGACTCTTCCTGAGG - Intergenic
1121046378 14:90791249-90791271 CAGGGTGCTCAGGGTTCCTGGGG - Intronic
1202920709 14_KI270723v1_random:28752-28774 GAGGGAGCTGTGTCTGACTGGGG - Intergenic
1125725190 15:41864683-41864705 CAGTGAGCTCTGGCTTCCTGGGG + Intronic
1127685108 15:61335986-61336008 CAGGGTGCTAAGGCTTCCTGTGG - Intergenic
1128081874 15:64861676-64861698 CCTGGAGCTGGGGCTTCCTGAGG + Intronic
1128156957 15:65397056-65397078 CCGGGTGCAGAGTGTTCCTGAGG - Intronic
1128690989 15:69724850-69724872 CAAGGAACAGAGTCCTCCTGGGG + Intergenic
1130081903 15:80741156-80741178 CCAGGAGCTGAGTCTAACTGGGG - Intronic
1131073038 15:89477755-89477777 CAGTGAGCTGAGGGTTCCTAGGG - Intronic
1131178999 15:90227767-90227789 CCTGGGACTGAGTCTTCCTGGGG - Intronic
1131631868 15:94186021-94186043 CAGGGTGCTTAGTCTCCATGTGG + Intergenic
1131842147 15:96448886-96448908 CAGGTAGGTGAGCCTTCCTGGGG - Intergenic
1132238135 15:100237283-100237305 CAGGGGCCTGAGGCTTACTGAGG - Intronic
1133819584 16:9224678-9224700 GAGGAAGCTGAGGCTTACTGAGG - Intergenic
1133875226 16:9727588-9727610 CAGTGTGCTGAGGCTTCCTATGG - Intergenic
1135763593 16:25157447-25157469 CAGGAAGCTGAGGCAGCCTGGGG + Intronic
1138439041 16:57023485-57023507 CTTGGAGCTGAGTGTTTCTGGGG + Intronic
1138892849 16:61166004-61166026 CAGGGATTTGGATCTTCCTGTGG - Intergenic
1139510670 16:67426791-67426813 AAGGGAACTGAGGCTTCCAGAGG - Intergenic
1139949026 16:70660337-70660359 CAGGAAGCTGAGCCCTGCTGTGG - Exonic
1140355554 16:74302902-74302924 CATCGAGCTCTGTCTTCCTGGGG + Intronic
1142181409 16:88672687-88672709 CAGTGATCTGCGTCTTCCTGCGG + Intergenic
1142257343 16:89020408-89020430 AAGGGAGCTGTGTCTTCCTGTGG - Intergenic
1142604643 17:1074723-1074745 CGGGGAGCAGAGCCTTTCTGTGG - Intronic
1142613434 17:1121685-1121707 CAGGGCTCTGAGCCTTGCTGTGG + Intronic
1144075320 17:11714424-11714446 CAGTGAGCTGAGTATGCCTCGGG + Intronic
1144806791 17:17972982-17973004 CTGGGAGCTGAGGCTCCCGGAGG + Intronic
1144811034 17:17999079-17999101 CAGCTAGCTGGCTCTTCCTGAGG + Intronic
1144942368 17:18950611-18950633 CAGGCAGTTGAGCCTGCCTGAGG + Intronic
1145177482 17:20713533-20713555 CAGTGAGCTGAGGCAGCCTGGGG - Intergenic
1145207763 17:20993807-20993829 CAGTGATCTGAGGCTTTCTGTGG - Intergenic
1145960218 17:28882793-28882815 CTCTGAGCTGGGTCTTCCTGGGG + Intronic
1146006319 17:29162934-29162956 CAAGGGGCTGTGTCTCCCTGGGG + Intronic
1147976471 17:44250800-44250822 CAGTGACCTGAGTCACCCTGTGG + Intronic
1148614607 17:48990840-48990862 CTGGGAACTGAATCATCCTGAGG + Intergenic
1148686239 17:49502694-49502716 CAGGAAGCAGAGTTTTCCCGAGG + Intronic
1149531830 17:57401877-57401899 TTGAGAGCTGAGTCTCCCTGGGG + Intronic
1150229950 17:63544338-63544360 CAGCAATCTGGGTCTTCCTGAGG - Exonic
1150264248 17:63821674-63821696 CGGGGAGATGAGTCTTCCTTGGG - Intronic
1151413011 17:73943500-73943522 CAGGGAGCTGAGCATCCCTGGGG - Intergenic
1151535648 17:74737452-74737474 CAGGCAGCTGCGTCTCCCAGAGG + Intronic
1151852075 17:76696895-76696917 TACGCAGCTGATTCTTCCTGAGG + Intronic
1152169725 17:78736782-78736804 CTGGGAGCCAAGTTTTCCTGTGG + Intronic
1203170635 17_GL000205v2_random:145539-145561 GAGGGAGCTGTGTCTGACTGGGG - Intergenic
1153961882 18:10147228-10147250 CAGTGGGCTGAGGCTTCCTCAGG - Intergenic
1157622749 18:49025748-49025770 CAGGGAGGTGAGTCCTGCTCAGG - Intergenic
1159346455 18:67212881-67212903 CAGAGACCAGAGTCTACCTGAGG - Intergenic
1160299649 18:77668420-77668442 CATGGAGCTGATTCCACCTGAGG + Intergenic
1160931870 19:1574690-1574712 CAGAAAGCTGAGTCTTGCTCCGG + Intronic
1161027486 19:2043220-2043242 AGAGGAGCTGAGGCTTCCTGAGG + Intronic
1164037788 19:21469072-21469094 GAGGGAGCTGTGTCTGACTGGGG + Intronic
1164575203 19:29401782-29401804 CAGAGAGCTGAGTCAGCCTCGGG - Intergenic
1164981691 19:32619244-32619266 CAGAGAGGTGAGGCTTCCAGAGG - Exonic
1166527494 19:43521574-43521596 CAGGGAACTGAGGCTCCCAGAGG + Intronic
1166797983 19:45439695-45439717 CAGGGCGCAGAATCTTCCAGGGG - Intronic
1166850609 19:45758875-45758897 CAGGGAGCCCACTGTTCCTGGGG + Exonic
1167816973 19:51891553-51891575 CAGTGAGCTGAGACTTCTTGAGG + Exonic
1168681840 19:58321578-58321600 CAGGGAGCTGAGACTTTGAGAGG + Intergenic
925203465 2:1987634-1987656 CAGTGAGCTGAGGCTGCGTGGGG + Intronic
927495648 2:23549973-23549995 CAGGGAGCTGGGCCACCCTGGGG + Intronic
928408397 2:31032922-31032944 CTGGGAGCTGACTGTTCCAGTGG - Intronic
929264793 2:39905715-39905737 CAATGGCCTGAGTCTTCCTGGGG - Intergenic
929608434 2:43251628-43251650 CAGGGAGCTGTGTCCAGCTGGGG + Intronic
930682446 2:54271490-54271512 CAGTGTGCTGAGTCCTCCTTTGG - Intronic
930864891 2:56112659-56112681 CAGGGAGCTGGCTTGTCCTGTGG + Intergenic
933200343 2:79440771-79440793 GAGGGAGCTGAGTCTTCCCAAGG - Intronic
933852567 2:86382358-86382380 CAGGGATTTGGGCCTTCCTGTGG + Intergenic
935148061 2:100409705-100409727 CAGGTAGCTGTTTGTTCCTGTGG - Intronic
935271044 2:101434891-101434913 GTCGGGGCTGAGTCTTCCTGGGG - Intronic
935944258 2:108271307-108271329 CAGGGAACTGGGCTTTCCTGGGG + Intergenic
935997454 2:108789254-108789276 AAGGGAGCAGAGTCTTCATTTGG - Intronic
941201466 2:162516498-162516520 TAGGGAGGGGAGTCTTGCTGGGG + Intronic
944524403 2:200603794-200603816 CAGGGAGTTGAGGCCTCCAGAGG + Intronic
944540553 2:200749767-200749789 CAGGGAGCTGAGGTTTTGTGAGG - Intergenic
946224325 2:218255101-218255123 CAGGGACCAGAGTCCTGCTGGGG - Intergenic
946331732 2:219013430-219013452 CAGGGAGCTGTGTTCTCCTGGGG - Intronic
948053147 2:234993071-234993093 AAGGGAGCTGGGTCCTTCTGGGG + Intronic
948799323 2:240424342-240424364 CTGAGGGCTGGGTCTTCCTGAGG + Intergenic
948864076 2:240766592-240766614 TAGGGAGCTGAGCCTCCTTGAGG - Intronic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1171045898 20:21809280-21809302 GCGGGAGCTGGGGCTTCCTGGGG + Intergenic
1172941222 20:38656041-38656063 GAGGGTGCTGAGCCTGCCTGGGG - Intergenic
1173108168 20:40158158-40158180 GAGGGAGCTGAGTTTGTCTGGGG - Intergenic
1173553324 20:43948547-43948569 CAGGGAGGTGAGGTTTCCAGTGG + Intronic
1174137888 20:48393110-48393132 CAGGGAACTGGGTCTTGCAGCGG + Intergenic
1174139886 20:48405508-48405530 CGGGGATCCGAGTCTTGCTGTGG - Intergenic
1174340264 20:49890991-49891013 CACGGACCTGAGACTTCATGAGG - Exonic
1176064375 20:63187171-63187193 CAGGCAGCTCAGTCTTCTAGGGG - Intergenic
1178473695 21:32917935-32917957 CTTGGACTTGAGTCTTCCTGTGG + Intergenic
1180108063 21:45632985-45633007 TAGGTCCCTGAGTCTTCCTGGGG + Intergenic
1181669941 22:24421324-24421346 GAGCGTCCTGAGTCTTCCTGAGG - Intronic
1181757268 22:25032781-25032803 CATGTTTCTGAGTCTTCCTGGGG - Intronic
1182055372 22:27349371-27349393 CAGGGAGTTGCTTCTCCCTGGGG + Intergenic
1183407794 22:37639145-37639167 CTGGGAGCTTTGGCTTCCTGGGG - Intronic
1183502936 22:38192041-38192063 CAGGAACCTGAGTCAGCCTGGGG + Intronic
1184288708 22:43486753-43486775 AGGGGAGGTGAGCCTTCCTGGGG + Intronic
1184892825 22:47390012-47390034 CGTGGAGCTGGGTCCTCCTGGGG - Intergenic
951674867 3:25226865-25226887 CACAGAGTTAAGTCTTCCTGAGG - Intronic
952454281 3:33458110-33458132 CAGGAAGCTGTTTCTTGCTGGGG + Intergenic
954363816 3:50135935-50135957 CATGGAGCTGAGGCTTTCAGGGG + Intergenic
955408458 3:58640752-58640774 CAGGGAACCGAGTCTTCTGGAGG + Intronic
956440951 3:69279830-69279852 AAGGGAGCTGAGGCTGTCTGTGG + Intronic
957021922 3:75137335-75137357 CAAGGTCCTAAGTCTTCCTGGGG - Intergenic
957080869 3:75634347-75634369 GAGGGAGCTGTGTCTGACTGGGG + Intergenic
957687344 3:83518412-83518434 CATAGGGCTGAGTCTTCCAGAGG + Intergenic
958638046 3:96770651-96770673 CAGGGATTTGAGCTTTCCTGTGG - Intergenic
961592352 3:127990433-127990455 CAGGGAGCAAAGTGTCCCTGAGG + Intergenic
961697895 3:128718906-128718928 AAGGGAGCTGGGTTTTTCTGTGG - Intergenic
963264209 3:143223198-143223220 CAGGATGGTGAGTGTTCCTGAGG - Intergenic
963715476 3:148798046-148798068 CAGGCAGCTGAGTGTACCTTTGG + Intronic
965150963 3:164974349-164974371 CAGGAAGTTGCTTCTTCCTGAGG + Intergenic
966851659 3:184168613-184168635 CAGGGCTCTGAGGCTGCCTGTGG - Intronic
968513356 4:1004834-1004856 CGGGGAGCTGAGGCTGCATGAGG + Intergenic
969503999 4:7572140-7572162 CTGTGAGCTGGGTCTTCCTTGGG + Intronic
969588288 4:8107154-8107176 CATGGAGCTGAATATTGCTGCGG + Intronic
969902253 4:10360686-10360708 CAGGGAGGTATGTCTTCCTGTGG - Intergenic
970182132 4:13409833-13409855 CAGGGACCTGTTTCTTTCTGTGG - Intronic
975806803 4:78121131-78121153 CAGGAACCTGAGTATTCCAGCGG + Intronic
977014878 4:91679477-91679499 CAAGGAGATGAGTCCACCTGAGG - Intergenic
977293744 4:95190776-95190798 CAGGGATCTGAGCAATCCTGTGG + Intronic
978562300 4:110046021-110046043 CAAGAAGCTGAATCTTCCAGTGG + Exonic
981951993 4:150421750-150421772 CAGAGAGCTGCACCTTCCTGGGG - Intronic
983518027 4:168677712-168677734 CAGGGAGCTGAGAAACCCTGAGG - Intronic
984532587 4:180934785-180934807 CAAAGAGCTGTGTATTCCTGTGG - Intergenic
985450019 4:190056791-190056813 GAGGGAGCTGCGTCTGACTGGGG - Intergenic
985607058 5:863443-863465 ATGGGAGCTCAGTCGTCCTGGGG - Intronic
985717396 5:1470311-1470333 CAGGGAGCAGCGACTCCCTGTGG + Intronic
988411975 5:30897760-30897782 CAGGGAGTTGAGCCTCCCTGAGG - Intergenic
988481378 5:31634178-31634200 CATGGCACTGAGTCTTCTTGGGG - Intergenic
988997691 5:36730282-36730304 CAGGGAGCTCAGAATTTCTGAGG + Intergenic
989306972 5:39969365-39969387 CAAGAAGCTGCGTCTCCCTGGGG - Intergenic
995463036 5:112422062-112422084 CTGGGAGGTGAGTCGTACTGAGG - Intergenic
995532147 5:113102200-113102222 CTGGCAGCTGAGTCTGTCTGTGG + Intronic
997706915 5:135964100-135964122 CATGGACCTGAGTCTTTTTGAGG - Intergenic
998737130 5:145155073-145155095 CATGTGGCTGGGTCTTCCTGAGG - Intergenic
999191655 5:149752401-149752423 CAGGCAGCTGGGTCTTCCTGGGG - Intronic
1000694038 5:164358307-164358329 CAGGGAGCAGAGTCCTCAGGTGG - Intergenic
1001471958 5:172020799-172020821 CAAGGTGCTCAGTCTTTCTGAGG - Intergenic
1002083106 5:176749059-176749081 CTGGAAGCTGAGTCTCTCTGAGG + Intergenic
1002660137 5:180786233-180786255 CAGGGGGCTGAGTCTTCTCAGGG - Intergenic
1006153840 6:32003576-32003598 CAGGGAGCAGTGTGGTCCTGTGG + Intergenic
1006160148 6:32036313-32036335 CAGGGAGCAGTGTGGTCCTGTGG + Intergenic
1007388932 6:41538646-41538668 CAGGGAACTAACACTTCCTGGGG - Intergenic
1007928088 6:45666037-45666059 CAGGGAGGCCAGGCTTCCTGTGG + Intergenic
1008435054 6:51466426-51466448 AAGGGAGCGCAGTGTTCCTGTGG + Intergenic
1009194631 6:60669162-60669184 CAAGGAACAGATTCTTCCTGAGG - Intergenic
1009742533 6:67765825-67765847 CACGGAACTGAGCCTTCCTGAGG + Intergenic
1011260158 6:85462064-85462086 CAGCCAGCTGAATATTCCTGTGG + Intronic
1012475410 6:99611290-99611312 CATTGAGCTGAGTCATTCTGCGG + Intronic
1015839892 6:137465980-137466002 CCTGGAGCTCAGTCATCCTGCGG + Intergenic
1016335990 6:143005729-143005751 CAGGGAGCTTAGATTTCCTAGGG - Intergenic
1018735036 6:166681539-166681561 GAGAGAGCTCAGCCTTCCTGGGG - Intronic
1019607567 7:1917864-1917886 CTGGGGGCTTTGTCTTCCTGGGG - Intronic
1020013842 7:4820076-4820098 CCCTGAGCTGACTCTTCCTGTGG + Intronic
1020276689 7:6628798-6628820 CAGGGGTCTGAGTGGTCCTGTGG + Intergenic
1021419575 7:20430424-20430446 AAGGAAGCTGAGTGTTTCTGGGG - Intergenic
1022522316 7:31016326-31016348 CAAGGAGCTGCCTCTACCTGGGG - Intergenic
1022585044 7:31600806-31600828 CAGGAAGTTGCTTCTTCCTGGGG + Intronic
1025149977 7:56540183-56540205 GAAGGAGCTGAGTTTTTCTGTGG + Intergenic
1025150320 7:56542104-56542126 CAGGGAGCTGAGTCTCCAGAGGG + Intergenic
1025490642 7:61116598-61116620 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025490805 7:61119333-61119355 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025490968 7:61122068-61122090 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025491129 7:61124802-61124824 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025491290 7:61127536-61127558 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025491449 7:61130270-61130292 CACGGAGCTGAAACTTCCTTTGG + Intergenic
1025491608 7:61133004-61133026 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025491765 7:61135738-61135760 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025491902 7:61138130-61138152 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025492235 7:61143768-61143790 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025492395 7:61146502-61146524 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025492558 7:61149236-61149258 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025492720 7:61151970-61151992 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025492877 7:61154703-61154725 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025493037 7:61157437-61157459 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025493361 7:61162905-61162927 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025493522 7:61165639-61165661 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025493684 7:61168373-61168395 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025493840 7:61171107-61171129 CACGGAGCTGAAACTTCCTTTGG + Intergenic
1025494046 7:61174697-61174719 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025494201 7:61177431-61177453 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025494363 7:61180165-61180187 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025494663 7:61185292-61185314 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025494824 7:61188026-61188048 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025494981 7:61190758-61190780 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025495142 7:61193492-61193514 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025495313 7:61196398-61196420 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025495475 7:61199132-61199154 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025495637 7:61201866-61201888 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025495797 7:61204599-61204621 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025495955 7:61207333-61207355 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025496117 7:61210067-61210089 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025496280 7:61212801-61212823 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025496442 7:61215535-61215557 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025496606 7:61218269-61218291 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025496765 7:61221003-61221025 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025496925 7:61223736-61223758 CACGGAGCTGAACCTTCCTTCGG + Intergenic
1025497263 7:61229545-61229567 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025497419 7:61232279-61232301 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025497583 7:61235013-61235035 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025497742 7:61237747-61237769 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025498051 7:61243215-61243237 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025498376 7:61248683-61248705 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025498531 7:61251416-61251438 CACGGAGCTGAAACTTCCTTTGG + Intergenic
1025498688 7:61254150-61254172 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025498846 7:61256884-61256906 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025499021 7:61259960-61259982 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025502870 7:61377999-61378021 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025503028 7:61380733-61380755 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025503191 7:61383467-61383489 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025503356 7:61386202-61386224 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025503514 7:61388937-61388959 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025503675 7:61391671-61391693 CACGGAGCTGAAACTTCCTTTGG + Intergenic
1025503832 7:61394405-61394427 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025503992 7:61397139-61397161 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025504151 7:61399873-61399895 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025504315 7:61402607-61402629 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025504477 7:61405341-61405363 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025504639 7:61408075-61408097 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025504800 7:61410809-61410831 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025505123 7:61416276-61416298 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025505285 7:61419011-61419033 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025505448 7:61421745-61421767 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025505613 7:61424476-61424498 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025505778 7:61427210-61427232 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025505956 7:61430114-61430136 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025506114 7:61432849-61432871 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025506275 7:61435583-61435605 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025506436 7:61438317-61438339 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025506593 7:61441051-61441073 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025506755 7:61443784-61443806 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025506919 7:61446518-61446540 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025507073 7:61449247-61449269 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025507243 7:61452001-61452023 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025507404 7:61454735-61454757 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025507570 7:61457473-61457495 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025507733 7:61460209-61460231 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025507897 7:61462944-61462966 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025508058 7:61465679-61465701 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025508218 7:61468412-61468434 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025508377 7:61471146-61471168 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025508539 7:61473880-61473902 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025508697 7:61476614-61476636 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025508855 7:61479348-61479370 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025509019 7:61482081-61482103 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025509184 7:61484823-61484845 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025509500 7:61490292-61490314 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025509660 7:61493026-61493048 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025509824 7:61495759-61495781 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025509987 7:61498493-61498515 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025510147 7:61501228-61501250 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025510310 7:61503962-61503984 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025510470 7:61506697-61506719 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025510635 7:61509431-61509453 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025510803 7:61512164-61512186 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025510956 7:61514899-61514921 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025511115 7:61517634-61517656 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025511280 7:61520368-61520390 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025511449 7:61523103-61523125 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1025511611 7:61525837-61525859 CACGGAGCTGAACCTTCCTTTGG + Intergenic
1026957824 7:74389000-74389022 CAGGGCGCTGATTCTCCCAGGGG - Intronic
1029839984 7:103351999-103352021 CAGCGAGCTAATTCTTCCTAAGG + Intronic
1032433572 7:131882292-131882314 CAGGGTGCTGTGTATCCCTGTGG + Intergenic
1032643851 7:133799322-133799344 CCAGGAGCTGAGTCTGACTGAGG + Intronic
1032985425 7:137331751-137331773 CAGGCAGCTGTGTCTTCCCTGGG + Intronic
1035743944 8:1948052-1948074 CTGGGCGCTGAGCCTTCCTTGGG + Intronic
1036800468 8:11787146-11787168 CAGGGAGCTGCGCCTTCCTGGGG + Exonic
1037122832 8:15310108-15310130 AATGGAGCTGAGTCTTACAGGGG - Intergenic
1038020387 8:23547950-23547972 CAGGAAGCTGAGTCATCCAGGGG + Intronic
1038428204 8:27479063-27479085 CAGAGAGGTGGGTTTTCCTGGGG + Exonic
1038536924 8:28360191-28360213 AAGGATGCTGAGTCTACCTGGGG + Intronic
1038964977 8:32562077-32562099 AAAGGATCTGTGTCTTCCTGAGG - Intronic
1039060317 8:33567172-33567194 CAAGGGGCGGAGTTTTCCTGGGG - Intergenic
1039736924 8:40343096-40343118 CAGGGAACTGGGTTTTCATGTGG - Intergenic
1040574812 8:48642341-48642363 GAGGAAACTGAGTCTTACTGTGG - Intergenic
1044737544 8:95294769-95294791 CACGGACCTGAGACTTCATGGGG - Intergenic
1045486064 8:102632791-102632813 CAGGAAGCTCAGGCTTCCAGGGG - Intergenic
1046799993 8:118415640-118415662 CATGCAGCTGACTCTTACTGAGG + Intronic
1047403615 8:124566996-124567018 CAAGGCCCTGAGTGTTCCTGTGG - Intronic
1048884418 8:138898252-138898274 CAAGGAGCTTTGTCTTTCTGGGG - Intronic
1049082334 8:140453185-140453207 CAGTGGGCTGACACTTCCTGAGG + Intronic
1049305370 8:141899989-141900011 CTGGGTCCTGAGCCTTCCTGGGG + Intergenic
1049470595 8:142773539-142773561 GAGGGGGCAGAGTCTTGCTGAGG - Intronic
1053052557 9:34973863-34973885 GAGGGAGCAGTGTGTTCCTGGGG - Intronic
1053393688 9:37753648-37753670 TAGGGAGCTGCGTCCTGCTGTGG - Intronic
1053430609 9:38039718-38039740 GAGGGAGCTGAGCTTCCCTGAGG - Intronic
1056143841 9:83709521-83709543 TAGGGAGTGAAGTCTTCCTGGGG - Intergenic
1057044626 9:91875859-91875881 CCAGGTTCTGAGTCTTCCTGTGG - Intronic
1059731030 9:117057277-117057299 CAAGGAGCTGAGAGTCCCTGGGG - Intronic
1059820661 9:117968787-117968809 CAGGAAGCTGAGACTTCTTGAGG - Intergenic
1060528394 9:124333367-124333389 CAGGGTGCTGTGTCTCACTGGGG - Intronic
1061532357 9:131224668-131224690 CAGGTAGCTTAGTCTTTCTTTGG + Intronic
1061754790 9:132804807-132804829 CAGGGAGGTGGGACTTGCTGGGG - Intronic
1062058914 9:134484031-134484053 AAGGGAGGTGAGTGTTCGTGGGG + Intergenic
1062231161 9:135482044-135482066 CGGGGAGGGGAGTTTTCCTGGGG - Intronic
1203435497 Un_GL000195v1:133137-133159 GAGGGAGCTGTGTCTGACTGGGG + Intergenic
1188649328 X:32612140-32612162 CCTGGAGCTCAGTCTTACTGGGG + Intronic
1192053017 X:67744595-67744617 CAGGGAGCTGGGCCCTCCTGTGG - Intergenic
1192733815 X:73829160-73829182 CAGAGAGCTGAGTCTTCAGCAGG - Intergenic
1195708647 X:107756935-107756957 CTGGGAACTCAGTCTTCCCGGGG + Intronic
1198677614 X:139147455-139147477 GAGGAAGCTGAGTCTTACTGAGG - Intronic
1200041865 X:153376428-153376450 CAGAGAGCAGAATCTTCCAGAGG + Intergenic