ID: 923362254

View in Genome Browser
Species Human (GRCh38)
Location 1:233223260-233223282
Sequence AATCAACGGTGACCCTGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 71}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923362251_923362254 13 Left 923362251 1:233223224-233223246 CCAAATGAGTCTAGTAACGTGAG 0: 1
1: 0
2: 0
3: 0
4: 39
Right 923362254 1:233223260-233223282 AATCAACGGTGACCCTGACAAGG 0: 1
1: 0
2: 0
3: 9
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923362254 Original CRISPR AATCAACGGTGACCCTGACA AGG Intronic
900334830 1:2157307-2157329 ATTCAACGGTCACCTTGACTGGG - Intronic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
916635672 1:166665798-166665820 AATAAAAGGGGACACTGACATGG + Intergenic
918237241 1:182592463-182592485 AGTCAACGGTGGCCCAGACCAGG + Intergenic
923362254 1:233223260-233223282 AATCAACGGTGACCCTGACAAGG + Intronic
924095848 1:240549995-240550017 AACAATCGGTGCCCCTGACATGG - Intronic
1063630179 10:7726068-7726090 CATCATTGGTGACCTTGACAAGG + Intronic
1067121485 10:43475625-43475647 TATCAACAGTGAACATGACAAGG + Intronic
1068587517 10:58816025-58816047 AAACATTGGTGACCTTGACAAGG - Intronic
1072794046 10:98340657-98340679 AAATAACAGTGACCCAGACAAGG - Intergenic
1073186796 10:101619849-101619871 GAACAATGGTGACCCTGAAAGGG + Intronic
1074308726 10:112302655-112302677 AATCATGGCTGACCCTGACTGGG - Intronic
1083013568 11:59427527-59427549 AATCAACTGTGAACATGAAAAGG + Intergenic
1084694611 11:70746123-70746145 CTTCAAAGGTGACTCTGACACGG + Intronic
1091122058 11:133065015-133065037 AAGAAACGGTGTCCCTGACAAGG + Intronic
1093668096 12:21838671-21838693 AATCCACTGTCACCCTTACAAGG - Intronic
1106087283 13:26554791-26554813 AATCAAAGATGTCCCTCACAAGG - Intergenic
1106986359 13:35356602-35356624 AATCAACGGTCACTCTAATATGG - Intronic
1109782758 13:67133875-67133897 AATCCACGGTGAGGCTGAAATGG + Intronic
1118957834 14:70499089-70499111 AATCACTGGTGTCCCTGAAAGGG + Intergenic
1125601214 15:40916650-40916672 AAGCACGGGGGACCCTGACAGGG + Intergenic
1125816314 15:42587853-42587875 AATCAAGGGCCACCCTGGCATGG - Intronic
1126411069 15:48373695-48373717 AGTCATTGGTGACACTGACATGG - Intergenic
1128125836 15:65192237-65192259 AATCAACCGTGGCCATGGCAGGG - Intergenic
1130416448 15:83698787-83698809 AGTCAACGTTGACTTTGACAAGG - Intronic
1136369481 16:29827033-29827055 AATCAAAGGTGAGCAGGACAGGG + Intronic
1136990547 16:35148882-35148904 AACCAACAGTGCCCCTGAGAGGG - Intergenic
1140794944 16:78428453-78428475 AATCAGGGGTCACCCTTACAGGG + Intronic
1143521210 17:7445361-7445383 GACCAACGCTGACCCTGACACGG - Exonic
1144340550 17:14306274-14306296 AATCAAGGGAGTCACTGACATGG + Intronic
1145126206 17:20302132-20302154 AATGAAGTGTGACCCTGAGAGGG + Intronic
1167596128 19:50429073-50429095 TAACAAGGGTGTCCCTGACAGGG - Exonic
1167680853 19:50919782-50919804 ATACAATGGTGACCCTGACAGGG - Intergenic
1168352021 19:55681273-55681295 AATCCACGGTTACCCTGTAAAGG + Intronic
925563110 2:5219803-5219825 TACCAACGGTGACCATGCCAGGG + Intergenic
926789930 2:16560118-16560140 AATCATCAGTGACCCTGTCAAGG - Intronic
927336198 2:21927656-21927678 ACTCAACTGTGAACTTGACAGGG - Intergenic
931294859 2:60912230-60912252 AATCACCTGTGACCCTGAACTGG + Intronic
931807234 2:65819033-65819055 AGTCATTGGTGACCTTGACAAGG - Intergenic
932290194 2:70570726-70570748 AATCAAGGGGGCCCCTGAAAAGG - Intergenic
936059641 2:109286040-109286062 AATCAATGGTGTTTCTGACATGG + Intronic
945499743 2:210556916-210556938 AAGCAAAGGTGTCCCTTACAAGG + Intronic
1174166157 20:48584882-48584904 AACCAACCCTGACCCTGACAAGG - Intergenic
1181037558 22:20177248-20177270 AATCTAGGGGGAACCTGACATGG - Intergenic
1182499593 22:30736530-30736552 TATCAGCTGTGACCCTGAGAAGG + Intronic
1183190937 22:36321845-36321867 GATCAGAGGTGCCCCTGACATGG + Intronic
1184110687 22:42392397-42392419 AGTCAATGGTGACCCTGAGAAGG + Intronic
959916381 3:111821087-111821109 AATCACTGGGGACCCTGACATGG - Intronic
965121445 3:164562910-164562932 AATCTAAGTTGACTCTGACAAGG - Intergenic
968225012 3:196968101-196968123 AAGCAAAGGTGACCCTGCCAGGG - Intronic
971167501 4:24199061-24199083 AATCAACAGAGACCCTGCCAGGG - Intergenic
977055924 4:92190412-92190434 TATCATTGGTGACCTTGACATGG - Intergenic
978867585 4:113532812-113532834 TATCAAGGGTGACACTGAGAAGG - Intronic
985580012 5:691515-691537 GATCAGCGGTGACACTGAGAGGG + Intronic
985594859 5:783574-783596 GATCAGCGGTGACACTGAGAGGG + Intergenic
989398164 5:40980809-40980831 AACCAAAAGTGACCCAGACATGG - Intronic
989426350 5:41300515-41300537 GGTCAATAGTGACCCTGACATGG + Intergenic
994385965 5:99132259-99132281 AGTCATTGGTGACCTTGACAAGG - Intergenic
995037652 5:107553271-107553293 AATCCCCAGTGACCCTGCCATGG + Intronic
1000179467 5:158794087-158794109 AATCAACTATGACCCTGTCCTGG - Intronic
1001957537 5:175858415-175858437 AATCCACGAAGACCCTGGCAGGG + Intronic
1004997638 6:21209542-21209564 AATCAATTGTGACCCTGGTAGGG + Intronic
1005670147 6:28097586-28097608 ACTCAATGGGGAACCTGACAAGG - Intergenic
1007113555 6:39327702-39327724 AATTAATGGAGAGCCTGACATGG + Intergenic
1012954319 6:105552694-105552716 AATAAACTGTGGCCCTTACAGGG + Intergenic
1014726239 6:124975367-124975389 AATCACAGGTGACTCTGATATGG + Intronic
1017744017 6:157430798-157430820 AATCACTGGTGGCCCTGCCAAGG + Intronic
1025986723 7:66459644-66459666 AATCAGCTGTGACCCTGAATTGG - Intergenic
1026003252 7:66579892-66579914 AATCAGCTGTGACCCTGAATTGG - Intergenic
1027209997 7:76138489-76138511 AATCAGCTGTGACCCTGAATTGG - Intergenic
1027766159 7:82345031-82345053 AATCATTGGTGATCCTGACTAGG - Intronic
1027886754 7:83917996-83918018 CATCAACTTTGACCCTGAGATGG - Intergenic
1030080863 7:105776582-105776604 ATTGAATGGTGAGCCTGACAGGG + Intronic
1030632495 7:111911044-111911066 AATTATCTGTGATCCTGACAAGG - Intronic
1039098663 8:33915618-33915640 AAGCAACAGTGAACCTGTCAGGG - Intergenic
1040482286 8:47836994-47837016 AAGCAATGGCGATCCTGACAAGG + Intronic
1047139462 8:122121001-122121023 AGTCATTGGTGACACTGACAAGG + Intergenic
1055640980 9:78318818-78318840 ATTGAATGGTGACCCTGAAAAGG - Intronic
1061859626 9:133461211-133461233 AACCCAAGGTGACCCTGAAAAGG - Intronic
1191189859 X:57655345-57655367 AATTCCCGGTGACCATGACAGGG - Intergenic
1194771619 X:97913900-97913922 CATGAACGGAGACCCTAACAAGG + Intergenic