ID: 923366495

View in Genome Browser
Species Human (GRCh38)
Location 1:233266936-233266958
Sequence CAGACAGAGGTGGGTCCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923366495 Original CRISPR CAGACAGAGGTGGGTCCAAT GGG (reversed) Intronic
900887730 1:5427367-5427389 CAGTCTGAGCTGGGGCCAATGGG - Intergenic
908820262 1:68078607-68078629 CAGACTGAAGTGGGACCACTGGG + Intergenic
909933627 1:81526941-81526963 TAGCCAGAGGTGGCTCCAAACGG - Intronic
913179839 1:116310998-116311020 GAGGCAGAAGTGGGTCCATTTGG + Intergenic
920421705 1:205838872-205838894 GGGAGAGAGGTGGGTTCAATAGG - Intronic
923366495 1:233266936-233266958 CAGACAGAGGTGGGTCCAATGGG - Intronic
924234110 1:241986327-241986349 CAGACAGACCTGGGTTCAAAAGG - Intergenic
924803382 1:247344088-247344110 CAGCCAGGGGTGGCTCCAAGGGG + Intergenic
1065804205 10:29380033-29380055 CACACAGAGGTCAGTCCATTAGG + Intergenic
1065833905 10:29640061-29640083 AAGACAGAGGTGGGGCCCAAGGG - Intronic
1070558428 10:77547527-77547549 CACACAGAGGTGGGCCCGGTTGG - Intronic
1071825670 10:89322930-89322952 CAGACAGAAGTGGAACCACTGGG - Intronic
1072188207 10:93061520-93061542 GAGACTGAGGAGGGTCCAGTGGG - Intronic
1074700151 10:116085565-116085587 CAGGCAGAGGAGGGTCAGATGGG + Intronic
1076510757 10:131012256-131012278 CAGCCAGAGGGTGGTCCAACTGG + Intergenic
1076614320 10:131746205-131746227 CATACAGAGGTGGCTCCAACAGG + Intergenic
1078179932 11:9003370-9003392 CAGACAGAGGTGATTCCTAATGG - Intronic
1078946237 11:16071343-16071365 CAGACAGAAGTGAGACCACTGGG - Intronic
1081035310 11:38136911-38136933 GAGACAGAGGTGGGCCCTCTGGG - Intergenic
1084071289 11:66737499-66737521 CAGGCAGATCTGGGACCAATGGG + Intergenic
1087765049 11:102141787-102141809 GACACAATGGTGGGTCCAATGGG - Intronic
1091519405 12:1221055-1221077 CAGACAGTGATAAGTCCAATGGG - Intronic
1091843897 12:3640304-3640326 GACACAGAGGTAGGTCCATTTGG + Intronic
1096714283 12:53482006-53482028 CTGAAGGAGGTGGGTCCAGTGGG + Exonic
1098167870 12:67716753-67716775 CAGACTGTGGTCGGGCCAATGGG - Intergenic
1101202629 12:102452767-102452789 CAGAAAGAGCTGGGTCAAAGAGG + Intronic
1103067148 12:117908986-117909008 CATAGAGAGGTGGCTTCAATAGG + Intronic
1107590798 13:41902875-41902897 CAGTCATAGGTGCGTACAATGGG + Intronic
1109498956 13:63213416-63213438 GAGATAGGGGTGGGGCCAATAGG - Intergenic
1113617503 13:111691367-111691389 CAGGCTGAGGAGGGTCCAAGTGG + Intergenic
1113623033 13:111776627-111776649 CAGGCTGAGGAGGGTCCAAGTGG + Intergenic
1113715185 13:112500002-112500024 CAGGCAGAGGAGGGTGGAATTGG + Intronic
1114233333 14:20803045-20803067 CAGACAGATGTGGTTCACATAGG - Exonic
1124505801 15:30272231-30272253 CATACAGAGATGGGTCCAAATGG + Intergenic
1124737752 15:32266401-32266423 CATACAGAGATGGGTCCAAATGG - Intergenic
1127257313 15:57303231-57303253 AAGACAGAGGTGGGTCCTGGAGG - Intergenic
1129670634 15:77605965-77605987 CAGCCAGAGTTGGGTACAACGGG - Intergenic
1129678734 15:77646201-77646223 TAGACACAGGTGGGGACAATTGG - Intronic
1133397202 16:5457503-5457525 TCTTCAGAGGTGGGTCCAATGGG - Intergenic
1135294253 16:21265421-21265443 CAGAGAGAGGTGTTTTCAATAGG - Intronic
1135473749 16:22755249-22755271 CACACAGAGGTGGAGGCAATGGG + Intergenic
1142029509 16:87831580-87831602 CAGCCAGAGGTGGAGCCAAGTGG - Exonic
1142488764 17:263950-263972 CAGGCAGAGCTGGGTCCAGCAGG + Intronic
1144666052 17:17102931-17102953 CAGACAGAAGTGGTTACAAACGG - Intronic
1150786925 17:68170525-68170547 CAGGCAGAGGTGGGGCAGATGGG - Intergenic
1151557382 17:74853346-74853368 CAGACAGAGGAGGGGCCCAGAGG + Intronic
1151718822 17:75844538-75844560 CAGCCAGAGGAGGGTCCTGTAGG - Exonic
1155096622 18:22561929-22561951 CAGACAGACCTGGGTTCAGTGGG - Intergenic
1157003958 18:43559731-43559753 CACACAGAAGTGGGGCCACTGGG + Intergenic
1157695892 18:49723284-49723306 TAGGTAAAGGTGGGTCCAATGGG + Intergenic
1157943431 18:51953912-51953934 CAAACAGAGGAGAGTCCAAGTGG - Intergenic
1161685224 19:5699209-5699231 CAGACAGAGGCAGGTTCAGTGGG + Intronic
1162573502 19:11485783-11485805 CAGGCAGAAGTGGGTCCCATAGG + Intronic
1163093964 19:15042100-15042122 CAGTGAGAGGTGAGTCCAGTTGG - Intergenic
1163586553 19:18167485-18167507 TAGTCAGAGGTGTGTGCAATGGG + Intronic
1164519426 19:28967201-28967223 CTGACAGAGGTGGCAGCAATAGG - Intergenic
1166154944 19:40903878-40903900 CACACTGAGGTGGGTCCTAATGG + Intergenic
927927908 2:27026048-27026070 CAGACTGGGGAGGGCCCAATGGG - Intronic
930765599 2:55082190-55082212 CTGACAGAGCTGGATCCAAAGGG + Intronic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
932781404 2:74560829-74560851 CAGAGAGAGGTGGGCACAAGTGG - Intronic
936144673 2:109972515-109972537 GAGACAGAAGTGGGACCAAGGGG + Intergenic
936181358 2:110270478-110270500 GAGACAGAAGTGGGACCAAGGGG + Intergenic
936200014 2:110398954-110398976 GAGACAGAAGTGGGACCAAGGGG - Intergenic
936382094 2:111995323-111995345 CAAACAAAGGTGGCTCCATTGGG - Intronic
937039538 2:118810127-118810149 GAGACAGTGGTGAGTCTAATTGG + Intergenic
947617659 2:231568766-231568788 CAGACAGAGGTGGGACCCTGGGG - Intergenic
947893528 2:233646678-233646700 CAGACTGAGGTGGTTTCAAATGG - Intronic
1170078864 20:12449801-12449823 CAGGCTGAGGTGGGTTCAGTTGG + Intergenic
1172620052 20:36312823-36312845 CAGACAGAGGTGGGTCCGGGAGG + Intronic
1173335167 20:42106772-42106794 CAGACAGAGGTGAGTCCTAGGGG - Exonic
1176190669 20:63808238-63808260 CAGACGGAGGGGGGGCCCATGGG + Intronic
1178712480 21:34930981-34931003 CAGACAGAGCTGGCTAGAATTGG + Intronic
1181850931 22:25749470-25749492 CAGAGAGAGGTGGGTAGAGTGGG + Intronic
1184473281 22:44707673-44707695 CAGACAGAGGTGAGGGCAACTGG - Intronic
1184576089 22:45367466-45367488 CACACAGAGGTAGGTTCCATAGG - Intronic
1184930268 22:47675597-47675619 AAGACAGAGGAGGGCCCCATTGG + Intergenic
1185311792 22:50160172-50160194 CAGAAAGGGGTGGGTCTCATCGG - Intronic
950259400 3:11533099-11533121 CAGACAGTGGAGGGTTCAGTGGG + Intronic
953080056 3:39608517-39608539 CACACAGAAGTGGGGCCACTGGG + Intergenic
955139567 3:56255714-56255736 CAGAAAGAGATGGATCCAAGGGG - Intronic
955940245 3:64140421-64140443 CATAGAGAGCTGGGTCCCATAGG - Intronic
959993506 3:112655033-112655055 GAGACAGAGATTGGTCCAGTTGG - Intergenic
965855481 3:173082636-173082658 CCCCCAGAGGTGGGTCTAATGGG + Intronic
967137340 3:186523575-186523597 CAGACAGAGGTGGGAACAAAGGG - Intergenic
970494090 4:16608444-16608466 CAGACATGGGTGGGTATAATTGG - Intronic
974610119 4:64206104-64206126 CAGATAGAGGTGGCTCTCATTGG + Intergenic
975058492 4:69966633-69966655 CAGACAGATCTGAGTCCAACTGG - Intergenic
981731064 4:147899063-147899085 CACCCTGAGGTGGATCCAATGGG - Intronic
983476024 4:168212769-168212791 CACCTTGAGGTGGGTCCAATGGG - Intergenic
985558325 5:568956-568978 CAGGCAGCGGTGGGTCGACTGGG - Intergenic
985965866 5:3338463-3338485 CAGACAGAGGTGGGAGCACCAGG - Intergenic
986256533 5:6105559-6105581 CAGGCAGAGGTGGGCCCAGCTGG - Intergenic
986605779 5:9521678-9521700 AAGAAAGAGCTGGGACCAATAGG - Intronic
986654689 5:9999597-9999619 CACACAGAAGTGGGACCACTGGG - Intergenic
986897188 5:12384910-12384932 CAGAAAGAAGTGGGTCCTCTTGG + Intergenic
988675421 5:33428221-33428243 CACACAGAAGTGGGACCACTGGG + Intergenic
988832747 5:35003469-35003491 CAGACAGAGGATGGTCAAAGCGG - Intronic
989125090 5:38045373-38045395 CAGATAGAGGTAGATCCAACTGG - Intergenic
996265490 5:121534743-121534765 GAGAAAGGGGTGGGTCAAATAGG + Intergenic
996306476 5:122053475-122053497 CATGCAGAAGTGGGTCCACTGGG + Intronic
1002665954 5:180825230-180825252 CAGACAGAGGTGTTTCCAGCTGG + Intergenic
1003583274 6:7361979-7362001 CAGATACAGGTGGGTCCCTTTGG + Intronic
1005811494 6:29519508-29519530 CTGGCAGAGGTGGGGCCATTTGG + Intergenic
1006575766 6:35044434-35044456 CAGACAGAGCTGGCTCCCACAGG - Intronic
1018298980 6:162379622-162379644 CAGCCAGAGGCGGGTCCATGCGG - Intronic
1018477705 6:164159511-164159533 CAGGCAGAGGTGTGTTCCATGGG - Intergenic
1018683252 6:166282152-166282174 AAGAAAGAGGAGGGTCCAAGGGG + Intergenic
1019321147 7:415870-415892 GACACAGAGGTGGGTCCCACAGG + Intergenic
1023023837 7:36033989-36034011 CAGACAGAGGTAGGGGCAAGGGG + Intergenic
1023075938 7:36482950-36482972 CAGACAGAAGTGGGACCACTGGG + Intergenic
1031916906 7:127571960-127571982 CAGGCAGAGGTGGTGACAATGGG - Intergenic
1034012684 7:147547039-147547061 CAGTAAGAGGTGGGGCCAAAAGG + Intronic
1037014146 8:13881667-13881689 CAGAGAGAGGTGGGGCCTATGGG + Intergenic
1037643076 8:20766080-20766102 CAGACAGATGTCTGTCCAGTTGG - Intergenic
1041034349 8:53773360-53773382 CAGAGAGAGGTTGGTTCAGTAGG - Intronic
1041147134 8:54888920-54888942 CTGACAGAAGTGTGTCCAAAAGG - Intergenic
1041541480 8:58989934-58989956 CAGACACAGGTTGGGTCAATCGG + Intronic
1043499786 8:80841408-80841430 CAGACAGAGGAGGCTGCAAAGGG - Intronic
1044749690 8:95404159-95404181 CAGAGCAAGGTGGGTCCAAAAGG - Intergenic
1045586593 8:103544583-103544605 CAGGCAGAAGTGGGACCACTGGG - Intronic
1046693791 8:117315752-117315774 CAGACAGAGTTGGGACCAGCTGG + Intergenic
1046707896 8:117476684-117476706 CTGACTGTGGTGAGTCCAATGGG - Intergenic
1047356796 8:124129655-124129677 CACACAGAAGTGGGACCACTGGG - Intergenic
1047754068 8:127905163-127905185 CAGACAGAAGCTGGTCCAGTTGG - Intergenic
1049378388 8:142300325-142300347 CAGAGAGAGGTGGTTAGAATGGG + Intronic
1050966608 9:11811703-11811725 CAGGCAGAAGTGGGACCATTAGG + Intergenic
1052594101 9:30536765-30536787 CAGACACAGGTGGGGCAACTGGG - Intergenic
1060389529 9:123267370-123267392 CAGAGAGAGGTGGGGACAGTAGG - Intronic
1062265506 9:135684980-135685002 CAGACACCCGTGGGTCCAAGCGG - Intergenic
1062275339 9:135727746-135727768 CGGACAGAGGTGGGGCCCACAGG + Intronic
1187223845 X:17356440-17356462 CAGACAGAGGTGGGTGCAGAGGG + Intergenic
1188000949 X:24981091-24981113 CTGACAGAGGTGGGTGGGATAGG - Intronic
1193277316 X:79604636-79604658 CAGACAGAAGTGGAACCACTAGG - Intergenic
1194577642 X:95633421-95633443 CACACAGAAGTGTGTGCAATTGG + Intergenic
1196555528 X:117080427-117080449 CAGACTGAGGTGGTCTCAATTGG + Intergenic
1196736204 X:118982973-118982995 CAGAGAGGGGAGGGTCCAGTAGG - Intronic
1201236190 Y:11914318-11914340 CAGGCAGAGGGGCTTCCAATTGG + Intergenic