ID: 923366803

View in Genome Browser
Species Human (GRCh38)
Location 1:233269612-233269634
Sequence ATTTACTTTAACCACATTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923366803_923366804 -3 Left 923366803 1:233269612-233269634 CCATCAATGTGGTTAAAGTAAAT 0: 1
1: 0
2: 0
3: 26
4: 240
Right 923366804 1:233269632-233269654 AATTGAGTTTTCCTGCTTAAAGG 0: 1
1: 0
2: 2
3: 20
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923366803 Original CRISPR ATTTACTTTAACCACATTGA TGG (reversed) Intronic