ID: 923366804

View in Genome Browser
Species Human (GRCh38)
Location 1:233269632-233269654
Sequence AATTGAGTTTTCCTGCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923366802_923366804 -2 Left 923366802 1:233269611-233269633 CCCATCAATGTGGTTAAAGTAAA 0: 1
1: 0
2: 2
3: 25
4: 242
Right 923366804 1:233269632-233269654 AATTGAGTTTTCCTGCTTAAAGG 0: 1
1: 0
2: 2
3: 20
4: 249
923366803_923366804 -3 Left 923366803 1:233269612-233269634 CCATCAATGTGGTTAAAGTAAAT 0: 1
1: 0
2: 0
3: 26
4: 240
Right 923366804 1:233269632-233269654 AATTGAGTTTTCCTGCTTAAAGG 0: 1
1: 0
2: 2
3: 20
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923366804 Original CRISPR AATTGAGTTTTCCTGCTTAA AGG Intronic