ID: 923367084

View in Genome Browser
Species Human (GRCh38)
Location 1:233273342-233273364
Sequence TGGCCACAGCTCAAAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923367081_923367084 -8 Left 923367081 1:233273327-233273349 CCATGGAAGGAGCAGTGGCCACA 0: 1
1: 0
2: 3
3: 44
4: 279
Right 923367084 1:233273342-233273364 TGGCCACAGCTCAAAGTGGGAGG 0: 1
1: 0
2: 1
3: 10
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923367084 Original CRISPR TGGCCACAGCTCAAAGTGGG AGG Intronic
900155839 1:1202966-1202988 TGGGCCCAGCTCACAGTAGGTGG - Intergenic
900333762 1:2150504-2150526 TGGTCACAGCTGCAGGTGGGAGG - Intronic
900380101 1:2379642-2379664 TGGCCACGGCTGACAGTGGGTGG + Intronic
901633004 1:10656955-10656977 TGGCCAAAAGTCAAAGTAGGGGG + Intronic
903182709 1:21613140-21613162 TGGGCACAGCTCACTGAGGGTGG - Intronic
903284792 1:22269871-22269893 GGGCCTCTGCTCCAAGTGGGCGG + Intergenic
904999216 1:34655175-34655197 GGGCCCAAGCTCAAGGTGGGAGG + Intergenic
907237065 1:53059713-53059735 AGCCCTCAGCTCAAAGTAGGAGG + Intergenic
907443827 1:54494907-54494929 GGGCCAGAGCTGAAGGTGGGGGG + Intergenic
910467789 1:87518627-87518649 GGGCAAGAGCTCAAAGTAGGGGG - Intergenic
915143020 1:153778539-153778561 TGGCCACATCTCCAGGTTGGTGG + Exonic
917510180 1:175663200-175663222 GGGCCAGAGCTCAGGGTGGGTGG - Intronic
917585864 1:176425903-176425925 TGGACACAGCTCCCAGTGGGAGG - Intergenic
919223453 1:194661914-194661936 TGCCCACAGGAGAAAGTGGGAGG + Intergenic
919935823 1:202250042-202250064 TGGCTACAGCATAGAGTGGGAGG - Intronic
922564742 1:226594334-226594356 TGGACTCAGTTCAGAGTGGGAGG + Intronic
923040820 1:230318749-230318771 TGGCCCCAGCTCACAGTATGGGG - Intergenic
923273696 1:232379190-232379212 TGGCCACTGCATAAAGAGGGAGG - Intergenic
923367084 1:233273342-233273364 TGGCCACAGCTCAAAGTGGGAGG + Intronic
924216183 1:241824720-241824742 GAGCCACAGCTCAAAGATGGAGG + Intergenic
1063614664 10:7591391-7591413 TGGCTACAGCTCAACGTGTCAGG - Intronic
1065474015 10:26114230-26114252 TGACCAGATCTCAAAGTAGGTGG - Intronic
1065566829 10:27019937-27019959 TGGACACAGCTCAAAGCCTGAGG + Intronic
1067778186 10:49177888-49177910 TGGCCTGAGCTCAAGGTGTGTGG - Intronic
1070307921 10:75250905-75250927 TGGCCACTGCCCAAAGGCGGTGG - Intergenic
1070437711 10:76410133-76410155 TGGCCAGAGATCATTGTGGGAGG + Intronic
1072894458 10:99354686-99354708 GGGCTAGAGCTCAAAGTTGGGGG + Intronic
1073104963 10:101027270-101027292 TGGCCAGAGCTCAGTGAGGGAGG - Intronic
1073115339 10:101088599-101088621 TGGCCACAGCTGAACGTGTTGGG - Intergenic
1073195583 10:101688157-101688179 TGTCCACAGCACAAAATTGGAGG - Intronic
1075471840 10:122696905-122696927 TGCCCACATCTAAAAGTTGGAGG - Intergenic
1078191137 11:9092902-9092924 TAGCCACAGCCCAAAGAGGCAGG - Intronic
1079116999 11:17646257-17646279 TGGCCACAGCTCTTGGTGGAGGG + Intronic
1083201172 11:61121911-61121933 TGGCCACAGCCCACAGTGGGTGG + Intronic
1083409847 11:62484606-62484628 TGGCCAGAGCTCCATGAGGGAGG + Intronic
1083638137 11:64131246-64131268 TGGCCATAGCTCAGAGTGACGGG + Intronic
1084537123 11:69763854-69763876 AGGCCTCTGCTCACAGTGGGAGG - Intergenic
1085940334 11:81199978-81200000 TGCAAACAGCTGAAAGTGGGTGG + Intergenic
1088729826 11:112670976-112670998 TGGACAGAGCTCCCAGTGGGAGG + Intergenic
1089035538 11:115386272-115386294 TGACCACAACCCTAAGTGGGAGG + Intronic
1089623098 11:119733975-119733997 TGAACCCAGATCAAAGTGGGAGG + Intergenic
1093768402 12:22991807-22991829 CTGCCAGAGCTCAAAGTGGAGGG + Intergenic
1094374151 12:29772621-29772643 AGGCTTCAGCTCAAAGTAGGAGG + Intronic
1095685042 12:45023972-45023994 TGGCCATAGTACAAAGTAGGAGG - Intronic
1096595585 12:52692976-52692998 TGACCACAGTGCAAGGTGGGTGG - Intronic
1097309224 12:58100346-58100368 TGGCCACATCTTAATGTGGTAGG + Intergenic
1100088424 12:90939167-90939189 TGCCCACAACTCAAACTGTGGGG - Intronic
1102185564 12:110945589-110945611 CTGACACAGCTCAATGTGGGTGG + Intergenic
1102915393 12:116748648-116748670 TGGTCACAGCTGACATTGGGTGG - Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1103844477 12:123891930-123891952 TTGCCACAACTCAATGTTGGGGG - Intronic
1104811508 12:131622636-131622658 AGGCCACAGCCCAGAGAGGGAGG - Intergenic
1105858993 13:24393193-24393215 CAGCCACAGCTTAAAGCGGGCGG - Intergenic
1106554556 13:30798533-30798555 CGCCCAAAGCCCAAAGTGGGTGG + Intergenic
1106842075 13:33694485-33694507 TGCCAACAGCTGCAAGTGGGTGG + Intergenic
1107297486 13:38926160-38926182 TGGGAACAGCTCAAAGGCGGGGG - Intergenic
1110544015 13:76736604-76736626 TGCCCAAAGCACAAAGTGGAAGG - Intergenic
1113098806 13:106695213-106695235 AGCTCACAGCTCAGAGTGGGAGG - Intergenic
1113759341 13:112836851-112836873 CAGCCACAGGTCAGAGTGGGAGG - Intronic
1113945756 13:114043221-114043243 TGGCCACAGGACATGGTGGGAGG + Intronic
1120411842 14:84167463-84167485 TGGGCAGAGCTCTAAGTGGGTGG - Intergenic
1121912245 14:97802166-97802188 TGGACAGAGCTCAGAGTGTGTGG + Intergenic
1125768530 15:42150462-42150484 TGGCCCCAGCGCAGAGTTGGAGG - Exonic
1125886112 15:43230833-43230855 TGGCCAGAGGTCAGAATGGGAGG - Intergenic
1126782993 15:52154406-52154428 GGGCCACAGCTCTAAGAGGAGGG + Intronic
1127504997 15:59589752-59589774 TGGCCACAGCTCGGGGTAGGAGG + Intergenic
1127717658 15:61665342-61665364 TGGCCACAGTGCCAAGTGGATGG + Intergenic
1128983940 15:72205917-72205939 TGGCCACTGCTCAGGGTTGGAGG - Intronic
1130225808 15:82057662-82057684 TGGCCACAGCTGAAAGGAGCTGG - Intergenic
1132554109 16:565130-565152 TGGCCACACCACCAAGTGTGAGG + Exonic
1134484223 16:14644476-14644498 TGCCCACAGTTCAAGGTGGTGGG - Exonic
1135185683 16:20313884-20313906 TGGCCACACCTCAAAGATGGTGG + Intronic
1137530390 16:49275608-49275630 AGGCCACACTCCAAAGTGGGAGG + Intergenic
1138189255 16:55000726-55000748 TGGCAACAGTTCCAAGAGGGTGG + Intergenic
1138423250 16:56913425-56913447 TGTCCACAGCTCTGAGTGTGTGG + Exonic
1138474916 16:57264974-57264996 GGGGCTCAGCCCAAAGTGGGAGG + Intronic
1139517413 16:67459954-67459976 TGGCCACAGCACAGTGTGAGAGG + Intronic
1139590492 16:67930375-67930397 AGGCCAAAGCTCAGGGTGGGAGG - Intronic
1140605030 16:76526152-76526174 TGGCCTCTGCTCAAATTAGGAGG - Intronic
1140605041 16:76526224-76526246 AGGCCATGGCTCAAAGTGGTGGG + Intronic
1141849501 16:86635653-86635675 GGGCCTTAGCTCATAGTGGGGGG - Intergenic
1144372399 17:14604448-14604470 TCGGGACAACTCAAAGTGGGAGG - Intergenic
1144397032 17:14854425-14854447 TGGCCACAGCTCAGAAGTGGAGG - Intergenic
1144962271 17:19051594-19051616 TGCCCCCAGCTCCCAGTGGGAGG + Intergenic
1144972890 17:19122926-19122948 TGCCCCCAGCTCCCAGTGGGAGG - Intergenic
1146137721 17:30337809-30337831 TGGTCACAGCTCAAAGGCTGTGG - Intergenic
1146503602 17:33385364-33385386 TGGCCACAGCTTAAATGGTGGGG - Intronic
1146752046 17:35390343-35390365 GGGACAGAGCTCCAAGTGGGAGG - Intergenic
1152378133 17:79929096-79929118 TGGCCCCAGCTCCCAGTGGAGGG - Intergenic
1152424262 17:80210449-80210471 TGGTCACAGCTCATTGTGGAGGG + Exonic
1153456082 18:5283399-5283421 TTGCCAGAGTTTAAAGTGGGAGG - Intergenic
1154026709 18:10714626-10714648 TGGCGACAGCTGGAAGAGGGTGG + Intronic
1155227501 18:23741832-23741854 TGGCCAGATCACTAAGTGGGTGG - Intronic
1157175391 18:45447087-45447109 TGGCCATAGCTCCTGGTGGGAGG + Intronic
1158376340 18:56873580-56873602 TGGCCACTGCTTGAAGCGGGAGG - Intronic
1159519197 18:69496172-69496194 CGGTGACATCTCAAAGTGGGGGG - Intronic
1159671093 18:71221857-71221879 TGGCAACAGCTCAAGGTGAATGG + Intergenic
1160768156 19:817843-817865 CGCCCACAGGTTAAAGTGGGTGG - Intronic
1161234451 19:3190921-3190943 TGTCCCCAGCTGAACGTGGGTGG + Intronic
1161590356 19:5126662-5126684 CGGCCCCAGCTCATAGTGAGGGG + Intronic
1164754103 19:30677454-30677476 TGGCCACAGCCCCAGGTGGATGG - Intronic
1166529793 19:43535333-43535355 TGGCCACCGCTCCAAGCTGGCGG + Exonic
1167357374 19:49012179-49012201 TGGGCCCAGCTGAAACTGGGCGG + Intronic
925350562 2:3198246-3198268 TGGCCACCTCTGAAATTGGGAGG - Intronic
925481595 2:4281109-4281131 TTGCCACAGCCCACAGTGTGTGG + Intergenic
926080114 2:9978280-9978302 TGGACACAGCTGAGAGTGTGAGG + Intronic
926416743 2:12656921-12656943 TGGACTCAGCTCAGAGTAGGAGG - Intergenic
930545548 2:52762413-52762435 TGGCCCCAGCTACAAGTGGAGGG + Intergenic
931749916 2:65321245-65321267 TGGCCCCAGCTGACACTGGGAGG + Intronic
932331514 2:70900738-70900760 TGGCCACAGCCCAACGGAGGTGG + Exonic
933106314 2:78330385-78330407 TGACCACCCATCAAAGTGGGTGG - Intergenic
934639838 2:96021299-96021321 TGGCCACAGCCAAAGGTGGAGGG - Intergenic
934793805 2:97084081-97084103 TGGCCACAGCCAAAGGTGGAGGG + Intronic
935200148 2:100849363-100849385 TGGCAGCAGGTCACAGTGGGAGG + Intronic
935537015 2:104307051-104307073 TGGCCTCAAATCAAAGTGGGTGG + Intergenic
935594507 2:104868505-104868527 TGACCACAGCTGGAAGTTGGAGG - Intergenic
940582516 2:155600393-155600415 TGGGCCCAGCGCAAAGTGGTGGG - Intergenic
940825393 2:158406376-158406398 AGGCCACAGGTCCTAGTGGGGGG + Intronic
943755347 2:191551306-191551328 TGGCAACAGCTCAGAGTTTGAGG + Intergenic
945025082 2:205612866-205612888 TGCTCACAGCTCACAGTGAGGGG - Intronic
946190261 2:218004051-218004073 AGGCCAGAGCTCAAAGAGGAAGG - Intergenic
946242383 2:218364604-218364626 TGGCAACAGCCAAAATTGGGGGG - Intronic
946583941 2:221162242-221162264 TGGCAACAACTTAATGTGGGGGG - Intergenic
948301432 2:236909975-236909997 TGACCACAGCCCATAGTGGAAGG + Intergenic
948754342 2:240150413-240150435 AGGCCACAGGTCCCAGTGGGTGG + Intergenic
1169362420 20:4962304-4962326 TGGAGACAGCTCAGAGAGGGAGG + Intronic
1175267984 20:57714114-57714136 TGGCCACAGCTGAGGGTGGCTGG + Intergenic
1181162628 22:20967163-20967185 TGGCCACAGCTTGAGCTGGGAGG + Intronic
1181533515 22:23530386-23530408 TGGGCCCTGCTCACAGTGGGAGG + Intergenic
1182135771 22:27901638-27901660 TTGCCAGAGGTCAAGGTGGGAGG + Intronic
1182877130 22:33701857-33701879 TGGTGACAGCTCAAAAGGGGAGG + Intronic
1183863318 22:40684817-40684839 AGTCAACAGCTCACAGTGGGTGG + Intergenic
1184389041 22:44192546-44192568 TGGCCACACCCCCCAGTGGGTGG - Intronic
1185165314 22:49258305-49258327 CGGCCACAGCCCCCAGTGGGAGG + Intergenic
1185276710 22:49953077-49953099 AGGCCACAGCGCCCAGTGGGAGG + Intergenic
1185359471 22:50396947-50396969 GGGCCACATTTGAAAGTGGGAGG - Intronic
950155891 3:10721335-10721357 GGGCCTTAGCTCAAAGTGTGGGG + Intergenic
956010753 3:64829099-64829121 TGGCCAAAGCTCAGTGTGAGAGG - Intergenic
956660308 3:71590934-71590956 AGGCCTCAGCTAAAAGTGGCAGG + Intergenic
960864687 3:122187238-122187260 TAGCCACTGCTCTAATTGGGAGG + Intronic
961468089 3:127093506-127093528 TGGGCAGAGCGCCAAGTGGGTGG + Intergenic
961506028 3:127371072-127371094 TGGCCACACGTGGAAGTGGGAGG - Intergenic
963753502 3:149208239-149208261 TGGTCACTGTTCAAACTGGGTGG + Intronic
963806398 3:149727270-149727292 GGGGCACAGAGCAAAGTGGGTGG + Intronic
964128765 3:153264530-153264552 TGGAGACAGCTTCAAGTGGGTGG + Intergenic
965521327 3:169670234-169670256 TGTCCACAGCTGAAAGGGGAAGG - Intergenic
967738130 3:192975477-192975499 TGTCCAACGCTGAAAGTGGGAGG - Intergenic
969624908 4:8297503-8297525 ATGCCACAGATCAAAGTGAGGGG + Intronic
969846490 4:9924025-9924047 TGCCCACAGGTCACAGGGGGTGG + Intronic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
977238305 4:94535544-94535566 TGGCTACAGGTGAAAGTGGGAGG - Intronic
978285512 4:107073179-107073201 TGGCCGCCGCTCAGAGTGCGGGG - Intronic
979375198 4:119938306-119938328 TGTCCACAGGGCAAAGTGAGGGG + Intergenic
980032446 4:127846008-127846030 AGGCACCAGCTCCAAGTGGGTGG - Intergenic
980303086 4:131019334-131019356 AGACCACAGCTGAAAGTGAGAGG - Intergenic
982951710 4:161705488-161705510 TGGCCTCAGTTCAAATTGGAAGG + Intronic
984823440 4:183904669-183904691 TGGCCACAGGTTATAGAGGGCGG + Intronic
985123561 4:186668115-186668137 TAGGCACTGCACAAAGTGGGTGG + Intronic
985624423 5:977589-977611 TGGGCACAGCTCTCAGCGGGAGG + Intergenic
986473348 5:8097627-8097649 TGGCCTCAGATGAAAGTAGGTGG + Intergenic
988211851 5:28214279-28214301 TGGCCACCGCTGGAAGTGTGTGG - Intergenic
988998864 5:36740749-36740771 TGCCCTCAGCTCAAACGGGGTGG + Intergenic
989796874 5:45484991-45485013 TGGCCACAGCTCAAAAGGCCAGG - Intronic
998158261 5:139798218-139798240 TTGCCACAGCTCAATGGAGGGGG + Intronic
999566922 5:152874108-152874130 GGGCCAGAGAACAAAGTGGGGGG + Intergenic
999859819 5:155633461-155633483 TGCCCACTCCACAAAGTGGGAGG - Intergenic
1000772130 5:165367971-165367993 TGTCCACTGCTCAGAGTGTGGGG - Intergenic
1001297865 5:170511416-170511438 AGGCCACAGCTCAAAGGGATGGG - Intronic
1001756358 5:174173378-174173400 TGGCCCCAGAGCACAGTGGGAGG - Intronic
1001934808 5:175696393-175696415 TGGCCCCACGGCAAAGTGGGGGG - Intergenic
1003264047 6:4550440-4550462 TGGACACAGCCCCAGGTGGGTGG - Intergenic
1003569255 6:7245735-7245757 TGGCAACAGCACACAGTGAGGGG - Intronic
1004067501 6:12262953-12262975 AGGGCACAATTCAAAGTGGGTGG + Intergenic
1004580288 6:16944382-16944404 TGGCCACAGCTGAATGAGAGAGG - Intergenic
1005620313 6:27614111-27614133 TGGGCACAGCTCCTAGTGGGTGG + Intergenic
1006642309 6:35495799-35495821 TGGACACAGCTCAGAGGGGCTGG - Intronic
1009770862 6:68141415-68141437 TGTCCAGTGCTGAAAGTGGGAGG + Intergenic
1012554314 6:100492963-100492985 TGGCTATAGCTAAAACTGGGAGG + Intergenic
1017064715 6:150518391-150518413 TGGCCACACCTCAGGATGGGGGG - Intergenic
1018647754 6:165963806-165963828 TGGCCACAGCTCAGAGGAGGAGG - Intronic
1019361357 7:605808-605830 TGTTAACATCTCAAAGTGGGTGG - Intronic
1019571713 7:1715911-1715933 AGGCCAGAGTTCAAAGTCGGGGG - Intronic
1020419855 7:7990099-7990121 TGGACTCATCTCAAAGTAGGAGG - Intronic
1024302641 7:47899494-47899516 TGGCTCCAGCCCAAAGTAGGGGG - Intronic
1024440227 7:49408210-49408232 TGGGCACAGATAAAAGTGGCTGG + Intergenic
1027521557 7:79215651-79215673 AGGGGACAACTCAAAGTGGGAGG - Intronic
1029547194 7:101216743-101216765 TGGCCACAGCTGAAACCGAGGGG - Exonic
1030089935 7:105849566-105849588 TGGCTACACCTCCAAGAGGGTGG - Intronic
1033007434 7:137582039-137582061 CAGCCACAACTCAAAGTGGAGGG + Intronic
1034975194 7:155444839-155444861 TGGCCACAGTTCAGAGTGTGTGG + Intergenic
1036719333 8:11158412-11158434 TGGCTACAGCTGAAAGTGCTAGG + Intronic
1037833734 8:22204174-22204196 AGGCCAGAGCGCAAAGAGGGAGG + Intronic
1040077149 8:43247419-43247441 GGGCCTCAGCTCCAGGTGGGAGG + Intergenic
1042992587 8:74657163-74657185 TAGCCACAGCTGGAAGTGGTGGG + Intronic
1043769883 8:84184660-84184682 TGGGCGCAGCTCACCGTGGGAGG - Intronic
1045745272 8:105411377-105411399 TGGCCCCAGCCCAAAGTGAGTGG - Intronic
1047037568 8:120956153-120956175 TGGCCAGAGCTCACAGTGACAGG + Intergenic
1047881889 8:129203510-129203532 TGATTACAGCTCAATGTGGGTGG + Intergenic
1049543719 8:143220016-143220038 TGGCCAGAGCTCATGGTGGAGGG - Intergenic
1049657293 8:143804518-143804540 TGCCCACAGCTGAAGCTGGGTGG + Intronic
1050058193 9:1677760-1677782 TGGTCAAAGCTGAAAGTGGATGG - Intergenic
1053176507 9:35929232-35929254 TTCCCTCTGCTCAAAGTGGGAGG - Intergenic
1053610482 9:39708470-39708492 TGTACACAGCTGAAAGTGCGCGG + Intergenic
1054087770 9:60762686-60762708 TGTACACAGCTGAAAGTGCGTGG - Intergenic
1054243041 9:62633925-62633947 TGTACACAGCTGAAAGTGCGCGG - Intergenic
1054557165 9:66668443-66668465 TGTACACAGCTGAAAGTGCGCGG - Intergenic
1058134092 9:101288065-101288087 TGGACCCTGCTCCAAGTGGGTGG - Intronic
1060527436 9:124328455-124328477 TGGGCACAGCACACAGGGGGTGG - Intronic
1061246961 9:129405457-129405479 TGGGCCCTGCTCACAGTGGGAGG - Intergenic
1061505149 9:131027544-131027566 TGGCCACATCTCATGGTGGCTGG - Intronic
1187399937 X:18950672-18950694 TGGCCACACCTCAATTTTGGAGG - Intronic
1195148708 X:102043911-102043933 TGGACACAGCTCCCACTGGGAGG + Intergenic
1197402250 X:126006316-126006338 TGGACAGAGCTCCCAGTGGGAGG + Intergenic