ID: 923368808

View in Genome Browser
Species Human (GRCh38)
Location 1:233289766-233289788
Sequence GCTAGGACTGACTAGAACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923368806_923368808 6 Left 923368806 1:233289737-233289759 CCTTTCTTTTGAGGAAACTGGAT 0: 1
1: 0
2: 0
3: 19
4: 250
Right 923368808 1:233289766-233289788 GCTAGGACTGACTAGAACAGAGG 0: 1
1: 0
2: 0
3: 12
4: 88
923368803_923368808 22 Left 923368803 1:233289721-233289743 CCATTAACAGAGAAAGCCTTTCT 0: 1
1: 0
2: 1
3: 30
4: 283
Right 923368808 1:233289766-233289788 GCTAGGACTGACTAGAACAGAGG 0: 1
1: 0
2: 0
3: 12
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923368808 Original CRISPR GCTAGGACTGACTAGAACAG AGG Intronic
904411712 1:30328786-30328808 GCCAGGACTGACAAGGTCAGAGG + Intergenic
905241093 1:36582098-36582120 GCTAGCACTGACTTGAAGAGGGG - Intergenic
906452154 1:45959743-45959765 ACTAGAACACACTAGAACAGAGG - Intronic
916490629 1:165299321-165299343 GCTAGGACTGGCTACAAGAATGG - Intronic
917708261 1:177656993-177657015 TCTGTGACTAACTAGAACAGAGG - Intergenic
918269949 1:182888704-182888726 ACTAAGACTGAATAGAACAGAGG - Intergenic
923368808 1:233289766-233289788 GCTAGGACTGACTAGAACAGAGG + Intronic
1063491072 10:6464260-6464282 GCAAGAACTGACAAGAACAGTGG + Intronic
1065412870 10:25449560-25449582 CCTAGGAGAGAGTAGAACAGTGG + Intronic
1067901636 10:50247742-50247764 CCTAACACTGACTGGAACAGAGG + Intronic
1068088421 10:52403271-52403293 GCTATGACTGACTAAAGCAATGG - Intergenic
1071930427 10:90463442-90463464 GCTTGAACAGACTAAAACAGTGG + Intergenic
1077262812 11:1632069-1632091 GCTAGAAGAGACCAGAACAGAGG + Intergenic
1080451038 11:32379236-32379258 GCAAGAACTGACTACAGCAGTGG + Intergenic
1081380762 11:42411850-42411872 GCTATCACTGACTAGAAAATAGG + Intergenic
1084782129 11:71417120-71417142 GCGAGAACAGACTAGTACAGTGG - Intergenic
1093410078 12:18854475-18854497 GCTAGTCTTGACCAGAACAGTGG + Intergenic
1099005869 12:77234026-77234048 GATAGGAGTGTCTAGAACTGGGG + Intergenic
1102509027 12:113401976-113401998 GCTAGGAGTGCCCAGGACAGGGG - Intronic
1102627024 12:114243379-114243401 GCTAGCAGTGACTTGAACAGTGG + Intergenic
1106762930 13:32884835-32884857 GCTAGGACTGACAAGTAGAATGG + Intergenic
1110584063 13:77167368-77167390 GCTAGGAATGACTGCAAGAGGGG + Intronic
1113701284 13:112390484-112390506 GCAAGAACTGACTAATACAGAGG - Intronic
1114567654 14:23644444-23644466 GCTGGGTCTCACTAGAACACTGG + Exonic
1114867846 14:26619746-26619768 GTCAGGCCTGACTAAAACAGGGG + Intergenic
1118863995 14:69688339-69688361 TCTATAACTGCCTAGAACAGAGG - Intronic
1128210725 15:65899756-65899778 GTTAGCATTGACAAGAACAGGGG - Intronic
1131286057 15:91058664-91058686 GCTAGTCCTGCCTAGAACTGGGG + Intergenic
1133657143 16:7876643-7876665 GAGAGGACTGACTACAAAAGGGG - Intergenic
1133737998 16:8630240-8630262 TCTGGGACAGTCTAGAACAGAGG - Intronic
1133955925 16:10443854-10443876 GCTAGGACTGACAATTAGAGGGG + Intronic
1135835018 16:25817318-25817340 TCTTGGACAGACTAGTACAGAGG + Intronic
1140251890 16:73301597-73301619 TCTAGGACTGTCTAGGCCAGTGG - Intergenic
1147410055 17:40244188-40244210 TCTAGGACAGACTATAACAGAGG - Intronic
1149373564 17:56021025-56021047 GAAAGAACTGTCTAGAACAGGGG + Intergenic
1149534031 17:57418223-57418245 ACTAGGACTGTCTATAACAGGGG - Intronic
1153574545 18:6507501-6507523 GCTAAGACTGACTGGAAAACAGG - Intergenic
1156228593 18:35132640-35132662 GCCAGGACAGACTAGAGCTGTGG + Intronic
1158991503 18:62873354-62873376 GCAAGTACTTACTAGAACACAGG - Intronic
1161581889 19:5085703-5085725 GCCAGGCCTGACTACACCAGGGG - Intronic
1163682020 19:18688221-18688243 GCTAGGAGTGGCTGGGACAGGGG + Intronic
1165242419 19:34479491-34479513 CCTAGGACAGAATAGATCAGGGG + Intergenic
1166665434 19:44677100-44677122 GCTAGGAATGGCTAAACCAGTGG - Intronic
926328849 2:11808383-11808405 GATGGGAGTCACTAGAACAGTGG - Intronic
926522143 2:13928613-13928635 ACTGGGACTCAGTAGAACAGTGG - Intergenic
930738546 2:54804716-54804738 GATAGGAAAGACTAGAGCAGGGG - Intronic
933729274 2:85445034-85445056 GTTAGGACTGACCAGGACAAGGG + Intergenic
934477225 2:94601814-94601836 GCCAGGACTGAAGGGAACAGTGG + Intronic
934871382 2:97869518-97869540 GCTTGGAGTAACAAGAACAGAGG + Intronic
935849790 2:107206078-107206100 CCTATGACTGACTAACACAGAGG - Intergenic
939322120 2:140637655-140637677 TCTAGGATGGACTACAACAGTGG - Intronic
941810250 2:169748477-169748499 GCTAGGAGTGACGATAAAAGCGG + Intronic
941825592 2:169892062-169892084 TCTAGGACTGCCTAGAAAGGTGG + Intronic
942419728 2:175795566-175795588 ACTAGTACTGACTAGTACAGGGG + Intergenic
944352720 2:198747843-198747865 GCTTTGAATGTCTAGAACAGAGG - Intergenic
945044319 2:205768484-205768506 GCCATGACTGACAAGTACAGTGG + Intronic
945295073 2:208162455-208162477 TCTAGGACTTACTAGAACCTAGG - Intronic
1173794029 20:45846326-45846348 GCTAGTACTAACTAGCACAATGG - Intronic
1174064240 20:47853071-47853093 GATGGGACTGTCTAGAGCAGCGG + Intergenic
1176212674 20:63932690-63932712 GGAAGGACTGACTGGACCAGAGG + Exonic
952884638 3:38004849-38004871 GCTAGAACTGGCCAGACCAGTGG + Intronic
953895784 3:46799162-46799184 GGTAGGACTGAGAAGACCAGAGG + Intronic
956582755 3:70832737-70832759 GCTTGGAGTGACTCGATCAGGGG - Intergenic
962724279 3:138207051-138207073 GCTGGCACTGAAAAGAACAGAGG - Intronic
963492708 3:146021205-146021227 GCTAGGACTAAATAGCACATTGG - Intergenic
965232989 3:166077183-166077205 GCCAGGAGTGACTAGGAAAGAGG - Intergenic
969001120 4:3983130-3983152 GCCAAGACTTATTAGAACAGTGG - Intergenic
969812799 4:9661739-9661761 GCCAAGACTTATTAGAACAGTGG + Intergenic
970468189 4:16348966-16348988 GCCAAGACTGACTTGAAAAGAGG - Intergenic
973648881 4:52977558-52977580 GCAAGGAATGACTAAAAAAGAGG + Intronic
975798804 4:78036728-78036750 GCTTGGATTCTCTAGAACAGGGG - Intergenic
976603478 4:86960793-86960815 GCTTGGACTGACTGCAACAGAGG - Intronic
977357193 4:95961921-95961943 GCTGGGACTGGCCATAACAGGGG - Intergenic
979528630 4:121744125-121744147 GTTAGCACAGACTAGAACAGAGG - Intergenic
979731657 4:124030244-124030266 GCTAAGACTGAATAGAACATAGG - Intergenic
983593439 4:169440654-169440676 GCTAGGACTGGCTAGAAGCCAGG + Intronic
988466997 5:31500686-31500708 GCCAGGGCTGACTACAAAAGTGG + Intronic
989304822 5:39941636-39941658 GCCTGGACTGACTAACACAGAGG - Intergenic
990486254 5:56261730-56261752 TCTAGCACTGACTAGAACACAGG - Intergenic
993439041 5:87932559-87932581 TCAAGGACTAACTAGAATAGAGG - Intergenic
993696843 5:91071420-91071442 GCTGGGCATGACTAGATCAGTGG + Intronic
995256963 5:110057969-110057991 GCTAAGATTGACTGGACCAGAGG + Intergenic
997289340 5:132715039-132715061 GAGAAGACTGACTAGATCAGAGG - Intronic
1003567377 6:7231995-7232017 GCTAGGAATAACTGGAACTGTGG - Intronic
1010072239 6:71757049-71757071 GATATGACTGACTAGAACTCAGG - Intergenic
1015950582 6:138548635-138548657 GTGAGGACTGAATAGAACAAGGG + Intronic
1019469650 7:1211893-1211915 GCCAGGACTGTCCAGACCAGGGG + Intergenic
1020987657 7:15156406-15156428 GCTGGAACTGGATAGAACAGGGG - Intergenic
1021301096 7:18974068-18974090 GCTGGGAATGACTAGAACATAGG - Intronic
1022261212 7:28706795-28706817 GCTACCACTGGCTTGAACAGGGG - Intronic
1028679336 7:93507425-93507447 GCCAGGACAGAAAAGAACAGTGG + Intronic
1028991313 7:97051512-97051534 GCTAGCACTGAAGAGAGCAGTGG + Intergenic
1030625893 7:111845950-111845972 TCTGGAACTGAATAGAACAGTGG - Intronic
1033258436 7:139821698-139821720 GTTTGGACTGGCTAGAAGAGTGG - Intronic
1034448264 7:151124355-151124377 CCCAGGACTGACTAGAAAGGAGG - Intronic
1047055734 8:121163039-121163061 TCAAGCACTGACTAGAACACTGG - Intergenic
1048504606 8:135009527-135009549 GCCTGGAATGACTAGGACAGTGG - Intergenic
1060953043 9:127616961-127616983 GCTAGGACACAGTAGAAAAGCGG + Intronic
1186159165 X:6758624-6758646 GCTAGGATTGACTAGAAAGATGG - Intergenic
1187325796 X:18286621-18286643 GGGATGTCTGACTAGAACAGAGG - Intronic
1199877957 X:151949865-151949887 CCCAGGACTGAATATAACAGGGG - Intergenic