ID: 923369334

View in Genome Browser
Species Human (GRCh38)
Location 1:233295238-233295260
Sequence AGACGTGCCATCAGCCTCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923369334_923369342 22 Left 923369334 1:233295238-233295260 CCCGTGAGGCTGATGGCACGTCT 0: 1
1: 0
2: 0
3: 4
4: 87
Right 923369342 1:233295283-233295305 CTCCATACCCACAGCTCCCCGGG 0: 1
1: 0
2: 2
3: 33
4: 293
923369334_923369341 21 Left 923369334 1:233295238-233295260 CCCGTGAGGCTGATGGCACGTCT 0: 1
1: 0
2: 0
3: 4
4: 87
Right 923369341 1:233295282-233295304 CCTCCATACCCACAGCTCCCCGG 0: 1
1: 0
2: 2
3: 34
4: 337
923369334_923369344 27 Left 923369334 1:233295238-233295260 CCCGTGAGGCTGATGGCACGTCT 0: 1
1: 0
2: 0
3: 4
4: 87
Right 923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG 0: 1
1: 0
2: 0
3: 9
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923369334 Original CRISPR AGACGTGCCATCAGCCTCAC GGG (reversed) Intronic
900754920 1:4426737-4426759 AGCGATGACATCAGCCTCACAGG - Intergenic
900835949 1:5004122-5004144 AGAAGTGCCAGCAGCCTCTGAGG - Intergenic
902650535 1:17834431-17834453 AGACGTGCCATGAGGCTCTCAGG - Intergenic
904813096 1:33176554-33176576 AGACGTGGCATCCGGCTCTCTGG - Intronic
905016382 1:34781567-34781589 AGACGGGCCACCAGCCCCTCCGG + Exonic
916404638 1:164485905-164485927 ACAAATGGCATCAGCCTCACTGG + Intergenic
923369334 1:233295238-233295260 AGACGTGCCATCAGCCTCACGGG - Intronic
1066508367 10:36067653-36067675 AGAGGTGCCACCAGCCACAGAGG + Intergenic
1068474576 10:57508129-57508151 AGAGGTGCCACCAGCCACACAGG + Intergenic
1071562129 10:86652783-86652805 AGAAGTGGGAGCAGCCTCACTGG - Intergenic
1071819204 10:89263672-89263694 AAAGGTGCCAACAGCCACACAGG - Intronic
1073937589 10:108652282-108652304 AGATGTGCCACCTGCCTCTCTGG - Intergenic
1074715167 10:116211462-116211484 TAAAGTGCCATCAGCCTCCCTGG - Intronic
1074979428 10:118607997-118608019 AGAGGTGCCACCAGCCACAGAGG - Intergenic
1075914739 10:126157629-126157651 AGACGGGCCCTCACACTCACTGG + Intronic
1078427806 11:11265726-11265748 AGGAGTGCCAGCAGGCTCACTGG - Intergenic
1080761524 11:35254628-35254650 AGCCTTGTCATCATCCTCACTGG - Exonic
1089403144 11:118176385-118176407 CGCCCTGCCTTCAGCCTCACGGG - Exonic
1090430708 11:126644065-126644087 GGAAGTGGCATCAGCCTCATAGG + Intronic
1095961780 12:47839456-47839478 AGACTCCCCATCAGCCTCACGGG + Intergenic
1101416771 12:104515307-104515329 ATAAGTGCCTTCAGCTTCACAGG - Intronic
1101491242 12:105211726-105211748 AGGCGTGGCTTCAGCCTCCCTGG - Intronic
1102781482 12:115569837-115569859 AGACTTGACATCAGCCACAGAGG - Intergenic
1104294068 12:127495847-127495869 AGAGGTGCCCAGAGCCTCACAGG + Intergenic
1104833351 12:131770307-131770329 CGACGTGCCCTCAGCCACGCAGG - Intronic
1104959553 12:132482008-132482030 AGTCGCGCCATCAGCTTCCCGGG - Intergenic
1113856410 13:113448748-113448770 AGATGTGCCTTCGGCCACACGGG + Intronic
1113863022 13:113502604-113502626 AGAAGTGCCATCAGTGTGACGGG - Intronic
1114459178 14:22876033-22876055 AGAGGTGCCAGCAGCCCCACAGG - Exonic
1114673327 14:24425452-24425474 AGACATTACATCAGCCTAACAGG - Intergenic
1116246563 14:42421619-42421641 AGCCATGCTATCAGCCTCTCTGG + Intergenic
1122248816 14:100424008-100424030 ACACGTGTCATCTGCCTCCCTGG - Intronic
1122523291 14:102362251-102362273 AGACCAGTCATCAGCGTCACAGG + Intronic
1123185389 14:106511725-106511747 AGATGTCCCATCTGCCACACAGG + Intergenic
1124635934 15:31365330-31365352 AAATGAGCCATCACCCTCACAGG - Intronic
1127366911 15:58299732-58299754 AGACAGGCCATCAGCTTCAAAGG + Intronic
1128814450 15:70597309-70597331 ACAGGTGCCCTCAGCCTCAACGG + Intergenic
1134216044 16:12317646-12317668 ACACCTGACATCAGCTTCACAGG + Intronic
1138998665 16:62481732-62481754 AGAGGTGCCACCAGCCACAGAGG + Intergenic
1149994861 17:61401046-61401068 AGCCGAGCCCTCCGCCTCACCGG + Intronic
1152988959 18:344963-344985 GGATCTGCCTTCAGCCTCACAGG + Intronic
1160202856 18:76809678-76809700 AGAGATGCCTTCAGCTTCACAGG - Intronic
1161587237 19:5112317-5112339 AGACCTGCCAGCAGCCTGTCTGG - Intronic
1163834220 19:19563388-19563410 AGAGGTCCCAGCAGCCACACAGG - Intronic
933728268 2:85438393-85438415 AGACACGCCTTCAGCCCCACTGG + Intergenic
937370688 2:121295411-121295433 AGAGGTGCCACCAGCCACAGAGG - Intergenic
937936307 2:127248334-127248356 AGAAGGGCCATCATCTTCACTGG - Intergenic
939714831 2:145570911-145570933 ACACCAGCCATCAGCCTGACAGG - Intergenic
941834088 2:169997198-169997220 AGAGGTGCCACCAGCCACAGAGG - Intronic
944474123 2:200086621-200086643 AGACCTGCTACCATCCTCACAGG + Intergenic
946629503 2:221651626-221651648 AAACGTGGCATCAGCTTCAAGGG + Intergenic
947320808 2:228916222-228916244 TGAAATGCCATCAACCTCACGGG - Intronic
948251202 2:236531369-236531391 AGACGAGCCAGCTGCCTCCCAGG + Intergenic
949071605 2:242028302-242028324 AGACATGCCCTGAGACTCACAGG + Intergenic
1169779515 20:9294016-9294038 AAACGTGCCCTCAGCTGCACTGG - Intronic
1174751072 20:53111969-53111991 ACACGTGCCCTCAGCATCTCAGG - Intronic
1175478187 20:59291864-59291886 AGAGATGCCATCTGCCCCACTGG - Intergenic
1181718030 22:24749334-24749356 TGAGATGCCATCAGCTTCACTGG + Intronic
962403626 3:135081956-135081978 TGCCGTTCCATCTGCCTCACAGG - Intronic
964118427 3:153159923-153159945 AGCTGGGCCATCAGCCTGACCGG + Intergenic
968051056 3:195655183-195655205 AGACGTGCCCTGAAACTCACAGG + Intergenic
974521473 4:62986789-62986811 AGAAGTGCCACCAGCCACAGAGG - Intergenic
974649371 4:64734389-64734411 ACATGTGCCAGCAGCCACACAGG - Intergenic
976285862 4:83370605-83370627 AGAACTGCCCTCAGCCACACAGG + Intergenic
978852666 4:113356870-113356892 AGACCTGTCTTCAGCCTCAGTGG - Exonic
989718376 5:44493105-44493127 AGAGGTGCCACCAGCCACAGAGG + Intergenic
999374374 5:151076549-151076571 AGACGTGCCCACAGCCACATGGG + Intronic
999759054 5:154686265-154686287 AGAAGTGACATCTCCCTCACTGG - Intergenic
1001332774 5:170773793-170773815 GAACCTGCCGTCAGCCTCACTGG + Intronic
1002089074 5:176793930-176793952 AGGAGAGCCATCGGCCTCACAGG - Intergenic
1002305477 5:178280266-178280288 AGGGGCGCCTTCAGCCTCACAGG + Intronic
1005200524 6:23339450-23339472 AGACACGCCAGCAGCCTCATGGG - Intergenic
1012042501 6:94226659-94226681 AGAGCTTCCATCAGCCTCAGAGG - Intergenic
1016163148 6:140907240-140907262 AAATGTGCCATCAGCCACAGAGG - Intergenic
1017706046 6:157123560-157123582 AGGCGTGCCAGGAGGCTCACAGG + Intronic
1019736409 7:2652122-2652144 AGACGTGCACGCAGTCTCACAGG + Intronic
1021115753 7:16744765-16744787 AGTCCTGCCCTCAGCCACACTGG - Intergenic
1024238631 7:47416634-47416656 AGTCTGGTCATCAGCCTCACAGG - Intronic
1024301769 7:47892424-47892446 AGAGGTCACATCATCCTCACTGG + Intronic
1024831663 7:53466562-53466584 AGAAATGCACTCAGCCTCACTGG - Intergenic
1031041543 7:116843447-116843469 AGAAGTGCCAGCAGCCTGAAAGG - Intronic
1036758982 8:11493980-11494002 AGCCGTTCTTTCAGCCTCACTGG - Exonic
1042688605 8:71470299-71470321 AGACTTGCCCTAAGCCTCAGAGG - Intronic
1043360302 8:79464362-79464384 AGACATGCTATCAGCTTCCCTGG - Intergenic
1044997436 8:97850388-97850410 AGACCTGGCTTCAGCCCCACAGG + Intronic
1047453406 8:124987558-124987580 AAAGGTGCACTCAGCCTCACAGG + Intergenic
1053317316 9:37063053-37063075 GCACGTGCCATCAGCATTACAGG - Intergenic
1186077167 X:5893141-5893163 AGAGGCGCCATGAGACTCACAGG - Exonic
1188522074 X:31049937-31049959 AGAGGTGCCAGCAGAATCACTGG + Intergenic
1200039402 X:153354880-153354902 CCCCGTTCCATCAGCCTCACTGG + Intronic
1201491059 Y:14541583-14541605 AGATGTGCTATTAGCCTTACAGG - Intronic
1201518169 Y:14840916-14840938 AGAGGCGCCATGAGACTCACAGG + Exonic