ID: 923369335

View in Genome Browser
Species Human (GRCh38)
Location 1:233295239-233295261
Sequence CAGACGTGCCATCAGCCTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923369335_923369344 26 Left 923369335 1:233295239-233295261 CCGTGAGGCTGATGGCACGTCTG 0: 1
1: 0
2: 1
3: 15
4: 100
Right 923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG 0: 1
1: 0
2: 0
3: 9
4: 143
923369335_923369341 20 Left 923369335 1:233295239-233295261 CCGTGAGGCTGATGGCACGTCTG 0: 1
1: 0
2: 1
3: 15
4: 100
Right 923369341 1:233295282-233295304 CCTCCATACCCACAGCTCCCCGG 0: 1
1: 0
2: 2
3: 34
4: 337
923369335_923369342 21 Left 923369335 1:233295239-233295261 CCGTGAGGCTGATGGCACGTCTG 0: 1
1: 0
2: 1
3: 15
4: 100
Right 923369342 1:233295283-233295305 CTCCATACCCACAGCTCCCCGGG 0: 1
1: 0
2: 2
3: 33
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923369335 Original CRISPR CAGACGTGCCATCAGCCTCA CGG (reversed) Intronic
900374745 1:2348377-2348399 GAGACGCGCCACCAGCCTCACGG - Intronic
901624385 1:10615666-10615688 CACACGTGCCATCTCCCACATGG - Intronic
902242070 1:15095961-15095983 CAGACGAGCCAGCATCCTGATGG - Intronic
907819734 1:57955218-57955240 GAGACCTGCCATGAGCCTCAAGG - Intronic
923369335 1:233295239-233295261 CAGACGTGCCATCAGCCTCACGG - Intronic
1063506195 10:6601929-6601951 CACACATCACATCAGCCTCAGGG - Intergenic
1066239358 10:33518267-33518289 CTCACCTGCCATCAGCCACATGG + Intergenic
1067213526 10:44281543-44281565 CAGTAGTGGCCTCAGCCTCATGG + Intergenic
1067765492 10:49082858-49082880 CAGCCCTGCCATCTGCTTCAGGG - Intronic
1069800793 10:71080344-71080366 CAGACCAGCCCTCAGGCTCAGGG + Intergenic
1075104856 10:119532339-119532361 CAGAAGTGCCCTCAGCCTAAGGG - Intronic
1075991887 10:126845093-126845115 CACACATGCCATCATCCTTATGG + Intergenic
1077916222 11:6613080-6613102 CAGACGAGGAAACAGCCTCAGGG + Exonic
1078364395 11:10694101-10694123 CAGACTTGGCACCAGCCCCAGGG + Intergenic
1078926182 11:15877413-15877435 CAGACCTGCCATCTGCATCCAGG - Intergenic
1080220152 11:29893673-29893695 CAGTGGAGCCATCAGCCGCATGG - Intergenic
1083715625 11:64574419-64574441 CAGAGGTGCCATCATGCTTATGG + Intergenic
1090310638 11:125733962-125733984 CAGACATGCCAAAAACCTCAGGG + Intergenic
1090434574 11:126676186-126676208 CAGGGGTGTCATCAGCATCAAGG + Intronic
1090859225 11:130638342-130638364 CAGAGGTGCCAGAAGCTTCAAGG - Intergenic
1094070675 12:26409771-26409793 CTAATGTGCCATGAGCCTCATGG - Intronic
1095961779 12:47839455-47839477 CAGACTCCCCATCAGCCTCACGG + Intergenic
1098690996 12:73488064-73488086 CAGGCGTGACATCAGCAACATGG + Intergenic
1104294097 12:127496039-127496061 CAGCCCTGCCATCATCCTGATGG + Intergenic
1105306117 13:19170236-19170258 CAGATCTGACAGCAGCCTCAGGG + Intergenic
1111253846 13:85640011-85640033 GAGAGGTGCCATCATCCTCTTGG + Intergenic
1112428118 13:99323484-99323506 CACAAGTCCCATCACCCTCATGG - Intronic
1113856409 13:113448747-113448769 CAGATGTGCCTTCGGCCACACGG + Intronic
1113863023 13:113502605-113502627 CAGAAGTGCCATCAGTGTGACGG - Intronic
1117047508 14:51828126-51828148 CAGTCCTGCCATCATCCCCAGGG + Intronic
1122580908 14:102771044-102771066 CAGACTTGTCCTCAGCCTCGGGG + Intergenic
1122777455 14:104127372-104127394 CAGACGTACCAACTGGCTCAGGG + Intergenic
1125611819 15:40976538-40976560 CTGACTTGGCAACAGCCTCAGGG - Intergenic
1129664325 15:77571228-77571250 CAGACGTTCCCTCAGCCCCCAGG + Intergenic
1131059046 15:89393160-89393182 CAGACCTGCCACCAGGCTCTGGG + Intergenic
1132586221 16:706691-706713 CAGACGCCCCAGCAGGCTCAGGG + Intronic
1134014344 16:10878233-10878255 CAGACCTGTCATCAGTCTCTGGG - Intronic
1135620670 16:23952652-23952674 CAGAAGTGCCTTCAGCAACAGGG - Intronic
1138186870 16:54983652-54983674 CAGCACTGCCATCAGCCTCAAGG - Intergenic
1139345922 16:66303761-66303783 CAGAAAAGCCATCAGGCTCAGGG + Intergenic
1140323158 16:73973616-73973638 CATTCGTGCCATCAGCCTGGTGG - Intergenic
1148077737 17:44948715-44948737 CAGACTTGCCATCAGGATAAGGG + Intergenic
1150606459 17:66695256-66695278 CTGAAGTGCCCTCAGCCCCAGGG - Intronic
1153497135 18:5710925-5710947 CAAATGTGCCAACAGCCACATGG + Intergenic
1153838660 18:8986946-8986968 CACAGGTCCCATCACCCTCACGG + Intergenic
1157799869 18:50610385-50610407 CAGAGGTACCAGCAGCCTCTGGG - Intronic
1158315781 18:56210144-56210166 CAGAAGAGCCAGGAGCCTCAGGG - Intergenic
1160258770 18:77271181-77271203 CAGACGTGCCAGTAGCATCTGGG - Exonic
1161525531 19:4752664-4752686 CAGACATGCCGCCAGCCTCTGGG - Intergenic
1163193287 19:15696065-15696087 CAAAGGTGCCCACAGCCTCAGGG + Exonic
1163228561 19:15981316-15981338 CAAAGGTGCCCACAGCCTCATGG - Intergenic
1167443036 19:49520722-49520744 GCCACGTGCCTTCAGCCTCAAGG - Intronic
1168466448 19:56605830-56605852 AAGACGTGCCATCCATCTCAGGG + Intronic
925598796 2:5587244-5587266 CAGAGGTGTCACCAGCCCCAAGG - Intergenic
927170488 2:20365343-20365365 CATGCCTGCCATCAGCGTCATGG + Intergenic
929789337 2:45012037-45012059 CAGACCTGCCAGGAGCCTCCAGG + Intergenic
935786358 2:106552277-106552299 CAAATGGGCCATCAGCCCCAAGG + Intergenic
936055952 2:109262092-109262114 CACAGGTGCCCTCGGCCTCAGGG + Intronic
937776491 2:125783021-125783043 CAGACCTCCCAGCAGCCTCTAGG + Intergenic
938564764 2:132508727-132508749 TACACCTGCCATCAGCCCCAGGG + Intronic
943861179 2:192864402-192864424 CATAAGAGCCACCAGCCTCATGG - Intergenic
944414353 2:199467924-199467946 CAGACTTGCCACCAACATCATGG + Intronic
946629502 2:221651625-221651647 CAAACGTGGCATCAGCTTCAAGG + Intergenic
947320809 2:228916223-228916245 CTGAAATGCCATCAACCTCACGG - Intronic
1173220067 20:41125273-41125295 CAGCCCTGCCTCCAGCCTCAGGG - Intergenic
1178534600 21:33401823-33401845 CACAAGTGTCATCCGCCTCAGGG - Intergenic
1181568163 22:23752091-23752113 CAGTCTTGCCATCAGCAGCAAGG - Intergenic
1183187909 22:36302929-36302951 CACACGTGCCTTCACCCCCATGG - Intronic
1184415542 22:44349940-44349962 CAGACCTGCCTGCAGCCTCAGGG - Intergenic
950496700 3:13338148-13338170 CAGACAGGGCAGCAGCCTCAGGG - Intronic
952796461 3:37243399-37243421 CGGACTTGCCCACAGCCTCAAGG + Exonic
956224865 3:66946189-66946211 CTAATGTGCCATCAGCCTCCAGG - Intergenic
960963689 3:123090129-123090151 CAGACGTGCCTGCATCCTCCAGG + Intronic
962488553 3:135868122-135868144 GAGACCTGACATCAGCCTCAGGG + Intergenic
965226211 3:165995302-165995324 CAGATGTTGCATCAGTCTCACGG + Intergenic
965475574 3:169150825-169150847 CAGCCCTGCCATCAGCCAAAGGG - Intronic
965786520 3:172340704-172340726 CAGACTTGCCAGAAGCCTCGTGG + Intronic
966428011 3:179801480-179801502 CAGATGTGTCATCAGCTGCAAGG + Exonic
969457523 4:7308599-7308621 CAGACATGCCAGCAACCTCAGGG + Intronic
981669813 4:147274648-147274670 CACACGTTCCAACAGACTCAGGG - Intergenic
981972040 4:150675073-150675095 CAGATGTGGCATGAGCCTCAGGG + Intronic
985523262 5:389033-389055 CAGACGCCCCATGAGCCACATGG + Intronic
985732093 5:1555046-1555068 CAGACGTGCCAAATGCCTAAAGG - Intergenic
986221014 5:5768657-5768679 CAGACGTGCCAGGGGCCTGAGGG + Intergenic
987370673 5:17189806-17189828 CAGGCGTGCCAGGAGGCTCAGGG + Intronic
989697302 5:44217516-44217538 CAGACATGACCTCAGCCTCAAGG + Intergenic
990992804 5:61701755-61701777 CAGAAATGCCAACAGCCCCAGGG - Intronic
996564114 5:124862031-124862053 CAGCTCTGCCATCATCCTCATGG + Intergenic
999374373 5:151076548-151076570 CAGACGTGCCCACAGCCACATGG + Intronic
1001677627 5:173531601-173531623 CAGAGAGGCCATCAGGCTCAAGG - Intergenic
1005200525 6:23339451-23339473 AAGACACGCCAGCAGCCTCATGG - Intergenic
1013311334 6:108897153-108897175 CTGACTTCCCATCAGGCTCAGGG - Intronic
1018442832 6:163828822-163828844 GAGACATGCCCTCAGCTTCAGGG - Intergenic
1019831601 7:3336237-3336259 CAGGCATGCCTTCAGCCTCTGGG - Intronic
1023871393 7:44264747-44264769 CTGAGGTGCCAGGAGCCTCAGGG + Intronic
1027195356 7:76026352-76026374 CAGTGGTGCAATCAGCCTCCTGG + Intronic
1029629398 7:101740979-101741001 CAGCCCTGCCAACAGCCCCAAGG + Intergenic
1031001053 7:116415195-116415217 CAGAGGTGCAAACAGCCTCATGG + Intronic
1031817514 7:126456340-126456362 CAGACCTGTCAGCAGTCTCATGG + Intronic
1034252488 7:149703475-149703497 CAGATGTGCAGTCAGCGTCAGGG - Intergenic
1035309108 7:157953492-157953514 CACCCGTGCCAGCAGCCTCATGG - Intronic
1042032067 8:64487187-64487209 GAGAGGTTCCATCAGGCTCAGGG - Intergenic
1049244367 8:141553979-141554001 CAGATGAGGAATCAGCCTCAGGG - Intergenic
1049406329 8:142453217-142453239 CACACGTGCCCCCAGCCTCCCGG - Intronic
1049425248 8:142535295-142535317 CAGATGTGCAAGAAGCCTCATGG + Intronic
1049593111 8:143471536-143471558 CACAGGAGCCATCAGGCTCATGG + Intronic
1050161530 9:2724639-2724661 CATTCCTGGCATCAGCCTCATGG - Intronic
1050214689 9:3309489-3309511 CAGATGTGGCACAAGCCTCAGGG - Intronic
1052867293 9:33472137-33472159 AAGACAGTCCATCAGCCTCAGGG + Intronic
1053392318 9:37744734-37744756 CAGAGGAGCCAGCAGCCCCAAGG - Exonic
1053565543 9:39246517-39246539 GAGGCGTGCAGTCAGCCTCAGGG - Intronic
1053831310 9:42084370-42084392 GAGGCGTGCCATCAGCCTCAGGG - Intronic
1054131605 9:61372522-61372544 GAGGCGTGCAGTCAGCCTCAGGG + Intergenic
1054599237 9:67103068-67103090 GAGGCGTGCCGTCAGCCTCAGGG + Intergenic
1056491244 9:87109306-87109328 CAGATGTGTCATCACCCTCTTGG + Intergenic
1060424325 9:123492173-123492195 CTGAGGTGCTTTCAGCCTCATGG + Intronic
1199854643 X:151750540-151750562 CAGACGTGCCATGACCAACATGG - Intergenic