ID: 923369337

View in Genome Browser
Species Human (GRCh38)
Location 1:233295267-233295289
Sequence TATGGAGGGAAGAAGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1332
Summary {0: 1, 1: 1, 2: 13, 3: 128, 4: 1189}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923369337_923369341 -8 Left 923369337 1:233295267-233295289 CCTTTCTCCTTCTTCCCTCCATA 0: 1
1: 1
2: 13
3: 128
4: 1189
Right 923369341 1:233295282-233295304 CCTCCATACCCACAGCTCCCCGG 0: 1
1: 0
2: 2
3: 34
4: 337
923369337_923369344 -2 Left 923369337 1:233295267-233295289 CCTTTCTCCTTCTTCCCTCCATA 0: 1
1: 1
2: 13
3: 128
4: 1189
Right 923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG 0: 1
1: 0
2: 0
3: 9
4: 143
923369337_923369359 29 Left 923369337 1:233295267-233295289 CCTTTCTCCTTCTTCCCTCCATA 0: 1
1: 1
2: 13
3: 128
4: 1189
Right 923369359 1:233295319-233295341 CACTCACCAGGTGCAGGGCCAGG 0: 1
1: 1
2: 1
3: 46
4: 369
923369337_923369342 -7 Left 923369337 1:233295267-233295289 CCTTTCTCCTTCTTCCCTCCATA 0: 1
1: 1
2: 13
3: 128
4: 1189
Right 923369342 1:233295283-233295305 CTCCATACCCACAGCTCCCCGGG 0: 1
1: 0
2: 2
3: 33
4: 293
923369337_923369354 23 Left 923369337 1:233295267-233295289 CCTTTCTCCTTCTTCCCTCCATA 0: 1
1: 1
2: 13
3: 128
4: 1189
Right 923369354 1:233295313-233295335 CCTCCCCACTCACCAGGTGCAGG 0: 1
1: 1
2: 3
3: 28
4: 347
923369337_923369351 17 Left 923369337 1:233295267-233295289 CCTTTCTCCTTCTTCCCTCCATA 0: 1
1: 1
2: 13
3: 128
4: 1189
Right 923369351 1:233295307-233295329 CCGGACCCTCCCCACTCACCAGG 0: 1
1: 0
2: 2
3: 31
4: 252
923369337_923369355 24 Left 923369337 1:233295267-233295289 CCTTTCTCCTTCTTCCCTCCATA 0: 1
1: 1
2: 13
3: 128
4: 1189
Right 923369355 1:233295314-233295336 CTCCCCACTCACCAGGTGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 294
923369337_923369360 30 Left 923369337 1:233295267-233295289 CCTTTCTCCTTCTTCCCTCCATA 0: 1
1: 1
2: 13
3: 128
4: 1189
Right 923369360 1:233295320-233295342 ACTCACCAGGTGCAGGGCCAGGG 0: 1
1: 0
2: 3
3: 33
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923369337 Original CRISPR TATGGAGGGAAGAAGGAGAA AGG (reversed) Intronic
900204715 1:1427052-1427074 GATGGAGGGATGAAGGATTAGGG - Intronic
900384039 1:2401278-2401300 GAAGGAGGGAGGAAGGAGGAGGG - Intronic
900471933 1:2859370-2859392 GAAGGAGGAAGGAAGGAGAAAGG + Intergenic
900498788 1:2989562-2989584 AATGGATGGAAGATGGAGGATGG - Intergenic
900550687 1:3252900-3252922 CATGCAGGAAAGAAGGAGAAAGG + Intronic
900886629 1:5419924-5419946 GAGGAAGGGAAGAAGGGGAAGGG - Intergenic
900892348 1:5458547-5458569 GAAGGAGAAAAGAAGGAGAAAGG - Intergenic
900932899 1:5747843-5747865 GAGGGAGGGAGGAGGGAGAAGGG + Intergenic
901046150 1:6396952-6396974 TGAGGAGGGAAGAGGAAGAAAGG - Intergenic
901178513 1:7322777-7322799 TATTAAGGGAAGAAGAAGAAAGG - Intronic
902951142 1:19883421-19883443 CATGGATGGAAGAAGGAAAAGGG + Intronic
903259877 1:22125745-22125767 AATGGAGGACAGCAGGAGAAGGG + Intronic
903471897 1:23593107-23593129 TAGGTAGGGAGGAAAGAGAAGGG + Intronic
903799465 1:25955736-25955758 GAGGGAAGGAAGAAGGAGGAAGG + Intergenic
904246291 1:29190439-29190461 TAAGGAGGGTGGAAGGGGAAGGG + Intergenic
904306518 1:29593635-29593657 TATGGAGGGGAAACTGAGAAAGG + Intergenic
904344969 1:29861771-29861793 CATGGAGGACACAAGGAGAAAGG + Intergenic
904441017 1:30530849-30530871 TTTGGAGGGAAGCAGAAGCAAGG - Intergenic
904920136 1:34000976-34000998 GAAGGAGGGGAGAAGGAGAAAGG + Intronic
905508984 1:38503452-38503474 GAGGGAAGGAAGAAGGAGCATGG - Intergenic
905520063 1:38590745-38590767 TGTGGGGGCGAGAAGGAGAATGG - Intergenic
905602725 1:39268244-39268266 AATGGAGGGAAAAAGAAGAGAGG - Intronic
905950121 1:41943554-41943576 TGTGTAGAGAAGATGGAGAAGGG - Intronic
906073478 1:43034921-43034943 GTTGGAGGGAAGAAAGAGTACGG + Intergenic
906245022 1:44267397-44267419 AAGGGAGGGAAGAAGAAGGAGGG - Intronic
906427788 1:45727462-45727484 GAGGGAGGGAAGGAAGAGAAAGG - Intronic
906800826 1:48735527-48735549 TAAGGAAGGAAGAAGGAAAAAGG + Intronic
907391603 1:54161744-54161766 TGTGGTGGGAAGGATGAGAAGGG - Intronic
907392429 1:54166965-54166987 CTTAGAGGGAAGCAGGAGAAGGG + Intronic
907401139 1:54225676-54225698 AGGGGAGGGAGGAAGGAGAAGGG + Intronic
907907788 1:58799944-58799966 GAAGGATGGAAGGAGGAGAAAGG - Intergenic
908064821 1:60391457-60391479 TAGGGAGGGAAGAAAGAGATAGG + Intergenic
908089440 1:60670754-60670776 TGTGGAAGGAGGAAGGAAAAAGG + Intergenic
908118975 1:60967929-60967951 TACGGAGGGAAGAGAGAGGAGGG + Intronic
908187827 1:61669584-61669606 TAGGGAGGGAAGGTAGAGAAAGG + Intergenic
908190382 1:61697334-61697356 GAAGAAGGAAAGAAGGAGAAAGG - Intronic
908278076 1:62497926-62497948 TATGGCTGGAAGAAAGAGTAAGG - Intronic
908440135 1:64145282-64145304 TATGGAACAAAGAAGGGGAAGGG + Intronic
909251628 1:73364346-73364368 GAAAGAAGGAAGAAGGAGAAGGG - Intergenic
909364382 1:74802252-74802274 TATTGGAGAAAGAAGGAGAAAGG - Intergenic
910464844 1:87487646-87487668 TATTGAGAGAGGCAGGAGAACGG + Intergenic
910647436 1:89528810-89528832 AAAGGAGGAAAGAAGGAAAAAGG + Intronic
910730622 1:90392042-90392064 TGAGTAGGGAAGAAGGAAAAAGG - Intergenic
910799381 1:91130536-91130558 TATGTAGGGAAGAGGGAAAGAGG - Intergenic
910843375 1:91582688-91582710 GAAGGAAGGAAGAAGGTGAAGGG + Intergenic
911172374 1:94783290-94783312 TATGGAGGAAGAAAGGAGCAAGG + Intergenic
911180022 1:94852176-94852198 TTTGGAGGGTAGAAGGAGACAGG + Intronic
911201030 1:95043836-95043858 GAAGGAGGGGAGAGGGAGAAGGG + Intronic
911216117 1:95197483-95197505 CATGGAGGGGAGGGGGAGAAGGG - Exonic
911326211 1:96472523-96472545 GAGGGAGGCAAGAAGGACAAAGG - Intergenic
911480861 1:98438385-98438407 AATGGAGGGAAGAAGGTGGCAGG - Intergenic
911968532 1:104399220-104399242 TAGGGAGAGAAGCAGGGGAATGG + Intergenic
912495655 1:110089641-110089663 TGGGCAGGGAAGAAAGAGAAAGG - Intergenic
912587360 1:110779217-110779239 GAAGGAAGGAAAAAGGAGAAGGG + Intergenic
912690402 1:111800680-111800702 TTTGGAGGGGAAAAGTAGAAGGG + Intronic
912730007 1:112093793-112093815 GAGGGAGGGAGGAAGGAGGAAGG + Intergenic
912897476 1:113608234-113608256 GAGGGAGGGAAGAAGGGAAAAGG + Intronic
913963533 1:143356690-143356712 GAGGGAGGGAAGAGGAAGAAAGG - Intergenic
914057893 1:144182279-144182301 GAGGGAGGGAAGAGGAAGAAAGG - Intergenic
914121253 1:144784086-144784108 GAGGGAGGGAAGAGGAAGAAAGG + Intergenic
914349985 1:146832388-146832410 TATGGAGGGAAGGAGGCAACTGG - Intergenic
915008951 1:152666729-152666751 TCAGGTAGGAAGAAGGAGAAAGG + Intergenic
915141318 1:153770409-153770431 TTTGGTGGGAAGGAGGACAATGG - Intronic
915343078 1:155186781-155186803 AATGGAGGGTAGACCGAGAAAGG - Intronic
915650809 1:157309178-157309200 GAAGGAAGGAGGAAGGAGAAAGG - Intergenic
915840135 1:159206521-159206543 TCTGGGGAGAAGAAGGAGAATGG + Intergenic
916063574 1:161118596-161118618 TACAGTGGGAAGATGGAGAAAGG - Intronic
916143819 1:161722822-161722844 TTTGGAGGGGTGAAGAAGAAGGG + Intronic
916385992 1:164270983-164271005 CAAGGAGGGAAGAGGGAGATTGG - Intergenic
916484399 1:165245244-165245266 TCTAGAGGGAGGAAGGAGAGCGG - Intronic
916851965 1:168712994-168713016 GAGGGAGGGGAGAAGGGGAAAGG + Intronic
917273622 1:173305855-173305877 TGTGGAGGGAAGGAGGTGACTGG - Intergenic
917469566 1:175314809-175314831 AAGGTAGGGAAGAAAGAGAAAGG + Intergenic
917469576 1:175314938-175314960 GAAGGAGGGAAGAATGAGGAAGG + Intergenic
917504699 1:175617046-175617068 GATGGAAGGAAGAAGCAGAGTGG - Intronic
917737606 1:177934824-177934846 AATGGAGGGAGGGAGGGGAAAGG + Intronic
917886991 1:179396253-179396275 TGGGGAGGGAAGAAGCAGAATGG - Intronic
917978688 1:180256187-180256209 TGAGGAGGGAAGGAGGGGAAAGG - Intronic
918109472 1:181442754-181442776 AATGGAAGGAAGAAAGAGACAGG - Intronic
918761867 1:188420595-188420617 GAAGGAAGGAAGAAGGAGGAAGG - Intergenic
918857757 1:189780673-189780695 GATGGAGGGAAGAAGGAGGGAGG + Intergenic
918876138 1:190046286-190046308 AAGGGAGGGAGGAAGGAGGAAGG + Intergenic
918878531 1:190083771-190083793 CAAGGATGGAAGAAGGAGAGAGG + Intergenic
918883783 1:190163791-190163813 TATTGACGGAAAAAGGATAAAGG - Intronic
919121875 1:193351481-193351503 TATGGACAGAAGAAGGAGAGTGG + Intergenic
919439178 1:197606695-197606717 TTTGAAGGCAAGAAGAAGAAGGG - Intronic
919509126 1:198438984-198439006 AAGGTAGGGAAGAAGGGGAAGGG + Intergenic
919544084 1:198891282-198891304 AATGTAGGGAAGAGGGAAAACGG + Intergenic
919781629 1:201224995-201225017 CATGGAGGAAAGGTGGAGAATGG - Intronic
920017403 1:202924401-202924423 TAAGGAGGAAGGAAGGAGAGAGG - Intronic
920074027 1:203324028-203324050 GATGGAAGGCAGAGGGAGAAGGG + Intergenic
920167002 1:204043142-204043164 CATGGAGGAGAGAGGGAGAAAGG + Intergenic
920259617 1:204679975-204679997 GAGGGAGGGAAGGAGGAGAATGG + Intronic
920367539 1:205455995-205456017 CAAGGAGGGAAGAAAGAGATTGG - Intergenic
920601695 1:207331770-207331792 TCTAGAAGGATGAAGGAGAATGG - Intronic
920826349 1:209427225-209427247 TCTGGAAGGAAGAGGGAGAGAGG + Intergenic
920930662 1:210384719-210384741 CATGGAGGCAAGAAAGAAAATGG + Intronic
921122995 1:212152911-212152933 TGTGGAGGGCAGAAGGTGCAGGG + Intergenic
921211737 1:212906614-212906636 TATGGAGAGAATAAAGAGTAAGG + Intergenic
921227641 1:213036214-213036236 TAGGGATGGAGGAAAGAGAAGGG - Intergenic
921256063 1:213340746-213340768 CATAGAGGGAAGAAGAGGAAAGG - Intergenic
921382539 1:214539655-214539677 AAGGAAGGGAAGAAGGAGGAGGG + Intronic
921600162 1:217098194-217098216 GATGGAGGGTTGAAGGAGAAGGG - Intronic
921734508 1:218612013-218612035 AAAGGAGAGGAGAAGGAGAAGGG - Intergenic
921734520 1:218612111-218612133 GAAAGAGGGAAGGAGGAGAAGGG - Intergenic
922063554 1:222114400-222114422 AATGAAGGGAAGAGGCAGAAGGG - Intergenic
922402745 1:225277019-225277041 GAGGGAGGGAGGAAGGGGAAAGG + Intronic
922825846 1:228517914-228517936 GGAGGAGGGAAGAAGGGGAAGGG - Intergenic
923027050 1:230212816-230212838 TATCAAGGGAAGAAAAAGAACGG - Intronic
923127769 1:231047342-231047364 AAAGGAGGGAAGGAGGAGGAAGG - Intergenic
923183316 1:231544768-231544790 AATGGAGAGAAAAAGGTGAAAGG + Intronic
923332959 1:232942577-232942599 GAGGGAGGAAGGAAGGAGAAAGG + Intergenic
923369337 1:233295267-233295289 TATGGAGGGAAGAAGGAGAAAGG - Intronic
923452876 1:234136218-234136240 GAGGAAGGGAGGAAGGAGAAGGG - Intronic
923591984 1:235327811-235327833 TTTGGGGGGGAGAAGGAGAGAGG - Exonic
923885721 1:238152970-238152992 TATGAAGAAAAGAAGGAGAGAGG - Intergenic
924279521 1:242422210-242422232 GAGGGAGGGCAGGAGGAGAAGGG + Intronic
924454585 1:244208869-244208891 TATTGTGGGAAGAGGCAGAATGG + Intergenic
924521681 1:244811332-244811354 TCTGGAGGGGAGAAGGGGCAAGG + Intergenic
924633400 1:245763207-245763229 TATTGAGGGAAGGAGGAGGGAGG - Intronic
924657699 1:245988569-245988591 AATGGTGGGAATAAGGGGAAGGG - Intronic
1063225642 10:4013047-4013069 GAGGGAGGGAGGAAGGAGAGAGG - Intergenic
1063477013 10:6337704-6337726 GATGCAGGGAAGAAGGAAATGGG + Intergenic
1063650125 10:7927276-7927298 AATGGAGAGAAGAATGAGAATGG - Intronic
1063666401 10:8063215-8063237 GAGGGAGGGAAAAAGGAAAAGGG - Intronic
1064300347 10:14117668-14117690 GAAGGAGGGTGGAAGGAGAATGG + Intronic
1064533021 10:16329533-16329555 GAAGGAAGGAAAAAGGAGAAGGG + Intergenic
1064550283 10:16493665-16493687 TATGGAAGGAAGAAAGGGAAAGG + Intronic
1064627241 10:17273841-17273863 GGAGGAGGGAAGAAGGAGGAAGG - Intergenic
1064812487 10:19216464-19216486 TGGGGAGGAAAGTAGGAGAAAGG - Intronic
1064857974 10:19792948-19792970 TATGGAGGGAGGATGGAAAAGGG - Intergenic
1064937442 10:20693756-20693778 GTTGGAGGGAGGAAGGGGAAGGG + Intergenic
1065113703 10:22464187-22464209 AAGGGAGGAAGGAAGGAGAAAGG + Intergenic
1065266043 10:23976677-23976699 TTTGGAGGGAAGAAGTCTAAAGG + Intronic
1065887561 10:30092220-30092242 TCTGGAAGGAGAAAGGAGAATGG + Intronic
1065923868 10:30418166-30418188 GAAAGAGGGAAGAAAGAGAAAGG + Intergenic
1065945131 10:30599300-30599322 TATGAAGGGACAAAGGAGAAGGG - Intergenic
1066221708 10:33341448-33341470 TAGGGAGAGAAGCAAGAGAATGG - Intergenic
1066304585 10:34128286-34128308 TAGGCAGGGGAGGAGGAGAAAGG - Intronic
1066359867 10:34719674-34719696 TTTGGAGGGGAGAAGGAAAGAGG - Intronic
1066487042 10:35856156-35856178 AAGGGAGGGAAGGAGGAGAGAGG - Intergenic
1066495223 10:35935986-35936008 TAGATAGAGAAGAAGGAGAAAGG - Intergenic
1066533728 10:36367522-36367544 GAGGGAGGGAAGAAGGAACAAGG + Intergenic
1066571217 10:36774659-36774681 TATGAAGGAGAGAATGAGAAGGG - Intergenic
1067027172 10:42853877-42853899 AAGGGAGGGAGGAAGGAGGAAGG - Intergenic
1067232008 10:44418513-44418535 GATGGAGGCAAAAAGAAGAAAGG + Intergenic
1067461257 10:46460303-46460325 CATCCAGGGAAAAAGGAGAAAGG - Intergenic
1067625938 10:47924298-47924320 CATCCAGGGAAAAAGGAGAAAGG + Intergenic
1067787080 10:49258257-49258279 TAAGGAGGGAAGAAGAATAATGG - Intergenic
1068064760 10:52115596-52115618 GATGGAGTGAGGAAGGGGAATGG - Intronic
1068076721 10:52264970-52264992 TATCTTGGGAAGAAGGAAAAGGG - Intronic
1068445099 10:57110514-57110536 TCTGGAGGGAAGAGTGGGAATGG + Intergenic
1068450387 10:57178892-57178914 GAGGGAGGGAAGGAGGGGAAGGG + Intergenic
1068712620 10:60150737-60150759 TATTCATGGCAGAAGGAGAAGGG - Intronic
1068807690 10:61217358-61217380 TATGGTGGGAGGATGGTGAAGGG + Intergenic
1069391977 10:67945914-67945936 GAAGGAAGGAAGAAGGAGGAAGG + Intronic
1070156734 10:73839969-73839991 TAGGGAGGGAAGGACTAGAAGGG - Intronic
1070520025 10:77244507-77244529 TGTGGAAGGGAGAAGGAGGAAGG + Intronic
1070664403 10:78333111-78333133 AATGGAGCAGAGAAGGAGAAGGG + Intergenic
1070731266 10:78830150-78830172 TAGAGAGGGCAGAAGGGGAATGG - Intergenic
1071012401 10:80953767-80953789 CAAGGATGGAAGAAGGAAAAAGG - Intergenic
1071268964 10:83989751-83989773 AAAGGAGGGAAGAAAGAGGAAGG + Intergenic
1071268973 10:83989794-83989816 AAGGGAGGGAAGAAGGAGGAAGG + Intergenic
1071268981 10:83989835-83989857 AAGGGAGGGAAGAAGGAGGAAGG + Intergenic
1071503980 10:86222015-86222037 CATGGGGGGAAGAAGGGGACAGG + Intronic
1071522643 10:86340706-86340728 GGAGGAGGGAAGAAGGAAAAAGG + Intronic
1071670386 10:87603802-87603824 TGGGGAGGGTAGCAGGAGAAGGG - Intergenic
1071810505 10:89176078-89176100 GATGGAGGGAGGTAGGAGATGGG - Intergenic
1071852670 10:89590889-89590911 AAAAGAGGGAAGAAGGAGAGAGG + Intronic
1072039296 10:91591840-91591862 AATGGAGGCAGGATGGAGAACGG + Intergenic
1072121238 10:92407133-92407155 TATGGAGGAGAGAAGGAGCTAGG + Intergenic
1072217156 10:93297103-93297125 TATGGAGACAAAAAGTAGAATGG - Intergenic
1072243438 10:93519385-93519407 TTAAGGGGGAAGAAGGAGAAGGG - Intronic
1073143280 10:101262803-101262825 GGGGGAGGGAAGAAGGAGATTGG - Intergenic
1073649097 10:105339975-105339997 GAAGGAGGGAGGGAGGAGAAGGG - Intergenic
1073686926 10:105765107-105765129 TGTGGAGGGAAGGAGGAAAGAGG + Intergenic
1073764313 10:106665350-106665372 AAGGGAAGGAAGAAGGAGAAAGG - Intronic
1074104562 10:110378860-110378882 CATGGTGGCAAGAAAGAGAAGGG - Intergenic
1074185005 10:111093551-111093573 TCTGTAGGGAAGAACCAGAAAGG + Intergenic
1074441428 10:113480435-113480457 TTAGGTAGGAAGAAGGAGAATGG + Intergenic
1074607714 10:114990426-114990448 TAAGGAGGGAAGTAGCAGTATGG + Intergenic
1074781282 10:116804134-116804156 TTTGGAGGGAGGAGGGAGGAAGG - Intergenic
1075485720 10:122820582-122820604 TATGGAGGTAAGTTGAAGAAAGG - Intergenic
1075544728 10:123346491-123346513 TAAGGAGGGGAGACAGAGAAAGG - Intergenic
1076502588 10:130949054-130949076 TAAGGAGGGAAGAAAGAGAGTGG - Intergenic
1076776463 10:132700576-132700598 GCTGGAGGGAGGAAGGAGGAGGG + Intronic
1077346536 11:2060066-2060088 TATGGAGTGAGTATGGAGAAGGG - Intergenic
1077357385 11:2124790-2124812 CATGGAGGGAAGAAAGCGAAAGG - Intergenic
1077662496 11:4082392-4082414 TATGCAGGTAAAAAGGAGAAGGG - Intronic
1077895709 11:6451635-6451657 CATGAAGGGATGAAGGGGAATGG + Intronic
1078372483 11:10760928-10760950 TAAAGAGGGAGGAAAGAGAAAGG + Intronic
1078913223 11:15752816-15752838 TTTGGAGGGAAGAAGGGGAAGGG - Intergenic
1079288715 11:19165944-19165966 CATGGAAGGAAGAAAGAGACAGG + Intronic
1080298122 11:30753342-30753364 TATGGAGGGAGGCAGGAGGCAGG - Intergenic
1081021223 11:37950084-37950106 TATGTAGGGGAGATGAAGAATGG - Intergenic
1081055936 11:38411304-38411326 TAAGAAGGGAAGAAGGCCAAAGG + Intergenic
1081462969 11:43288704-43288726 GATGGAGGAAAGAAAGGGAAGGG + Intergenic
1081620730 11:44617912-44617934 TGTGCAGGGCACAAGGAGAATGG - Intronic
1081659487 11:44879267-44879289 TAGGGAAAGAAGAAGGAGGAAGG - Intronic
1081822378 11:46012054-46012076 TATGAAGGTAAAAAGGAAAAGGG - Intronic
1081872139 11:46388043-46388065 CATGGAGGGAAGAGGAAGAGGGG - Intergenic
1081969373 11:47187170-47187192 TAGGGAGAGAGGAGGGAGAAGGG - Intergenic
1083034079 11:59620391-59620413 TATGGAGGAAAAAAAGAGAAAGG - Intergenic
1083729160 11:64643589-64643611 GAGGGAGGGAAGGAGGAGAGCGG + Intronic
1083985568 11:66212679-66212701 TATTAAGGGGAGAAGAAGAAAGG + Intronic
1084162770 11:67359090-67359112 CATGGTGGGCAGAAGTAGAAGGG - Intronic
1084166167 11:67375647-67375669 GAAGGAGGGGAGAGGGAGAAGGG + Intronic
1084194772 11:67518226-67518248 TAGGGAGGGAGGAAGGTAAAGGG + Intergenic
1084609267 11:70191811-70191833 TAGGGAGGGCCCAAGGAGAACGG + Intergenic
1084630384 11:70344444-70344466 TATGGTGGGAAGCGGGAGGAAGG + Intronic
1084742197 11:71146982-71147004 TATGGAGCGAGGAAGGAGCACGG + Intronic
1085806746 11:79643358-79643380 GAAGGAAGGAAGAAAGAGAAAGG + Intergenic
1085853237 11:80145980-80146002 AAGGGAGGGAAGGAGGGGAAGGG + Intergenic
1086080300 11:82896954-82896976 GATGTAGTGAAGAGGGAGAATGG - Intronic
1086419215 11:86621586-86621608 TTTGTAGGAAAGAAAGAGAAAGG - Intronic
1086472078 11:87124765-87124787 AATGAAGGGAAGGAGGAGAAAGG - Intronic
1086540279 11:87900738-87900760 GAGGGAGGGAAGAAGGAAGATGG + Intergenic
1087359161 11:97136361-97136383 TATAGAGGAAAGTAAGAGAAGGG - Intergenic
1087786228 11:102357258-102357280 GAGGGAGGGAAGAGGGAGTAAGG - Intronic
1088002139 11:104895142-104895164 TACGGAGGGAAGAAAGTAAAAGG + Intergenic
1088227161 11:107633778-107633800 TTTTGAGGGAAAGAGGAGAATGG - Intronic
1088366170 11:109042032-109042054 TAAGAAGGGGAGAAAGAGAAAGG - Intergenic
1088544887 11:110949156-110949178 CATGGAGGAAAGAAGGAAAGAGG - Intergenic
1088693499 11:112347316-112347338 GTTAGAGGGAAGAAGAAGAATGG - Intergenic
1088735533 11:112724968-112724990 GAGGGAGGGAAGAAGGGAAATGG - Intergenic
1088827534 11:113508188-113508210 GGGGGAGGGAAGAAGGAAAACGG + Intergenic
1088857910 11:113773121-113773143 CATCGATGGAAGAAGGGGAAGGG + Intronic
1088986488 11:114913838-114913860 CCAGGAGGGAAGAAAGAGAAAGG + Intergenic
1089100403 11:115958195-115958217 TAGGGAGAGAGGAAGGAGGAAGG - Intergenic
1089111369 11:116060468-116060490 TAGGGAGGGAGGAAGGAGCTGGG + Intergenic
1089391472 11:118104835-118104857 GAAGGAGGGAAAAAGGAGAGAGG - Intronic
1089496160 11:118909635-118909657 TAAGGAGGGAAGAACTAGAAGGG + Intronic
1089654416 11:119936256-119936278 TATGGAGCTAAGAATGACAATGG + Intergenic
1089669829 11:120046654-120046676 TATGGAGGCCAGAAGGAAATAGG + Intergenic
1089733735 11:120535394-120535416 GAAGGAGGGAAGAAGGAGTTTGG + Intronic
1089999384 11:122941539-122941561 TATAGAGGGAGGAAAAAGAATGG - Intronic
1090067026 11:123511735-123511757 TATGGAGGAGAGAATGAGAGAGG + Intergenic
1090262240 11:125330090-125330112 GATGGTGGGAAGGAGGAGCATGG + Intronic
1090357862 11:126152049-126152071 TGTGGAGGGATTAAGGAGAAAGG - Intergenic
1090718440 11:129451413-129451435 TTTTGAGGGAAGAGGGAGACTGG + Exonic
1090787302 11:130061138-130061160 GAAGGAAGGAAGAAGGGGAAGGG + Intergenic
1090941925 11:131394462-131394484 TATGGAGAGAAGACTGAGTAGGG + Intronic
1091019523 11:132087129-132087151 TAAGGACAGAAGAAGGAAAAAGG - Intronic
1091785864 12:3243055-3243077 TTTGGAGGGATGAAGGAGCAGGG + Intronic
1091809873 12:3388029-3388051 AAGGAAGGAAAGAAGGAGAAAGG - Intronic
1091913652 12:4251798-4251820 AATGAAGGAAGGAAGGAGAAAGG + Intergenic
1091924775 12:4336609-4336631 AATGGAGGGAGGAAGGAAAGAGG + Intronic
1091937720 12:4446356-4446378 TGTGGAGGGAAGGAGGGCAAGGG + Intergenic
1091941225 12:4484465-4484487 AAGAAAGGGAAGAAGGAGAAAGG + Intergenic
1092041208 12:5386203-5386225 CATAAATGGAAGAAGGAGAAAGG - Intergenic
1092196402 12:6552184-6552206 GATGGAGGGAAGGGGAAGAAAGG - Intronic
1092246815 12:6868358-6868380 GGTGGAGGGAGGAAGGAGGATGG - Intronic
1092281475 12:7101118-7101140 GAGGGAGGGAAGAAGGAGGGAGG - Intronic
1092982148 12:13807429-13807451 CAGGGAGGTGAGAAGGAGAAGGG - Intronic
1093641557 12:21533170-21533192 TATAGAGGCAAAAAAGAGAAGGG - Intronic
1093710888 12:22328704-22328726 TGGGAAGGGAAGAAGGAGTAAGG + Intronic
1093746354 12:22745782-22745804 AATGGGGAGAAGAAGGAGAGAGG - Intergenic
1093952438 12:25178885-25178907 TATAGAAGGAAGGAGAAGAAAGG - Intronic
1094083798 12:26566327-26566349 GAGGGAGAGGAGAAGGAGAAGGG + Intronic
1094200276 12:27788015-27788037 TAGGAAGGGGAGAAGGGGAAAGG - Intronic
1094203581 12:27817386-27817408 AAGGGAGGGAAGAAGAAGGAGGG - Intergenic
1094224088 12:28026388-28026410 TGTGGAGGGCAGATGGAGAAGGG - Intergenic
1094292579 12:28868752-28868774 CATGGACGTAAGGAGGAGAACGG - Intergenic
1094657102 12:32430903-32430925 AAAGAAGGGAAGGAGGAGAAGGG + Intronic
1095223410 12:39647554-39647576 GATGGAGAGAAGCAGGAGTAGGG + Intronic
1095276933 12:40296933-40296955 GCTGGAGGGTAGAAGGAAAAAGG - Intronic
1095298477 12:40554748-40554770 TATGAAGGCAAGATGGATAAAGG - Intronic
1095528555 12:43157446-43157468 AATGGAGGGAAGGTGGAGCAGGG + Intergenic
1095945583 12:47751522-47751544 TATGGAAGGTAGAAGGGGACAGG + Intronic
1096630852 12:52925921-52925943 TAGGGGAGGAAGGAGGAGAAAGG + Intronic
1096668671 12:53184497-53184519 TGTTGAGGGAGGAAGGAGGAAGG + Intronic
1096755258 12:53794105-53794127 TTGGGAGGGAAGAAAGGGAATGG - Intergenic
1096803547 12:54126952-54126974 TTTTGAGGGGAGATGGAGAAGGG + Intergenic
1096806270 12:54143041-54143063 CAAGGAAGGAAGAAGGAGGATGG + Intergenic
1096965164 12:55620457-55620479 TATGGATGAAGGAAGAAGAAAGG + Intergenic
1097039492 12:56146943-56146965 TATGTAGGGAAGAGGGGAAATGG - Intergenic
1097599579 12:61673999-61674021 AATGGAGGGCTGAAGGAGGAAGG + Intergenic
1097723561 12:63049724-63049746 TGTGTAGGTAAGAATGAGAAAGG - Intergenic
1097945942 12:65367451-65367473 TATACAGTTAAGAAGGAGAAAGG + Intronic
1098167241 12:67711024-67711046 TATGTAGGCAAGAATGTGAAAGG + Intergenic
1098251797 12:68577826-68577848 TTTGGAGGGAGGAGGGACAAGGG - Intergenic
1098566203 12:71939245-71939267 TATGGAGAGAAGAGGAAGACTGG - Intronic
1098640598 12:72834618-72834640 TCTTGAGCGAAAAAGGAGAAGGG + Intergenic
1098743411 12:74203892-74203914 TATTGAGGGAAAAGAGAGAAAGG + Intergenic
1098802410 12:74978375-74978397 AATGAAGGAAGGAAGGAGAAGGG + Intergenic
1099438154 12:82668294-82668316 GAGGGAGGGAGGAAGAAGAAAGG - Intergenic
1099950378 12:89295367-89295389 GAAGGAGGGAAGAGGGAGAGTGG + Intergenic
1100236742 12:92669238-92669260 GAGGGAGGGGAAAAGGAGAATGG + Intergenic
1100563129 12:95769070-95769092 TCTGCAGGGAAGAAAGAGAGCGG + Intronic
1100891431 12:99130575-99130597 TAGAGAGGGAAGAAGGACACAGG - Intronic
1101310532 12:103574881-103574903 GAAGGAGGGAAGGAGGAGAGAGG - Intergenic
1101560461 12:105852974-105852996 TATGTAGGGAATAGGAAGAAGGG + Intergenic
1102241536 12:111327635-111327657 TAAGCAGAGAAGATGGAGAATGG + Intronic
1102249510 12:111376616-111376638 GACGGAGGGAGGAAGGAAAAGGG + Intergenic
1102590919 12:113956215-113956237 AAAGGAGGGAGGAAGAAGAAAGG + Intronic
1102625636 12:114233265-114233287 TTTGGAAGGGAGAAGGGGAAGGG - Intergenic
1102664615 12:114560632-114560654 TCTGGAGTGAAGTACGAGAATGG - Intergenic
1102745191 12:115243846-115243868 GAGGGAAGGAAGGAGGAGAAGGG + Intergenic
1102764761 12:115423062-115423084 GAGGGAGGAAAGAGGGAGAAAGG + Intergenic
1102888337 12:116538462-116538484 TATGGAGGCAACCAGGAAAAAGG - Intergenic
1102906589 12:116680759-116680781 GCTAGAGGGAGGAAGGAGAATGG + Intergenic
1102992046 12:117322489-117322511 GAGGGAGGGAAGAAGGAGAGAGG - Intronic
1103191408 12:119005117-119005139 TCTGGGGGAAAGGAGGAGAAGGG + Intronic
1104004619 12:124883236-124883258 GAGGGAGGGAGGAAGGAGGAAGG + Intergenic
1104082139 12:125438661-125438683 GAAGGAAGGAAGAAGGAGGAAGG - Intronic
1104189057 12:126460171-126460193 TAAGGATGGGTGAAGGAGAAGGG + Intergenic
1104374415 12:128251105-128251127 AATGGAGGGAAGGAGGACAGAGG + Intergenic
1104451666 12:128874013-128874035 GAGGGAGGGAGGAAGGGGAAGGG - Intronic
1104917021 12:132270959-132270981 AAAGGAGGGAAGGAGGAGACAGG + Intronic
1105273933 13:18903986-18904008 GATGGAGGGCAAAAGGAGGATGG - Intergenic
1105280961 13:18962383-18962405 TGTGGAGGGAAGGAGGAGGTGGG - Intergenic
1105290158 13:19048395-19048417 TGTGGAGGGAAGGAGGAGATGGG - Intergenic
1105437071 13:20388605-20388627 AAAGGAGGGAAGAAGCAGAGAGG - Intergenic
1105483580 13:20803509-20803531 TTGGGAGTGAAGATGGAGAAAGG - Intronic
1105806692 13:23955613-23955635 GATGGAGGGAGGAAAGAGAGTGG + Intergenic
1105932159 13:25062746-25062768 CATGAGGGGAAGAAGGAGAATGG + Intergenic
1106220080 13:27739468-27739490 TATGGAAGAAAGAAGGAGAATGG - Intergenic
1106356229 13:28986168-28986190 GATGGGGGCAGGAAGGAGAATGG + Intronic
1106584142 13:31042863-31042885 TGTGGAGGGTGGAAGGAGAGTGG + Intergenic
1106667245 13:31864659-31864681 TAGTGATGGAAAAAGGAGAATGG + Intergenic
1107119735 13:36783123-36783145 GAGGGAGGGAAGGAGGAAAAAGG + Intergenic
1107518185 13:41152328-41152350 TTTGGTGGGAAGAAGGTTAAGGG + Intergenic
1107986079 13:45777404-45777426 TATTGAGATAAGAAAGAGAAAGG - Exonic
1108297562 13:49039419-49039441 TCTGGAGTGAGGAAGGACAAAGG - Intronic
1108506615 13:51118187-51118209 TGTGGAGTTAGGAAGGAGAAGGG + Intergenic
1108519628 13:51234655-51234677 GATGGAAGGAAGGAGGAGGAAGG + Intronic
1109284263 13:60393740-60393762 TATATAGGTAAGAAAGAGAAAGG - Intergenic
1109714099 13:66198381-66198403 TATGGATGGAAAAATGAGAAGGG + Intergenic
1110746708 13:79062486-79062508 TCTGGAGGGGAGTAGGAAAATGG + Intergenic
1111239148 13:85451892-85451914 TCTAGAGGGGAGAGGGAGAAAGG - Intergenic
1111319185 13:86603067-86603089 TATGGAGAGAAGAAGAGGGAGGG - Intergenic
1111444603 13:88330827-88330849 GAGGGAAAGAAGAAGGAGAAGGG - Intergenic
1111446195 13:88348125-88348147 GAAGGAGGGAAGAAGGAGGGAGG + Intergenic
1112187342 13:97139997-97140019 TATGGAAGAAAGCAGAAGAAGGG - Intergenic
1112365914 13:98755313-98755335 TATGGAGACAAAAAGAAGAACGG - Intergenic
1112782962 13:102922128-102922150 TAAGGAGGGAAAAGGTAGAATGG + Intergenic
1112833116 13:103478080-103478102 TATGATGGGAGGAAGGAGAGAGG + Intergenic
1113303870 13:109054954-109054976 AAAGGAGGGAGGAAGGGGAAGGG - Intronic
1113352688 13:109544804-109544826 GAATGAGGGAAGAAGTAGAATGG + Intergenic
1113375190 13:109758924-109758946 GAAGGAGGGAGGAAGGGGAAAGG + Intronic
1113428624 13:110230512-110230534 TATAAAGGGAAGAAGGGTAAAGG + Intronic
1113680687 13:112242234-112242256 GATGGAGGGAAGGAGGAAGAAGG + Intergenic
1113755890 13:112810558-112810580 GAGAGAGGGAAGGAGGAGAAAGG - Intronic
1114412389 14:22513313-22513335 TATGGAGGGTGGAAGGAGAGGGG - Intergenic
1114639784 14:24211814-24211836 TCCTCAGGGAAGAAGGAGAAAGG - Exonic
1114653495 14:24301724-24301746 TAAGGAGGGAAGTAGGAGGATGG + Intronic
1114911147 14:27199450-27199472 AAGGGAGTGAGGAAGGAGAAAGG - Intergenic
1115828343 14:37303637-37303659 TATTAAGGGAAGAATGGGAATGG + Intronic
1116095048 14:40356986-40357008 AATGGAGGGAAGAAAGTGGAGGG + Intergenic
1116133321 14:40889248-40889270 AAGGGAGGGAAGAAGGAGGGAGG + Intergenic
1116171677 14:41410279-41410301 TATGGAGGTTAGAAGGAAAGGGG - Intergenic
1116378876 14:44239741-44239763 AAGGAAGGGAAGAAGGAGAGAGG - Intergenic
1116635187 14:47385729-47385751 TTTGGAGGAAAGAAGGAAATGGG + Intronic
1116805405 14:49489548-49489570 GCAGGAGGGAAGAAAGAGAAAGG + Intergenic
1116810276 14:49533493-49533515 GGTGGAGGGAGGGAGGAGAATGG - Intergenic
1117432728 14:55685503-55685525 TAGGGAGGGCAGAAGGATAGCGG - Intronic
1117530261 14:56654107-56654129 TCTGGAGGGTTGAAGGAGAGGGG - Intronic
1117551453 14:56840851-56840873 TATGTAGGGATGAAGAGGAAGGG + Intergenic
1117723842 14:58652866-58652888 GAGGGAGGGAGGAAGGAGAGAGG - Intergenic
1118062004 14:62149799-62149821 TTTGGAGGGAAGAATGGGAGGGG + Intergenic
1118145851 14:63135756-63135778 AAAGGAGGGGGGAAGGAGAAGGG + Intergenic
1118507451 14:66428991-66429013 TGTGGAGAGAAGCAGGAAAAAGG + Intergenic
1118800634 14:69186316-69186338 TAAGCAAGGAAGAAGGGGAAGGG + Intergenic
1119263009 14:73249208-73249230 TATGGAGAGAATAATGTGAAAGG - Intronic
1119476635 14:74934310-74934332 TCTAGGGGGAAGAAGGGGAAGGG + Intergenic
1119567187 14:75638665-75638687 GAGGGATGGGAGAAGGAGAAAGG + Intronic
1119726163 14:76922939-76922961 ATAGGAGGGAAGAAGGAGGAGGG - Intergenic
1119798477 14:77421104-77421126 TTTGGAGGGAAAAAGAAAAATGG - Intronic
1120062974 14:80006235-80006257 TATTGTAGGAAGTAGGAGAAAGG - Intergenic
1120446511 14:84604232-84604254 TATGCAGGGCACAAGGAGAAGGG + Intergenic
1120768931 14:88357850-88357872 TATGGAGGGAGGGAGGTGATTGG + Intergenic
1120906009 14:89622006-89622028 GATGGAGCGGTGAAGGAGAAAGG - Intergenic
1121624668 14:95375171-95375193 GAGGGAGGAAAGAAGGAAAAGGG - Intergenic
1121684268 14:95821392-95821414 TCTGGAGGGAAGAAAGAACATGG + Intergenic
1121832727 14:97065988-97066010 GAGGGAGGGAGGAAGGAAAACGG - Intergenic
1122098959 14:99392136-99392158 TATCGGGGGAAAAAGGAAAAAGG - Intergenic
1122287095 14:100658554-100658576 CATGGAGGGGAGGAGGAGCATGG + Intergenic
1122290838 14:100679675-100679697 GGTGGAGGGAGGAGGGAGAATGG - Intergenic
1122316493 14:100828516-100828538 TATGGAGGGAGGAAGGAGGGGGG - Intergenic
1122948571 14:105027074-105027096 AAGGGAGGGAGGAAGGAGGAAGG + Intergenic
1124052144 15:26207114-26207136 TATATAGGGAAGCATGAGAAAGG + Intergenic
1124609417 15:31198132-31198154 TAGGGATAGAAGAAGGAGAAGGG - Intergenic
1124991649 15:34680267-34680289 GAGGAAGGGAAGAAGGAAAAAGG + Intergenic
1125248358 15:37670061-37670083 TATGGAGGGTAGAATGAGGTTGG - Intergenic
1125319279 15:38466311-38466333 AATGGGAGGAAGATGGAGAATGG - Intronic
1125421759 15:39511297-39511319 GATGGAAGGAAGGAGGAAAAGGG + Intergenic
1125532756 15:40424270-40424292 GAAGGAGGGAAGCAGCAGAAGGG - Intronic
1126154990 15:45557684-45557706 GATGGAGGGGACAATGAGAAAGG - Intergenic
1126351409 15:47748555-47748577 TGAAGAGGGAAGAATGAGAAAGG + Intronic
1126377141 15:48007753-48007775 GAAGGAGGGACAAAGGAGAAAGG + Intergenic
1126966628 15:54061796-54061818 TAAGGAGAAAAGAAGGAAAAGGG + Intronic
1127063227 15:55208939-55208961 TGAGGAGGTAGGAAGGAGAATGG + Intronic
1127161932 15:56197661-56197683 GAAGGATGGAAGAAAGAGAAGGG + Intronic
1127191553 15:56536707-56536729 TTTAGAGGGATGAAGCAGAAAGG + Intergenic
1127581550 15:60343410-60343432 TGTGGAGGGAAGGAGGTGATTGG - Intergenic
1128485706 15:68085371-68085393 TAGGTGGGGAAAAAGGAGAAAGG + Intronic
1128806462 15:70534542-70534564 TGCGGAGGGAACAAGGAGCAGGG + Intergenic
1129162573 15:73754749-73754771 TTTGGAGGGTAGAAGGTGACAGG + Intergenic
1129317875 15:74756797-74756819 ATTGAAGGGAACAAGGAGAAAGG + Intergenic
1129931469 15:79414613-79414635 TATGGAGATAAGAATGAGGATGG + Intronic
1130108492 15:80946534-80946556 GATGGAGGAAGGAAGGAGAAAGG - Intronic
1130746830 15:86663354-86663376 GAGTGAGGGAAGAAGGAGAAAGG - Intronic
1130771898 15:86932704-86932726 TAAGCAGTGAAGCAGGAGAATGG - Intronic
1130915711 15:88303038-88303060 TAAGGAGGGAAGAAGCTGCAAGG - Intergenic
1130915822 15:88303739-88303761 GCTGGGGGGAGGAAGGAGAAAGG - Intergenic
1131035650 15:89220433-89220455 TATGGAGCTAAGAAAGAGAAGGG - Intronic
1131115226 15:89791226-89791248 TATAGAGGGAAGAAGGACCAAGG - Intronic
1131348937 15:91678813-91678835 CATGGGAGGAAGAAGGAAAATGG - Intergenic
1131478446 15:92761847-92761869 GATGGAGAGAAGAAAGAGACAGG - Intronic
1131683139 15:94744883-94744905 GAGGGAGGGAGGAAGGAGAAGGG + Intergenic
1131689312 15:94809416-94809438 AAAGGAAGGAAGAGGGAGAAGGG + Intergenic
1132024411 15:98392640-98392662 TATAGAGGGGAGTTGGAGAAAGG - Intergenic
1132030883 15:98437854-98437876 GATGGATGGAAGATGGAGGATGG + Exonic
1132484831 16:185409-185431 GAGGGAGGGAGGAGGGAGAAAGG + Intergenic
1132942954 16:2517350-2517372 TATAGAGGGAGGAAGGAGGCTGG - Intronic
1133446330 16:5864049-5864071 TCTGGAGGGTGGAAGGTGAAAGG - Intergenic
1133543926 16:6786613-6786635 TATGAAGGGGATGAGGAGAATGG + Intronic
1133766218 16:8839864-8839886 TATGGGGGGAGAAAGGAGAAAGG + Intronic
1133839258 16:9394026-9394048 GAGGGAGGGAAGAAGGGGGATGG - Intergenic
1134024916 16:10946219-10946241 TATGGTGGGAAGTAGTGGAAGGG + Intronic
1134272872 16:12749342-12749364 TATGGAATGAAGAAAGAGAGTGG - Intronic
1134616285 16:15653502-15653524 TATGGAGTGGGGATGGAGAAGGG + Intronic
1134859319 16:17547018-17547040 TATGGAGGAAAGAAAGAGACAGG + Intergenic
1135234558 16:20743043-20743065 TCGGGAGGGAGGCAGGAGAATGG - Intronic
1135252145 16:20909560-20909582 GATGTAGTGAAGAAGGAAAAGGG + Intronic
1135358830 16:21793615-21793637 GAAGGAAGGAAGAAGGGGAAGGG + Intergenic
1135457386 16:22610051-22610073 GAAGGAAGGAAGAAGGGGAAGGG + Intergenic
1135471141 16:22732271-22732293 AAGGGAGGGAAGAAGGAAAGCGG - Intergenic
1135529086 16:23237251-23237273 AAGGTAGGAAAGAAGGAGAAGGG - Intergenic
1135838461 16:25850833-25850855 TAAGGAGGGAACAGGGAGTATGG + Intronic
1136920519 16:34267532-34267554 AAGGGAGGGCAGAGGGAGAATGG - Intergenic
1137466273 16:48712715-48712737 TATGGAGAGAAAAAGGAAAGTGG - Intergenic
1137517833 16:49164012-49164034 AATGGAAGGAAGACAGAGAAAGG - Intergenic
1137541281 16:49363706-49363728 TATTCATGGTAGAAGGAGAAGGG - Intergenic
1137854539 16:51780723-51780745 ACAGGAGAGAAGAAGGAGAAGGG - Intergenic
1137983903 16:53091804-53091826 GAGGGAGGGAGGAAGGAGAGAGG - Intronic
1138239569 16:55416298-55416320 TTTGGAGGGGACAAGGAGCAAGG - Intronic
1138486682 16:57349772-57349794 AAAGGAGGGAAGAAGGAGGCAGG - Intergenic
1138506251 16:57479785-57479807 GAGGGAGGGAAGAGGGAGAGAGG - Intronic
1138766798 16:59614728-59614750 TATGGAGGGAAGAAACTGGAAGG + Intergenic
1138898725 16:61242659-61242681 TATAGAGGGAAGAAAAAGACAGG - Intergenic
1139984053 16:70883143-70883165 TATGGAGGGAAGGAGGCAACTGG + Intronic
1140132431 16:72175309-72175331 TTTGGAGAGAGGAAGGAAAAGGG + Intronic
1140270727 16:73464344-73464366 TCTGGAGGGAAGATGGGGGAGGG + Intergenic
1141236362 16:82221455-82221477 TGGGGAGGGAAGGAGGAAAAGGG - Intergenic
1141713938 16:85716362-85716384 AAGGGAGGGAAGGAGGAGAGAGG + Intronic
1141734668 16:85844252-85844274 GAAGGAAGGAAGAAGGAGGAAGG - Intergenic
1141753520 16:85975692-85975714 TATAGAGGTTAGAAGGAGGAAGG - Intergenic
1142964688 17:3573279-3573301 CCTGGAGGGAAGAAGGGGGAGGG - Intronic
1143021289 17:3918222-3918244 AAGGGAGGGAGGGAGGAGAAAGG + Intergenic
1143141391 17:4743693-4743715 TTTGGAAGGAAGAAAGAGATGGG + Intronic
1143364381 17:6396317-6396339 CAGAGAAGGAAGAAGGAGAAAGG + Intronic
1143702090 17:8668225-8668247 AATGGAGAGAAGATGGTGAAAGG - Intergenic
1143846719 17:9777727-9777749 TATGGAAGGAAGAAGGAAGAAGG + Intronic
1143861891 17:9897261-9897283 GCTGGAGGGTAGAAGGAGGAGGG - Exonic
1144197145 17:12905473-12905495 TTTGGAGGGAGGATGGAGAGGGG - Intronic
1144314488 17:14046926-14046948 TATGGCTGGAAAAAGGACAAAGG - Intergenic
1144436775 17:15249538-15249560 TAGAGAGGGTGGAAGGAGAATGG + Intronic
1144561006 17:16320283-16320305 GAGGGAGGGAGGAAGGGGAAGGG + Intronic
1145004629 17:19330384-19330406 TAGGGAGGGATAAAAGAGAAGGG - Intronic
1145272046 17:21410023-21410045 TGTGGAGGGGAGAGGGAGAGTGG - Intronic
1145310255 17:21697486-21697508 TGTGGAGGGGAGAGGGAGAGTGG - Intronic
1146123726 17:30216265-30216287 AGGGGAGGGGAGAAGGAGAAGGG + Intronic
1146637822 17:34519093-34519115 AATGGAGGCTAGAAGGAGGAGGG + Intergenic
1147261325 17:39211059-39211081 CCTGGAGAGAAGCAGGAGAAAGG + Exonic
1147273146 17:39291354-39291376 TAGGGAGGGAGGGAGGAGAGAGG + Intronic
1147303979 17:39550586-39550608 TATGGAGAGACGGAGGAGAAGGG + Intronic
1147528696 17:41253029-41253051 CATGAAGGAAGGAAGGAGAAGGG + Intronic
1147638414 17:41978477-41978499 GTTGGAGGGAGTAAGGAGAATGG - Intronic
1147688744 17:42302430-42302452 TAGGGAGGGAAGTAGCAGAGAGG + Intronic
1148180714 17:45602612-45602634 GAAGGAGGGAAGAAGGGAAAGGG - Intergenic
1148268189 17:46243314-46243336 GAAGGAGGGAAGAAGGGAAAGGG + Intergenic
1148391497 17:47276143-47276165 AAAGGAGGGAAGGAGGAAAAGGG - Intronic
1148518227 17:48242400-48242422 TTTGCAGTAAAGAAGGAGAATGG - Intronic
1148529808 17:48378833-48378855 AATGGAGGTAAGAAGCAGGAAGG + Intronic
1148552782 17:48560512-48560534 GAAGGAGGGAAGAAGAAGATGGG - Intronic
1148873885 17:50675333-50675355 TAGGGTGGGAGGAAGGAGATAGG - Intronic
1148889063 17:50794659-50794681 CCTGGAGAGAACAAGGAGAATGG - Intergenic
1149005761 17:51803422-51803444 TTTGGAGAGAAGAGGGAGTAAGG - Intronic
1149083284 17:52683946-52683968 TGTGGAAGTAAGAAAGAGAAAGG - Intergenic
1149114161 17:53071707-53071729 TAAGGAAGGAAGAAGGAAGAAGG + Intergenic
1149430597 17:56593591-56593613 TTTGGGGGGAAGAAGGGGGAGGG + Intergenic
1149518833 17:57302995-57303017 TAGGGAGGGATGAGGGAAAAAGG + Intronic
1149828064 17:59847754-59847776 CATGGAGGGAACATGGAGATGGG - Intergenic
1150491762 17:65579162-65579184 TATGCAGTGAGGAAGAAGAATGG - Intronic
1150860038 17:68791767-68791789 TGGGGAGGGAGGAAGGGGAAAGG + Intergenic
1150977811 17:70108781-70108803 AAGGGAGGGAGGAAGGTGAATGG - Intronic
1151050975 17:70978472-70978494 GAAGGAGGGAAGAAGGTGGAGGG + Intergenic
1151100504 17:71550804-71550826 GAGGGAGGGAAGGAGGGGAAAGG + Intergenic
1151250476 17:72830024-72830046 TATGCAGGAAGGAAGGAGAGAGG + Intronic
1151345824 17:73500618-73500640 AATAGAGGGAAGATGGAGAGAGG - Intronic
1151469022 17:74306334-74306356 GATGAAGGGGAGGAGGAGAAAGG - Intronic
1151548481 17:74807634-74807656 TTTGGGGGGCAGAAGTAGAAGGG + Intronic
1151606808 17:75142649-75142671 GATGGAGGGAAGGGGGAGGAAGG + Intronic
1151783140 17:76260940-76260962 TGTTGAGAGGAGAAGGAGAATGG - Intergenic
1151991347 17:77576864-77576886 AATGGAGGGAAGGAGAAGAAAGG - Intergenic
1152040921 17:77902203-77902225 TATGGAGGGAGGGAGGTGATTGG + Intergenic
1152187077 17:78864266-78864288 GAGGGAGGGAAGAAGAAGGAAGG - Intronic
1152250950 17:79212309-79212331 TGGGGAGGGGAGGAGGAGAAAGG - Intronic
1152373159 17:79903112-79903134 GAGGGAGGGAAGAAAGAGAGAGG - Intergenic
1152524451 17:80879503-80879525 CAGTGAGGGAAGAAGGGGAAGGG - Intronic
1153216208 18:2823358-2823380 GAAGGAAGGAAGAAAGAGAAGGG - Intergenic
1153711386 18:7803073-7803095 TATGGTGGGAGGATGGGGAAAGG + Intronic
1153732223 18:8025934-8025956 CAGGGAGAGCAGAAGGAGAAAGG + Intronic
1153777421 18:8466321-8466343 AAAGGAGGGAGGGAGGAGAAAGG + Intergenic
1154359506 18:13647597-13647619 TACAGAGGTAAGAAGCAGAAGGG - Exonic
1154465600 18:14641039-14641061 GATGGAGGGCAAAAGGAGGATGG - Intergenic
1155011991 18:21788017-21788039 TATGGAGAGTAAAAGGAGAGAGG - Intronic
1155161991 18:23203585-23203607 TTTGGAGGGAAAAAGGGGATGGG + Intronic
1155490407 18:26395756-26395778 TGGGGAGGCTAGAAGGAGAAAGG + Intergenic
1155562993 18:27100484-27100506 TATGGAAGGAAGAATAAGAGTGG + Intronic
1155797399 18:30057675-30057697 AAGGAAGGAAAGAAGGAGAAGGG - Intergenic
1155932486 18:31722256-31722278 TATAGAAGGAGGAAGGAGCAAGG + Intergenic
1156266893 18:35497500-35497522 TAAGGAGAGAAGAAGAAGTAGGG - Intronic
1156493823 18:37512730-37512752 GCAGGAGGGAAGAAGGAGAAAGG - Intronic
1156881956 18:42091519-42091541 TATGGAGGAAAGAACTGGAAGGG + Intergenic
1156908684 18:42385068-42385090 GATGGAGGGAAGAAAGAGGAAGG - Intergenic
1157145318 18:45156767-45156789 TATGGAAGGAAGAAAAAGAGGGG - Intergenic
1157409302 18:47450323-47450345 AATGGAGGGAAGGAATAGAAGGG - Intergenic
1157636613 18:49162830-49162852 GTTGGAGGGAAGAAGAGGAAGGG + Intronic
1157690308 18:49676556-49676578 CATAGAGTTAAGAAGGAGAAAGG + Intergenic
1157877993 18:51291565-51291587 TATGAAGGAAAGAAAGAGGAAGG - Intergenic
1157884737 18:51355749-51355771 TCTGGATGAAAGAAGGAGATTGG - Intergenic
1158067783 18:53433804-53433826 TATGTAAGGAAGTAGGAGATAGG - Intronic
1158220937 18:55149986-55150008 TGTGGATGGGAGAAGGAGGAGGG + Intergenic
1158275297 18:55760519-55760541 AATGGAAAGAAGAAGGAGGAGGG - Intergenic
1158367118 18:56748939-56748961 GAAGGAAGGAAGAAGGAGAAAGG - Intronic
1158605798 18:58895039-58895061 TAAGGGGAAAAGAAGGAGAATGG - Intronic
1158880913 18:61778977-61778999 TGAGGAGGGAAGAAAGGGAAGGG + Intergenic
1159537838 18:69737424-69737446 TGTGGAGGGAGGGAGGTGAATGG - Intronic
1159935345 18:74361290-74361312 TAGGGAGGGAGGAAGGAGGACGG + Intergenic
1160018339 18:75161238-75161260 TTTTAAGGGAAGAAAGAGAAAGG + Intergenic
1160117213 18:76090513-76090535 CATGGAGGAAGGAAAGAGAATGG - Intergenic
1160173542 18:76573681-76573703 GATTGAGGGAAGCAGAAGAAAGG + Intergenic
1160394981 18:78564317-78564339 TAGGGAGGGGAGGAGGAGAAGGG - Intergenic
1161122878 19:2539838-2539860 GAGGGAGGCAGGAAGGAGAAAGG - Intronic
1161494501 19:4580160-4580182 TAAGGAGGGAGGAGGGAGAGAGG - Intergenic
1161777073 19:6269441-6269463 TAGAGAGGGAGGAAGGAAAAGGG + Intronic
1162026316 19:7895875-7895897 TATGGAGGTAAGGAAGATAAGGG - Intronic
1162791429 19:13065084-13065106 AATGGAGGGTAGGAGGAGGAAGG - Intronic
1162863667 19:13527269-13527291 GATGAAGGAAGGAAGGAGAAAGG - Intronic
1162875603 19:13618867-13618889 GAGGGAGGGAGGAAGGAGAAGGG + Intronic
1162875644 19:13618999-13619021 GAGGGAGGGAGGAAGGAGAAGGG + Intronic
1162875650 19:13619017-13619039 AAGGGAGGGAGGAAGGAGAAGGG + Intronic
1163178277 19:15581005-15581027 GATGGAGGGAAGGAGGGAAAAGG - Intergenic
1163548041 19:17950872-17950894 TGTGGAGGGAAAAAGAACAAAGG - Intergenic
1164250267 19:23469575-23469597 AAAGGAGGAGAGAAGGAGAATGG - Intergenic
1164404544 19:27932349-27932371 GATGAAGAGAAGAAGGAGGAAGG - Intergenic
1164684097 19:30155867-30155889 TATGGGGGTTAGAAGGAGAAAGG + Intergenic
1164816023 19:31204130-31204152 TGTGGAGGGAAGGAGGTGATTGG - Intergenic
1164834601 19:31349422-31349444 TGCGGAGGGAAGAAGGAGGGCGG + Exonic
1165330958 19:35141039-35141061 GAAGGAGGGAACAGGGAGAAAGG - Intronic
1166128877 19:40733493-40733515 TATGGAGGTAAGAAAGAGGCTGG - Intronic
1166990641 19:46690557-46690579 CATGAAAGGAAGAAGCAGAAAGG + Intronic
1167040781 19:47021394-47021416 TCTGGTGGGAAGGAGGAGGAAGG - Intronic
1167256244 19:48431202-48431224 GATGAAGGGATGAAGGTGAAAGG - Intronic
1167485884 19:49762815-49762837 TGGGGAGGGAAGAAGGAGAAGGG - Intronic
1167621617 19:50563962-50563984 GATGGGGGGATGAAGGAGGAGGG + Intronic
1167674402 19:50875471-50875493 TGAGGAGGGAGGAAGGAGAAGGG + Intronic
1167708231 19:51094405-51094427 GATTGAGGGAAAAAGGAGAGGGG - Intergenic
1167741400 19:51326740-51326762 TGTGGGGGGAAGGAGGAGGAGGG - Intronic
1168143918 19:54408592-54408614 GAAGGAGGAAGGAAGGAGAAAGG + Intergenic
1168433797 19:56302287-56302309 AAAAGAGGGAAGAAGGAGAGAGG - Intronic
1168501906 19:56899956-56899978 AAGGGAAGGAGGAAGGAGAAGGG + Intergenic
1202697376 1_KI270712v1_random:134947-134969 GAGGGAGGGAAGAGGAAGAAAGG - Intergenic
925128879 2:1480708-1480730 TTTGGACGGATGAAGGAGGAGGG - Intronic
925445570 2:3923990-3924012 GATGGAGGGAAGGAGAAGAGAGG - Intergenic
925653106 2:6113472-6113494 TTTGCAGGGAAGAATGAGTAAGG - Intergenic
925791090 2:7488793-7488815 GAAGGAGGAAGGAAGGAGAAAGG + Intergenic
925791160 2:7489037-7489059 GAAGGAGGAAGGAAGGAGAAAGG + Intergenic
925791196 2:7489157-7489179 GAAGGAGGAAGGAAGGAGAAAGG + Intergenic
925927996 2:8684570-8684592 GGTGGGGGGATGAAGGAGAAGGG - Intergenic
926148158 2:10409481-10409503 TTTGGAGGAAAGAAGGACACAGG + Intronic
926197603 2:10773146-10773168 TCAGGAGGGATGAAGGGGAAAGG + Intronic
926428288 2:12759774-12759796 TTTGGAGGGATGAAGGGCAAAGG + Intergenic
926449004 2:12979747-12979769 TGTGTTGGGAAGAGGGAGAAAGG - Intergenic
926542881 2:14203242-14203264 GAGGGAGGGAATAAGGAAAAAGG + Intergenic
926553218 2:14325615-14325637 AAGGGAGGAAAGAAGGAGAAGGG + Intergenic
926640081 2:15225859-15225881 GATGAAGGCAAGAAGTAGAAAGG + Intronic
926747567 2:16171527-16171549 TAAGGAGGAAAGTGGGAGAAAGG + Intergenic
926926936 2:17996421-17996443 TAAGGATGGAAGAAGGAGAGAGG + Intronic
926962766 2:18376942-18376964 TTGGCTGGGAAGAAGGAGAAAGG - Intergenic
927008222 2:18873862-18873884 AATGCAGGAAAGAAGGAAAAAGG + Intergenic
927352489 2:22133721-22133743 AATGTAAGGAAGAAAGAGAAAGG - Intergenic
927791748 2:26015611-26015633 CCTGGAGGAAAGAAGGGGAAGGG + Intergenic
928044238 2:27911414-27911436 TAGGGAGGGAAGAAAGAAAGGGG + Intronic
928121900 2:28589898-28589920 CAGGGAGGGATGAAGGAGATGGG - Intronic
928426622 2:31183827-31183849 GAGGGAGGGAAGAAGGAGAGAGG - Intronic
928789220 2:34931422-34931444 TAAGGAAGGAAGCAGGTGAACGG + Intergenic
928921663 2:36534103-36534125 GAGGGAGGGAAGGAGGGGAAAGG + Intronic
929052402 2:37849211-37849233 AAGTGGGGGAAGAAGGAGAAGGG - Intergenic
929362151 2:41104531-41104553 AAGGGAAGGAAGAAGGAGAAGGG + Intergenic
929448968 2:42023987-42024009 GAGGGAGGGAAGAAGGAAGATGG + Intergenic
929792385 2:45033125-45033147 GAGGGAGGTGAGAAGGAGAAGGG - Intergenic
929895868 2:45960461-45960483 TGTGGGGGGCAGAAGGGGAAGGG + Intronic
930270843 2:49254763-49254785 TGTTGAGGGGTGAAGGAGAAAGG - Intergenic
930528191 2:52558234-52558256 TATGCATGGCAGAAGGGGAAAGG + Intergenic
930751983 2:54943235-54943257 AAGAGAGGGAAGAAGGTGAATGG - Intronic
930853777 2:55989834-55989856 TATGAAGTGAAGCTGGAGAAAGG - Intergenic
930864573 2:56109802-56109824 CATGGAGGGAAGAATCTGAATGG - Intergenic
930901770 2:56515864-56515886 TATGTGGTGAAGAAGAAGAAAGG + Intergenic
931051574 2:58421135-58421157 GATGGAAGGAAGAAGGAAGAAGG + Intergenic
931239146 2:60437107-60437129 CTTGGAGGGAAGAAGCAGCAAGG + Intergenic
931528721 2:63188279-63188301 AAAGGAGGAAAGAAAGAGAAAGG - Intronic
932231788 2:70089250-70089272 TTTGGAGGGAGGAGGGAGAAGGG + Intergenic
932432965 2:71686432-71686454 TCTGGAGGGAGGGAGGAGACAGG - Exonic
932542608 2:72671842-72671864 AATGGAGGGAGGAAGAAGGAAGG + Intronic
933229168 2:79785978-79786000 AATTGAGGGAAGAAGGAGGTGGG + Intronic
933510407 2:83233894-83233916 TATGGAGAGAAGAAAGAAAAAGG - Intergenic
933632562 2:84673972-84673994 TATAGAGTCAAGAGGGAGAAGGG + Intronic
934278544 2:91591972-91591994 GAGGGAGGGAAGAGGAAGAAAGG - Intergenic
934812348 2:97291262-97291284 AATGGAGGGAAGAAGGTGGGTGG - Intergenic
934825346 2:97416661-97416683 AATGGAGGGAAGAAGGTGGGTGG + Intergenic
935033983 2:99350421-99350443 TATGGTGAGAATATGGAGAAAGG - Intronic
935078045 2:99765284-99765306 TGTGGAGGCTGGAAGGAGAAGGG + Intronic
935162813 2:100543941-100543963 TAGGAAGGGAAAAAGGAAAAAGG - Intergenic
935376863 2:102408853-102408875 TAAGGATGGAAGAAAGAAAAGGG + Intergenic
935553178 2:104479683-104479705 GAAGGAGGGAAGAAGGGGTAGGG + Intergenic
935761095 2:106321478-106321500 TAAGAAGGGAAAAAGGACAAAGG + Intergenic
936687072 2:114840273-114840295 TTTGAAAGGAAGAAGGAGTAAGG + Intronic
937062779 2:118992696-118992718 AAGGAAAGGAAGAAGGAGAAAGG - Intronic
937419247 2:121740816-121740838 GAGGGAGGGAAGGAGGAGAGGGG - Intronic
937453556 2:122022538-122022560 TCTGAAGGGAAGATGGAGTAAGG + Intergenic
937643543 2:124240614-124240636 AATGCAGGAAAGAAGGGGAAGGG - Intronic
937814039 2:126231582-126231604 TGTGGAGGGAAGAAACAGGAAGG - Intergenic
938516102 2:132009367-132009389 TAGGGAGGAAGGAAGGAAAAAGG - Intergenic
938710400 2:133971563-133971585 TATGGGTGGAAAAAGGAGATTGG + Intergenic
938905696 2:135833900-135833922 CATGGAGAGAGGAAGGAGAATGG - Intronic
939054227 2:137343995-137344017 AATGGAGAGAAAAAGGACAATGG + Intronic
939603882 2:144228556-144228578 AAAGGAGAAAAGAAGGAGAATGG + Intronic
939629542 2:144516492-144516514 TCAGGAAGGAGGAAGGAGAAAGG - Intronic
940297206 2:152139662-152139684 TTGGGTGGGAGGAAGGAGAAAGG - Intronic
940692570 2:156937500-156937522 GAGGGAGGGAGGAAGGAGGAAGG + Intergenic
940709711 2:157147010-157147032 TATGGAGGGTACTAGTAGAAAGG + Intergenic
940972383 2:159907574-159907596 TATGAAGGGAGTAAAGAGAAAGG - Intergenic
941168662 2:162110609-162110631 TATGGAGAAAATAAGTAGAAAGG + Intergenic
941203625 2:162544846-162544868 AAGGGAGGGTAGAAGGAAAACGG - Intronic
941268958 2:163401270-163401292 TATGGAGGGTAGAAGGAAGGAGG - Intergenic
941809166 2:169738797-169738819 TTTGGAGGGAAGATGAAGAAAGG - Intronic
942280365 2:174356610-174356632 GAAGGAAGGAAGAAGGGGAAGGG + Intronic
942484945 2:176429043-176429065 TGTGGAGGGAAGGAGGTGAATGG + Intergenic
942611231 2:177744431-177744453 TGTGGAGGGCAGGAAGAGAAAGG + Intronic
942702626 2:178730865-178730887 TTTTAAGGGAAGAAGGAGCATGG + Intronic
942792631 2:179778208-179778230 CATGCAGGGCAGATGGAGAATGG - Intronic
943004549 2:182373672-182373694 AAAGCAGTGAAGAAGGAGAAAGG + Intronic
943152081 2:184126457-184126479 GAAGGAGGCAAGAATGAGAAAGG + Intergenic
943166767 2:184338465-184338487 TATATAAAGAAGAAGGAGAAAGG - Intergenic
943281172 2:185935072-185935094 CATGAAGGGAAGAAGTACAAAGG - Intergenic
943420644 2:187663780-187663802 TCAAGATGGAAGAAGGAGAATGG + Intergenic
944091345 2:195915374-195915396 TAGTGAGTGAAGAAGTAGAATGG + Intronic
944409841 2:199429350-199429372 TATGCATGGAAGAAGGATGAAGG - Intronic
944714016 2:202361107-202361129 TTTGTAGGGGAGAGGGAGAAGGG - Intergenic
945158316 2:206862275-206862297 TATGGAAGCATGGAGGAGAAGGG + Intergenic
945335173 2:208583459-208583481 GATGGAGGGAAGTAACAGAAGGG + Intronic
945338009 2:208615881-208615903 TATGCAGGGAAGAAAGAAACAGG + Intronic
945385591 2:209196086-209196108 AATTGAGAGAAGAAGTAGAAAGG + Intergenic
945399834 2:209367744-209367766 TATGCAGGAAGGAAGCAGAAAGG + Intergenic
945641566 2:212437775-212437797 CATGGAGGAAAGAAACAGAATGG - Intronic
946085030 2:217162260-217162282 GAGGGAGAGAAAAAGGAGAAGGG - Intergenic
946174835 2:217916278-217916300 TCTGGAGGGGAGGAGGTGAATGG - Intronic
946217242 2:218194005-218194027 TAGTGAGGGAGGAAGGGGAATGG - Intergenic
946315277 2:218907275-218907297 AATAGAGGGAAACAGGAGAAGGG + Intergenic
946380621 2:219346267-219346289 AGGGAAGGGAAGAAGGAGAAAGG - Intergenic
946452092 2:219789047-219789069 GAGGAAGGGAAGAAGGAAAAGGG - Intergenic
946524650 2:220505253-220505275 TAAGGAGGGAGGAAGGGGCAGGG + Intergenic
946739398 2:222787150-222787172 TGGGGAGGAGAGAAGGAGAAGGG + Intergenic
947152685 2:227131075-227131097 TAAGAAGGGAAGAAGCAGATTGG - Intronic
947159077 2:227193842-227193864 GAAGGAGAGGAGAAGGAGAAGGG + Intronic
947159094 2:227193909-227193931 GAAGGAGAGGAGAAGGAGAAGGG + Intronic
947159124 2:227194047-227194069 GAAGGAGAGGAGAAGGAGAAGGG + Intronic
947179423 2:227399021-227399043 GAGGGAGGGAAGAAGGAGGCAGG + Intergenic
947340650 2:229135111-229135133 GATGGAGGGAAGAAGTGGAAGGG + Intronic
947361357 2:229348705-229348727 TATGGAGAGAAGGAGGGAAAAGG + Intergenic
947505866 2:230708129-230708151 CATGGAGGGAAACAGGGGAAAGG - Intergenic
947745701 2:232506338-232506360 CAGGGAGAGAAGAAGCAGAAAGG + Intergenic
947808581 2:232985141-232985163 TATACATGGCAGAAGGAGAAAGG - Intronic
947815453 2:233033656-233033678 TATGGAGTGTAGAAGGTGAGAGG + Intronic
947984416 2:234436678-234436700 TATGCAAGGGAGAAGGAGCAGGG - Intergenic
948013096 2:234665556-234665578 AAAGGAAGGAAGAAAGAGAAAGG - Intergenic
948094911 2:235325619-235325641 TGAGAAAGGAAGAAGGAGAAAGG - Intergenic
948225545 2:236306741-236306763 TAATAAGGAAAGAAGGAGAAGGG + Intergenic
948458721 2:238119062-238119084 GATGGATGGAAGAGGGTGAATGG + Intronic
1168816922 20:744183-744205 AATGGAGGGGAGAAAGAGAGTGG - Intergenic
1168944549 20:1741713-1741735 GAGGGAGGGAAAAAGAAGAAAGG - Intergenic
1169178236 20:3538623-3538645 AATGTAGGGAATAAGGAAAAGGG - Intronic
1169182618 20:3583220-3583242 TTTGGAGGGAAGAAGGTCTACGG - Intronic
1169777953 20:9276635-9276657 TATGATGGGAAGAAAGAGCAGGG - Intronic
1169852325 20:10065667-10065689 AATGAAGGGAGGAAGGAAAAAGG + Intergenic
1170394662 20:15913196-15913218 TATGAAGAGAAGAGGGACAATGG - Intronic
1170446994 20:16438683-16438705 TATGGACCAAAGGAGGAGAAAGG - Intronic
1170816725 20:19720490-19720512 TAGGGAGGAGAGAAGGAAAATGG + Intronic
1170938272 20:20827978-20828000 TGAGGAGGGAGGAAGGAGGAAGG + Intergenic
1171354536 20:24534008-24534030 TATTCATGGAAGAAGGTGAAGGG + Intronic
1171369808 20:24654619-24654641 GAGGGAGGGAGGAAGGAGAGAGG + Intronic
1171370924 20:24661493-24661515 GAGGGAGGGAAGAGGGAGGAAGG + Intronic
1171727600 20:28639565-28639587 TTTGTAGGGAGGAAGGGGAAAGG - Intergenic
1172187398 20:33039719-33039741 GTTGGAGGGAGGAAAGAGAAAGG - Intronic
1172628979 20:36365810-36365832 GATGGGAGGAATAAGGAGAAAGG - Intronic
1172807286 20:37621491-37621513 TTTGGGGGGCTGAAGGAGAAGGG - Intergenic
1172864540 20:38085684-38085706 TCTGGAGAGATGAAGGAGAAAGG - Intronic
1173102898 20:40104196-40104218 AATGGAAGGAAGAAGGAGGTGGG - Intergenic
1173144196 20:40510775-40510797 GAAGGAGGGAGGGAGGAGAAAGG + Intergenic
1173144213 20:40510854-40510876 CAGGGAGGAAAGAAGGAGGAAGG + Intergenic
1173218009 20:41105104-41105126 TCTACAGGGAAGAAGGTGAATGG - Intronic
1173533923 20:43794334-43794356 TGAAGAAGGAAGAAGGAGAAAGG + Intergenic
1174081197 20:47971882-47971904 GATGGAGAGAGGGAGGAGAAGGG - Intergenic
1174627607 20:51928220-51928242 GAGAGAGGGAAGAGGGAGAAAGG + Intergenic
1174969868 20:55262953-55262975 AAGGGAGGGAAAAAAGAGAAGGG - Intergenic
1175120265 20:56711128-56711150 GAGGGAGGGGAGGAGGAGAAGGG - Intergenic
1175293725 20:57894829-57894851 GAAGGAAGGAAGAAGGAGGAAGG + Intergenic
1175372249 20:58499788-58499810 TAGGGAGGGAAGCTGGAGAGAGG - Intronic
1175509137 20:59510370-59510392 TATGCAGGGGAGAAGGATGATGG - Intergenic
1175615007 20:60390499-60390521 AATGAAGGGAAGAAGGGGAGAGG - Intergenic
1175692517 20:61075813-61075835 TGAAGGGGGAAGAAGGAGAAGGG + Intergenic
1176808957 21:13517443-13517465 GATGGAGGGCAAAAGGAGGATGG + Intergenic
1176892527 21:14335421-14335443 ATTGGAGGGAAGACAGAGAAAGG + Intergenic
1177047449 21:16187801-16187823 AAAGGAGGAAGGAAGGAGAAAGG - Intergenic
1177410826 21:20728620-20728642 TCTGGAGGGAAGACAGAGATGGG + Intergenic
1178016116 21:28347567-28347589 GAAGGAAGGAAGAAGGAGGAGGG - Intergenic
1178068030 21:28928113-28928135 TAGGGAAAGAAGGAGGAGAATGG + Intergenic
1178084272 21:29096814-29096836 CATGGAGGGAAGTAGAAGAGAGG - Intronic
1178784732 21:35643051-35643073 TAGGGAGAGAAAAAGGAGACAGG - Intronic
1178794089 21:35727518-35727540 TATGGAGGGGAGATGGAGGAGGG - Intronic
1178947571 21:36960632-36960654 TATTGAGAGAAGAAGAAAAATGG - Intronic
1178961640 21:37071988-37072010 GAGGGAGGGAAGAAGTGGAAAGG - Intronic
1179025184 21:37673818-37673840 AGTGGAGGAAAGAAGGGGAAGGG + Intronic
1179028925 21:37703201-37703223 GATGGAGGAAAGAAAGAGGATGG + Intronic
1179116705 21:38499843-38499865 GAGGGAGGAAGGAAGGAGAAAGG + Intronic
1179160550 21:38893508-38893530 TGTGGGGAGAAAAAGGAGAAGGG - Intergenic
1179591261 21:42410235-42410257 TCAGGAGAAAAGAAGGAGAAGGG + Intronic
1179823091 21:43948308-43948330 GAGGGAGGGAAGAACGACAAAGG + Intronic
1180727198 22:17955207-17955229 GAAGGAGTGAAGCAGGAGAAAGG - Intronic
1180998561 22:19977414-19977436 TTTGGAGGCAAGAAGGCCAAAGG - Exonic
1181331395 22:22094862-22094884 GTTGGGGGGAAGAAGGGGAAGGG + Intergenic
1181584305 22:23844771-23844793 TGGGGAGGGAGGAAGCAGAATGG + Intergenic
1181637411 22:24180905-24180927 TCTGGAGGGAGGAAGGAGGAAGG - Intergenic
1181780087 22:25186216-25186238 GATGGAGGGAGGCAGGTGAAGGG + Intronic
1181907336 22:26209769-26209791 GAGGGAGGGAAGAAGGAGGAAGG + Intronic
1181912869 22:26254366-26254388 AAGGGACGGAAGAGGGAGAAGGG + Intronic
1181949986 22:26546859-26546881 TATCAAGGGAAGAGGGTGAAGGG + Intronic
1182074251 22:27484076-27484098 TATGGAGGGAAGGAGGAAGATGG - Intergenic
1182151250 22:28028614-28028636 TAGGAAGGGAAGAAGGATGAGGG + Intronic
1182253196 22:29018302-29018324 TGTGGAGAGAGGAAGGGGAAGGG + Intronic
1182287846 22:29258792-29258814 GCCGGAGGGAAGAAGGAGAGAGG - Intronic
1182649581 22:31840278-31840300 AATGGAGGGCAGGAGTAGAAGGG + Intronic
1182662254 22:31933374-31933396 GTGGGAGGGAAGAAGGAGCAAGG - Intergenic
1182680714 22:32077352-32077374 AAAGGAAGGAAGAAGGGGAAAGG - Intronic
1182755369 22:32674690-32674712 AATGGAGAGAAGAGGGATAATGG + Intronic
1182836012 22:33341921-33341943 GATGGCGGCAGGAAGGAGAAAGG - Intronic
1183007655 22:34916653-34916675 AAGGGAGGGAAGGAGGGGAAGGG + Intergenic
1183159775 22:36104614-36104636 TAAGGAAGTAAGATGGAGAAGGG - Intergenic
1184130123 22:42512655-42512677 TGTGGAGGCAAGAAGCAGGAAGG + Exonic
1184293425 22:43509781-43509803 GAGGGAGGGAAGGAGGAGGAAGG - Intergenic
1184463822 22:44657470-44657492 GATGGAGGGGAGAGAGAGAAGGG + Intergenic
1184588937 22:45467974-45467996 TGTGGAGGGAGGAAGGTGAATGG - Intergenic
1184623160 22:45698693-45698715 TATTGAGGCAGGAAGGAAAATGG + Intronic
1184792474 22:46708591-46708613 TAAGGAGAGGAGATGGAGAAAGG + Intronic
1184984028 22:48117272-48117294 TATGGAAGGAAGAAGGAGAAGGG + Intergenic
1185069664 22:48649095-48649117 TAGGAAGGGAAGAAGGGGAAGGG + Intronic
1185135784 22:49071358-49071380 GAAGGAGAGAAGAGGGAGAAAGG - Intergenic
949165229 3:932547-932569 TATGGAGGGTAAAAAAAGAAAGG - Intergenic
949493546 3:4611015-4611037 GAGGGAGGGAGGAAGGGGAAGGG - Intronic
949562871 3:5219087-5219109 TTTGGTGGGGAGAAGGGGAAAGG - Exonic
949667632 3:6358703-6358725 CAGGAAGAGAAGAAGGAGAAAGG - Intergenic
949789739 3:7779932-7779954 AATGGAAGGAAAAAGGAGAGTGG - Intergenic
949809802 3:7994370-7994392 GATGGAGAGAGAAAGGAGAATGG - Intergenic
949909062 3:8885652-8885674 AAGGGAGGGAAGAGGGAAAAGGG + Intronic
950171534 3:10842204-10842226 TTTGGAGGGAGGGAGGAGAGGGG - Intronic
950358665 3:12434413-12434435 GAGGGAGGGGAGAAGGAAAAGGG - Intergenic
950503151 3:13377091-13377113 TCTGCAGGGCAGGAGGAGAATGG + Intronic
950564899 3:13763072-13763094 TGTGGAGGGAAGCAGGCGACCGG - Intergenic
951058959 3:18181846-18181868 GATGCTGGGAAGAAGGAAAAGGG + Intronic
951072946 3:18353312-18353334 GATGGAGGGAGCAAGAAGAATGG - Intronic
951103593 3:18717573-18717595 AAGGGAGGAAAGAAGGAAAAGGG - Intergenic
951421034 3:22484978-22485000 TATGGAGAGAAACAGAAGAAAGG + Intergenic
951526033 3:23653902-23653924 AAAGGAGGGGAGAAGCAGAAAGG + Intergenic
951588844 3:24241954-24241976 TGTGGGGGGAGGAAGGAGAGTGG - Intronic
951607277 3:24449987-24450009 AAAGGAGGGAAGAAGGAGGAAGG + Intronic
951809230 3:26681077-26681099 TTTTGAGGGAGGAAGAAGAAAGG + Intronic
952630800 3:35464169-35464191 TATTGAGGGAGGAAGGTGATTGG - Intergenic
952984017 3:38761455-38761477 TATGTAGAGATGAAGGAGGATGG - Intronic
953302284 3:41789801-41789823 TCTGGAAGGCAGTAGGAGAATGG + Exonic
953939694 3:47082298-47082320 TATGGAAGGAAGAATAAGTAGGG - Intronic
954776913 3:53027701-53027723 CATGGATGGAAGAATGAGAAAGG + Intronic
955059120 3:55481656-55481678 TAGGGAGGGGAGAAGGAGATGGG + Intronic
955252158 3:57294576-57294598 TTGGGAGGGGAGAATGAGAAGGG + Intronic
955750754 3:62183818-62183840 TGGGGAAGGATGAAGGAGAAGGG + Intronic
955770233 3:62378149-62378171 GCTGGAGGGAAGAAGGAGGGAGG - Intergenic
955874196 3:63473154-63473176 TATCCAGGTAAGAGGGAGAAGGG - Intronic
956080209 3:65549327-65549349 TAGGAAGGGAGGAAGGAGACTGG - Intronic
956183272 3:66537512-66537534 AGTGTGGGGAAGAAGGAGAAGGG - Intergenic
956216915 3:66858533-66858555 TATGGAGGTCAGAAAGGGAATGG - Intergenic
956279944 3:67545721-67545743 AAAGGAGGGAGGAGGGAGAAAGG - Intronic
956610242 3:71115170-71115192 TATGGTGGGGAAGAGGAGAAAGG + Intronic
956846031 3:73183709-73183731 CAGAGAGGGAAGGAGGAGAAGGG - Intergenic
957036378 3:75297042-75297064 TGTGGAGGGAAGAAGGACTTTGG - Intergenic
957557330 3:81779567-81779589 CATGGTGGCAAGAAGGAGAAGGG + Intergenic
957591419 3:82204621-82204643 TATGGAGGGGAGATGCAGACAGG + Intergenic
957801355 3:85087083-85087105 TCTTGAGGGAAGCAGCAGAAAGG + Intronic
958154571 3:89740105-89740127 TATGAAGGGCAAAAGGGGAAGGG + Intergenic
958154719 3:89742094-89742116 TTGGGAGGGAGGAAGGAAAAAGG + Intergenic
958439905 3:94143618-94143640 TATGGAGGAAAGGAAGAGAGAGG + Intergenic
958827946 3:99054821-99054843 TTTGAAGGCAAGAAGGAGAGAGG + Intergenic
959087594 3:101868098-101868120 GAGGGAGGGAAGAAGGGGAGGGG - Intergenic
959334921 3:105052076-105052098 GTTGGAGGAAAGAAGGAGGAAGG + Intergenic
959755277 3:109890011-109890033 GGTGGAGGGTAGAAGGGGAATGG - Intergenic
959878847 3:111419275-111419297 TATGGAGGGACGAGGAAGTAAGG - Intronic
959899597 3:111645364-111645386 CTTGGAGGGAAGAATGAGAGGGG + Intronic
960457698 3:117893281-117893303 TATGGAGAGAAAAGGGAAAATGG + Intergenic
960734546 3:120764170-120764192 CAGGGAAGGAAGAAGGTGAAGGG - Intronic
960961736 3:123075603-123075625 AATGGAAGGAGGGAGGAGAATGG + Intronic
961108690 3:124264725-124264747 TGTGGATGGCAGAAGGGGAAGGG - Intronic
961136801 3:124518960-124518982 GAAAGAGGGAAGAAGAAGAAGGG + Exonic
961472119 3:127121880-127121902 TATGGAGGGAAGAAGACATATGG - Intergenic
961836934 3:129669660-129669682 TGTGAAGGTAACAAGGAGAAAGG + Intronic
961930257 3:130525773-130525795 TCTCGTGGCAAGAAGGAGAATGG - Intergenic
961985485 3:131128306-131128328 GAGGGAGGGAAGAATGAGTAAGG - Intronic
961996749 3:131253535-131253557 TAGGGAAGGAAGAAGAGGAAAGG - Intronic
962269496 3:133967730-133967752 TGTGCAAGGAAGGAGGAGAAAGG - Intronic
962599992 3:136984398-136984420 CATGGAGGTAGGAAGGAGCAAGG + Intronic
962630553 3:137271282-137271304 TATGGAAGGAAGAAAAAGTAAGG - Intergenic
962890225 3:139665350-139665372 CAAGGAGGGAAGAAGGAGGGAGG - Intronic
962922381 3:139962442-139962464 TATGGAGTGAAGAATGAGGTTGG - Intronic
963492090 3:146015287-146015309 AATAGAGGGAGGAAGAAGAAAGG - Intergenic
963752082 3:149191335-149191357 TATGGGAGGAAGGAGGGGAATGG - Intronic
964444655 3:156746110-156746132 TAGAGAGGGAAGAATGACAATGG - Intergenic
965382271 3:168004701-168004723 AATGGAGGGAAGGAGGAGACAGG - Intergenic
965490707 3:169332237-169332259 AAAGGAGGGAAGAAGGAAAGGGG + Intronic
965737048 3:171831803-171831825 TATGGAGGAAAGAGGAACAAAGG + Intergenic
966052764 3:175641337-175641359 GAAAGAGGGAAGAGGGAGAAAGG - Intronic
966211183 3:177454928-177454950 CATGAAGGGAAGAAAGAGGAAGG - Intergenic
966294373 3:178401968-178401990 TATGGGAAGGAGAAGGAGAAGGG - Intergenic
966396327 3:179507405-179507427 AAGGAAGGGAAGAAGGAGGAAGG + Intergenic
966548220 3:181175168-181175190 TGTGAATGGAAAAAGGAGAAGGG + Intergenic
967236898 3:187393782-187393804 TAAGAAGGGAAGAAGGACAAAGG - Intergenic
967355392 3:188564224-188564246 AATGGTGGAAAGAAGGAGTATGG - Intronic
967816832 3:193806542-193806564 TGTGGAAGGATGAAGGAGAGGGG + Intergenic
968435856 4:588674-588696 CATGGAGGGACGACGGAGGAAGG - Intergenic
968890342 4:3365349-3365371 TCTGGAGGGAGGAGGGAGACAGG + Intronic
968909040 4:3467276-3467298 GCGGGAGGGAAGAAGGAGGAGGG - Intronic
968971187 4:3796073-3796095 AAAGGTGGGCAGAAGGAGAAGGG - Intergenic
969137772 4:5044421-5044443 AAGGGAGGGAAGGAGGAGATTGG - Intergenic
969158339 4:5232876-5232898 TATTGAGGTGGGAAGGAGAATGG + Intronic
969535609 4:7754753-7754775 TGTGGAGGGTGGAAGGAGAGAGG + Intergenic
969656487 4:8501694-8501716 AAAGAAGGGAAGAAGGGGAAAGG - Intergenic
970024646 4:11610544-11610566 TATGGAGCACAGAAGGACAATGG + Intergenic
970290035 4:14562137-14562159 CATGTAGTGAAGAAAGAGAAAGG - Intergenic
970573358 4:17404285-17404307 AAGGGAAGGAAGAAGGAGAAAGG + Intergenic
970689966 4:18611588-18611610 GAGGGAGGAAGGAAGGAGAAAGG + Intergenic
970690130 4:18612048-18612070 GAGGGAGGAAGGAAGGAGAAAGG + Intergenic
970690216 4:18612286-18612308 GAGGGAGGAAGGAAGGAGAAAGG + Intergenic
970814167 4:20134251-20134273 GCTGGAGGGGAGAAGGAAAAGGG + Intergenic
970833746 4:20374657-20374679 AAGGAAGGAAAGAAGGAGAAAGG - Intronic
970858571 4:20676159-20676181 GAGGGAGAGAAGAAGGAGAGAGG + Intergenic
970924160 4:21431128-21431150 TAAAGAGGAACGAAGGAGAAGGG + Intronic
970959426 4:21855805-21855827 GATGGAGGGAAGAAGGGCAAGGG - Intronic
971008741 4:22405998-22406020 CATGGAGGTAGAAAGGAGAATGG - Intronic
972103238 4:35447865-35447887 AAGGAAGGAAAGAAGGAGAAAGG + Intergenic
972271014 4:37510927-37510949 AGGGGAGGGAAGAAGGGGAATGG - Intronic
972420988 4:38886126-38886148 TGTGGAGGGAGGATGGACAAGGG + Intronic
972607846 4:40630355-40630377 TATGGGGGGAAGAAGGGGAGCGG - Intronic
972786893 4:42334751-42334773 TATGGAGGAAAAAGGGAGTAGGG - Intergenic
972865288 4:43224990-43225012 TATGACTGGAAGAAGAAGAAAGG + Intergenic
972874680 4:43343702-43343724 GAGGGAGGGAGGAAGGAAAAAGG - Intergenic
973335807 4:48955401-48955423 GAGGGAGGGAGGGAGGAGAAGGG - Intergenic
973622657 4:52742809-52742831 TCAGGAGGGAGGCAGGAGAATGG + Exonic
973723705 4:53751100-53751122 CTGGGAGGGAAGAAGGAAAAGGG - Intronic
973730506 4:53817930-53817952 TGTGCTGGGAAGAAGGAGTAGGG + Intronic
973769740 4:54195462-54195484 TGGGGTGGGTAGAAGGAGAATGG + Intronic
974122380 4:57655206-57655228 TGTGTATGGATGAAGGAGAAGGG - Intergenic
974369584 4:60998330-60998352 GCTGGAGGGAATATGGAGAAAGG - Intergenic
974436679 4:61865775-61865797 GATGGAAGGAAGAGGGAGAGGGG + Intronic
974612162 4:64230817-64230839 TAGGGAGGCAAAGAGGAGAAAGG - Intergenic
974705036 4:65503109-65503131 ACTAGAGGGAAGAAGGAGGAAGG + Intronic
975201170 4:71591599-71591621 TCTTGTGGGAAGAAGTAGAAGGG - Intergenic
975321634 4:73015174-73015196 AATGTAAAGAAGAAGGAGAAAGG + Intergenic
975328577 4:73087962-73087984 AAAGGAGGGAAGAAGGAAAAGGG + Intronic
975337002 4:73189732-73189754 TATGGAGGAAATAAAGAGGATGG - Intronic
975825099 4:78311168-78311190 AAAGGAGGGAAGAAAGAGAAAGG - Intronic
976563946 4:86532443-86532465 TATGGAATGCAGAAGGAGATAGG - Intronic
976598650 4:86917565-86917587 GAGGGAGGGAGGAAGGAGAAGGG + Intronic
976640687 4:87334539-87334561 GGAGGAGGGAAGAAGAAGAAGGG - Intergenic
976766617 4:88604446-88604468 ACTGGAGGGAAAGAGGAGAATGG - Intronic
976842891 4:89452395-89452417 TTTGGAGGAGAGAAGGAGGAAGG + Intergenic
977287697 4:95129399-95129421 TATGCAGGGAGGAAGAAAAAAGG - Intronic
977356263 4:95951617-95951639 CATGGAGGCAGCAAGGAGAAGGG + Intergenic
977370011 4:96123879-96123901 TAGGGTGGGAAGGAGGAAAATGG + Intergenic
977542842 4:98339001-98339023 AAAGGAGGGAGTAAGGAGAATGG - Intronic
977821912 4:101481922-101481944 TGTGGAGGTAAGGAGTAGAATGG - Intronic
977990624 4:103436668-103436690 TAGGGAGGAAAAAAGGAGAGAGG - Intergenic
978243792 4:106548811-106548833 AAGGGAGGGAAGGAGGGGAAGGG - Intergenic
978243800 4:106548829-106548851 AAGGGAGGGAAGGAGGGGAAGGG - Intergenic
978441102 4:108734417-108734439 AAAGGAGAGAAAAAGGAGAAAGG + Intergenic
979014889 4:115420027-115420049 TAAGGATGGAAAAAAGAGAACGG + Intergenic
979215467 4:118158841-118158863 TATGGAAGGAAGGAGGATATGGG - Intronic
979323637 4:119353302-119353324 TAGGGAAGGAGGAAAGAGAAGGG - Intergenic
979398147 4:120214471-120214493 TATGCAGGGGAGAAGGGGGATGG + Intergenic
979613128 4:122710603-122710625 TATGGAAAGAAGACGGAGCAGGG + Intergenic
980062474 4:128146625-128146647 TCTGGAGAGAAGGAGGGGAATGG + Intronic
980064275 4:128166722-128166744 AAGGGTGGGATGAAGGAGAATGG - Intronic
980296776 4:130929322-130929344 GGTGGAAGGAAGGAGGAGAAAGG + Intergenic
981332644 4:143530559-143530581 TATGATGGGAAAAAGGATAAAGG + Intronic
981562288 4:146061255-146061277 AAAGGAAGGAAGAAGGAGGAAGG - Intergenic
981620429 4:146691518-146691540 TATAGAGGGAAGGAGAAAAATGG - Intergenic
981843908 4:149144865-149144887 TATGGCCGGAAGAATCAGAAAGG + Intergenic
982194481 4:152896604-152896626 TATAGAGGGAACAGGGTGAATGG + Intronic
982406713 4:155028769-155028791 GAGGGAGGGAAGGAGGAGCAAGG - Intergenic
982837094 4:160132358-160132380 TAGGGAGAAAAGATGGAGAAAGG + Intergenic
983241469 4:165237968-165237990 TAGGGAAGGAGGAAAGAGAAGGG - Intronic
983346712 4:166536062-166536084 TAAGGAAGGAAGGAGGACAAAGG - Intergenic
983552556 4:169032406-169032428 GAAGGAGGAAGGAAGGAGAAAGG - Intergenic
983691049 4:170469590-170469612 GAGGGAGGGAGGAAGGAGAGAGG - Intergenic
984171326 4:176362744-176362766 TAGAGAGGGGAGAAGGAGAAGGG - Intergenic
984376273 4:178934693-178934715 TAGAAGGGGAAGAAGGAGAAGGG - Intergenic
984535300 4:180967795-180967817 TTTGTAAGAAAGAAGGAGAATGG - Intergenic
984963554 4:185121322-185121344 GATGAAGGGAAGATGGAAAAGGG - Intergenic
985222586 4:187723643-187723665 TATGGAGTGGAGAGGGAAAAAGG + Intergenic
985282407 4:188300457-188300479 TAAGCAGGGAAGAAGGAGGAGGG - Intergenic
985321873 4:188721675-188721697 AGGGGAAGGAAGAAGGAGAAAGG + Intergenic
985898089 5:2762303-2762325 GAGGAAGGGAGGAAGGAGAAAGG + Intergenic
986163324 5:5250879-5250901 AATGGAGGGAGGAAGGAGTCAGG - Intronic
986235388 5:5904917-5904939 AATGGAGGGAAGAGGAGGAAGGG + Intergenic
986348903 5:6858933-6858955 GGTGGAGAGAAGAAGGAGAAGGG - Intergenic
986468403 5:8050114-8050136 AATGAAGGAAGGAAGGAGAAGGG + Intergenic
986530123 5:8727062-8727084 GAGGGAGGGAAGAAAGAGCAAGG + Intergenic
986570356 5:9157642-9157664 GATGGAGGCATGAAGGAGCATGG - Intronic
986618285 5:9642970-9642992 GAGGGAGGAAAGAAGGAAAAAGG - Intronic
986618292 5:9643009-9643031 AAGGGAGGGAAGAAGGAAAAAGG - Intronic
986895905 5:12367996-12368018 TGTGGAGGGAAGAAATATAAAGG + Intergenic
987001543 5:13664875-13664897 GTTGGAGAGAGGAAGGAGAATGG + Intergenic
987020769 5:13868694-13868716 GAGGGAGGGAAGAGAGAGAAAGG - Intronic
987514877 5:18892425-18892447 TGTTGAGGGAAGGAGGTGAATGG - Intergenic
987661408 5:20882952-20882974 TATGGATGCCAGAAGGACAAGGG - Intergenic
988039331 5:25869058-25869080 TATATATGGAAGAAGGAGACAGG + Intergenic
988174008 5:27696813-27696835 GAGGGAGGGATGAAAGAGAAAGG + Intergenic
988343205 5:30001775-30001797 TGAGAAGGGAGGAAGGAGAAAGG + Intergenic
988633363 5:32955212-32955234 TAAGGAGGAAAGAAGAGGAAAGG + Intergenic
988947802 5:36224025-36224047 TATTGAAGAAAGAAGGATAAGGG + Intronic
989097299 5:37793182-37793204 ACTTGAGGGCAGAAGGAGAAGGG - Intergenic
989145963 5:38250436-38250458 TAAAGAGGGAAGTAGGACAAAGG - Intergenic
989427258 5:41310747-41310769 AAAGGAGGGAAGAGGTAGAAGGG - Exonic
989736615 5:44715346-44715368 GAGGGAGGGAAGAATGAGACAGG - Intergenic
989811810 5:45686294-45686316 TATGTAGGGTAAAAGGAAAAGGG - Intronic
990225647 5:53649353-53649375 AATAGAGGGGAGAGGGAGAAGGG - Intronic
990331272 5:54728311-54728333 TAAGGAGGGAAGGAGGAAGAAGG + Intergenic
990488312 5:56280292-56280314 TCTGGAGCACAGAAGGAGAAGGG + Intergenic
990529576 5:56660195-56660217 CATTGAGGGGAGCAGGAGAAGGG - Intergenic
990597898 5:57329627-57329649 AGGGAAGGGAAGAAGGAGAAGGG + Intergenic
990638925 5:57760995-57761017 TGTGGAGGGAAGCAGGAAAATGG + Intergenic
990717720 5:58657228-58657250 TTTGGGGGGAAGAATGGGAAGGG + Intronic
990893932 5:60676744-60676766 GATGGGGAGGAGAAGGAGAAGGG - Intronic
990936993 5:61162193-61162215 TAAGGAGGGAAGAGTGAGCAAGG - Intronic
990960617 5:61390041-61390063 TATGGAATGAAGATGAAGAAAGG - Intronic
991492412 5:67195933-67195955 TAATGAGAGAAAAAGGAGAAGGG - Intronic
991572299 5:68067985-68068007 TCTGGAGAGAAGTAGAAGAAAGG - Intergenic
992010272 5:72518738-72518760 GATGGAGGGATGAAGAAGTAAGG + Intergenic
992264830 5:75008288-75008310 GAAGGAGGGAAGAAGGATGAAGG - Intergenic
992946205 5:81812957-81812979 TCTGGAGGGAAGAAATAAAATGG + Intergenic
993039546 5:82797260-82797282 TCTGGAGGGAAAAGGGAAAAGGG - Intergenic
993562954 5:89434565-89434587 AATGGAGGCAAGAAAGAGTAAGG - Intergenic
993622386 5:90184016-90184038 CATGAAGGAAAGAAGGAGGAAGG + Intergenic
994728227 5:103461631-103461653 TGGGGAAGGAAGAAAGAGAAAGG - Intergenic
994771092 5:103982575-103982597 TATGGCAGGAAGGAGGAAAAGGG + Intergenic
994927161 5:106131200-106131222 TATGGAGTAATGGAGGAGAAAGG - Intergenic
994987665 5:106958560-106958582 GGTGGAGGGATGAAGGGGAAAGG - Intergenic
995082175 5:108065027-108065049 TAGGGATAGAAGAGGGAGAAAGG - Intronic
995154811 5:108898508-108898530 AAAGGAAGGAAGAAGGAGAAAGG - Intronic
995331270 5:110949658-110949680 AAGGGAGGGCAGAGGGAGAATGG - Intergenic
995405093 5:111785788-111785810 CATGGAGGAAAGGATGAGAAAGG + Intronic
996367873 5:122722024-122722046 GAGGAAGGGAAGAATGAGAAAGG - Intergenic
996748141 5:126863879-126863901 AATGGAGGAAGGAAGGAGATAGG + Intergenic
996775967 5:127132999-127133021 TATAGAGACAAGAAGTAGAATGG + Intergenic
996798352 5:127375613-127375635 AGGGGAGGGAAGAAGGAGATGGG - Intronic
996985322 5:129555124-129555146 TATGGAAAGAGGAAAGAGAAAGG + Intronic
997038335 5:130220799-130220821 TATGGAGGGGTGGAGGGGAAGGG - Intergenic
997581316 5:135019145-135019167 GATGGAGGGAGGGAGGAGGAGGG + Intergenic
997977369 5:138448311-138448333 GTTGGAGGAAAGGAGGAGAAGGG + Intergenic
998042605 5:138962019-138962041 TAAGGAAGCAATAAGGAGAAGGG - Intronic
998189698 5:140012769-140012791 AATGGAAGAAAGAAAGAGAAGGG - Intronic
998194836 5:140059591-140059613 TATGAATGGAAGAAGAAAAATGG - Intergenic
998457043 5:142281321-142281343 TATGGAGGGAGGTGGGAGTAGGG - Intergenic
998468366 5:142363966-142363988 TATGGAGAGGAAAAGGATAAAGG + Intergenic
998553609 5:143101809-143101831 TAGGGAGAGAAGCTGGAGAAGGG + Intronic
998694375 5:144622699-144622721 TTTGGACAGAAAAAGGAGAATGG + Intergenic
998809357 5:145950527-145950549 TAGAGAGGGAAACAGGAGAAGGG + Intronic
998880179 5:146637537-146637559 GATGGAAGGCAGAAGGATAAAGG - Intronic
999065213 5:148678445-148678467 GAGGGAGGAAAGAAGGAGAAAGG - Intergenic
999138482 5:149340193-149340215 TGGGGAGGGAACAAGTAGAAGGG + Exonic
999275115 5:150325076-150325098 GAAGGAGGGAAGAAGGAAAGAGG + Intronic
999900917 5:156086277-156086299 TCAGGAAGGAAGAAGGAAAAAGG - Intronic
1000070441 5:157735670-157735692 CATGGAGGGAAGGAGCAGTAGGG - Intronic
1000576700 5:162983508-162983530 TATTGAGGGAAAAGAGAGAAAGG - Intergenic
1000904541 5:166948518-166948540 AAGGGAGGGAAGAAGTATAATGG + Intergenic
1001200996 5:169716662-169716684 AATGGGGAGAAGAAGGTGAAAGG - Intronic
1001494031 5:172175380-172175402 TATGGTGGAGAGAGGGAGAAGGG + Intronic
1001582030 5:172805451-172805473 GAGGGAGGGAGGAAAGAGAAAGG + Intergenic
1002566742 5:180116430-180116452 GAAGGAAGGAGGAAGGAGAAAGG - Intronic
1002825398 6:768205-768227 TATGAGGGAAAGAAGGAAAAAGG - Intergenic
1003286055 6:4734688-4734710 GATGGAGGGAAGATGGGGATGGG + Intronic
1003474562 6:6469565-6469587 TTTGGAGGGCAAAAGGAGACAGG + Intergenic
1003921338 6:10836124-10836146 TATTGAGGGAAGAATAAGCAAGG + Intronic
1004073716 6:12326102-12326124 GATGAAGGGAAGAAGGAGAAAGG + Intergenic
1004351360 6:14893078-14893100 GATGGAGGGAAGGAGGAGAATGG + Intergenic
1004480803 6:16017720-16017742 AAAGGAAGGAAGAATGAGAATGG - Intergenic
1004751372 6:18565772-18565794 GAGGGAGGGAAGAAGAAGGAGGG - Intergenic
1004761133 6:18667703-18667725 GAGGGAGGGAAGAAGGAAACAGG - Intergenic
1004796801 6:19095396-19095418 TATGAATGGAGGAAGGGGAAGGG - Intergenic
1004950706 6:20668076-20668098 CAGGGAGGGAAGAAAGAGAGGGG - Intronic
1005018780 6:21398437-21398459 GAGGGAGGGAAGGAGGGGAAGGG - Intergenic
1005301590 6:24476369-24476391 CATGGAGGGAAGGAGGAGAAGGG - Intronic
1005354619 6:24970259-24970281 TTTGTAGGGGAGAAGGAGTAAGG - Intronic
1006206440 6:32347540-32347562 TATGATGGCAAGAAGGAGAGAGG - Intronic
1006340543 6:33443998-33444020 CAGGGAGGGAAGAAGGAGATGGG + Intronic
1006823881 6:36919556-36919578 TCTGGAGGAAAGAATGAGGAGGG - Exonic
1006924622 6:37647694-37647716 TTGGGAGGAAAGAAAGAGAAGGG + Intronic
1007063855 6:38969652-38969674 TATGGATGGAGGAAAGTGAATGG + Intronic
1007081496 6:39108375-39108397 TATGGGGGGTGGCAGGAGAAAGG + Intronic
1007102670 6:39260857-39260879 TAAGGGAGGAAGAAGGAGTATGG + Intergenic
1007234493 6:40380498-40380520 AGTGGAAGGAAGAAGGGGAAAGG - Intergenic
1007250170 6:40489970-40489992 CATAGAGGGAAGGAGCAGAAAGG - Intronic
1007337973 6:41168462-41168484 GATGGAGGGAGGCAGGAGGATGG - Intergenic
1007346688 6:41236464-41236486 CCTGCAGGGAAGAAGGAGAAAGG - Exonic
1007377440 6:41466538-41466560 AAGAGAGGGAAGAAGGAGGAAGG + Intergenic
1007432362 6:41784061-41784083 TGAGGGGGAAAGAAGGAGAAAGG + Intronic
1007466168 6:42052785-42052807 TATGAAAGGAAGTAGGAGAAAGG + Intronic
1007809474 6:44476024-44476046 TCTGGAGGGAAGGAGGAGAAGGG - Intergenic
1008122225 6:47631820-47631842 TACTCAGGGAAGAGGGAGAAAGG + Intergenic
1008286180 6:49654040-49654062 GAGGGAGGGAAGAAGGAAGAAGG - Intergenic
1008362338 6:50635548-50635570 AAGGGAGGGGAGAAGGGGAAAGG + Intergenic
1008364106 6:50655660-50655682 CTTGGAGGGAAGAAGGTGAGTGG + Intergenic
1009957004 6:70467700-70467722 AAAGGAGAAAAGAAGGAGAAAGG - Intronic
1010189872 6:73184167-73184189 TTTTGAGGAAATAAGGAGAAAGG - Intronic
1010895398 6:81356954-81356976 AAAGGAAGGAAGAAGTAGAAGGG - Intergenic
1010899752 6:81411927-81411949 TATGTAGGGAAAATGGAGAGAGG + Intergenic
1010922808 6:81704816-81704838 AAGGGAGGGAAGAAAGAGTAGGG + Intronic
1011228840 6:85137455-85137477 TAAGGAGGGAGGATGGAGAGGGG - Intergenic
1011412539 6:87081093-87081115 TATGCATGGAAAAAGTAGAAGGG - Intergenic
1011764310 6:90603666-90603688 TGTGGAGGGAAGGAGAACAATGG - Intergenic
1012143862 6:95656917-95656939 TAGGCAGGGAGGAAGGAGAGTGG - Intergenic
1012329079 6:97961796-97961818 AAGGGAGGGAGGGAGGAGAAGGG - Intergenic
1012466745 6:99523938-99523960 CATGGAGAGATGAGGGAGAAAGG + Intergenic
1012671270 6:102050770-102050792 AAAGGAGGGTAGAGGGAGAAAGG + Intronic
1012770217 6:103424360-103424382 TCTGGATGGGAGAAGGAGAGGGG + Intergenic
1013139073 6:107312736-107312758 TGTGGAGGGTAGAAGGAAGAAGG + Intronic
1013838222 6:114358297-114358319 TATGGAGAAAGGAAGGGGAAAGG + Intergenic
1014808609 6:125859969-125859991 TTGAGAGGGAAGTAGGAGAAAGG + Intronic
1015075511 6:129151788-129151810 TATGGAGGGAGGGAGGAGACTGG - Intronic
1015464674 6:133535401-133535423 AATGCAGGTAAGAGGGAGAAGGG + Intergenic
1015723727 6:136276400-136276422 AAGGGAGGGCAGAGGGAGAATGG - Exonic
1015813540 6:137185264-137185286 TAAGGACGGAAGAAGGAAAATGG - Intergenic
1016186330 6:141202068-141202090 TATTGGGTGAAGAAGAAGAAAGG + Intergenic
1016877049 6:148876135-148876157 TATGCATGGCAGAAGGCGAAGGG + Intronic
1016943922 6:149510297-149510319 CACAGAGGGAAGAAGGAAAAGGG + Intronic
1017052461 6:150406432-150406454 TGTGGAGGGAGGAAAGAGGATGG - Intergenic
1017340125 6:153311437-153311459 TAGGGAGGAGGGAAGGAGAATGG - Intergenic
1017359180 6:153545966-153545988 TGGGGAGGGCAGAAGGAGCATGG - Intergenic
1017523710 6:155224568-155224590 TATGGAAGGAAGGAGGAGAATGG + Intronic
1017540272 6:155394742-155394764 TATGCAGGGAAGTAGCATAAAGG + Intergenic
1017751061 6:157490986-157491008 TAGGGAGGGAAGGGGGAGGAGGG + Intronic
1018392433 6:163350686-163350708 TGAGGAGGGAAGAAGGGGCAAGG - Intergenic
1018595143 6:165471257-165471279 TAAGGGAGGAAGAAGTAGAAAGG - Intronic
1018614432 6:165673187-165673209 ACTAGATGGAAGAAGGAGAAAGG + Intronic
1018619417 6:165715549-165715571 AATGAAGGGGAGAAGGAGGAGGG + Intronic
1018731638 6:166656289-166656311 GAGGCAGGGAAGAAGAAGAAGGG + Intronic
1018844711 6:167547517-167547539 GATGGGGTGAAGAAGGAGGAGGG - Intergenic
1019327603 7:445993-446015 GATGGAGAAAAGAAGGAGGAGGG + Intergenic
1019483532 7:1277158-1277180 GAGGGAGGGAGGAGGGAGAAGGG - Intergenic
1019483547 7:1277201-1277223 GAGGGAGGGAGGAGGGAGAAGGG - Intergenic
1019483556 7:1277223-1277245 GAGGGAGGGAAGAGGAAGAAAGG - Intergenic
1019698882 7:2463048-2463070 TATGGAGACAGAAAGGAGAATGG + Intergenic
1020353947 7:7256730-7256752 TATGGAGTGAGGTAGGAAAATGG + Intergenic
1021117526 7:16760609-16760631 TAGTGAGGGTAGATGGAGAAGGG + Intronic
1021292858 7:18867150-18867172 CATGCAGGGAAGAAGGAAGAGGG + Intronic
1021481602 7:21123896-21123918 TATGGTGGGAACAAGGAGAGAGG + Intergenic
1021546737 7:21821893-21821915 CATGGAGGCAAAGAGGAGAATGG - Intronic
1021826288 7:24555547-24555569 TCTGAAGGGAAGGAGGAGAAGGG - Intergenic
1021894234 7:25219182-25219204 AAGGGAGGGAGGGAGGAGAAGGG - Intergenic
1021950511 7:25769569-25769591 GAGGGAGGAAAGAAGGGGAAGGG + Intergenic
1022035756 7:26532831-26532853 AATGGAGGGAGGGAGGGGAAGGG - Intergenic
1022069651 7:26900064-26900086 TATGTTGGAAAGATGGAGAAGGG - Intronic
1022384547 7:29889090-29889112 GATGGAGGGAAGCAGGAAGAGGG - Intronic
1022424269 7:30253177-30253199 TGAGGTGGGCAGAAGGAGAAGGG - Intergenic
1022445740 7:30469401-30469423 GAGGGAGGGAAGAGGGAGTAGGG - Intronic
1023085774 7:36568743-36568765 TAAGGAGAGAAGAAAGAGAAGGG - Intronic
1023566235 7:41526456-41526478 TCCATAGGGAAGAAGGAGAAGGG + Intergenic
1023611322 7:41974093-41974115 TATGGAGACCAGAAGGAGAGAGG + Intronic
1023948642 7:44823593-44823615 GAAGGAGGGAAGAAGAAGGAGGG - Intronic
1024138448 7:46434346-46434368 CAAGGCGGCAAGAAGGAGAATGG - Intergenic
1024225689 7:47325168-47325190 TGTGGAGGTAAGAAGGAAATGGG - Intronic
1024461292 7:49662172-49662194 TAAGGAGAGAAGAAAGAGAAGGG - Intergenic
1024792116 7:52978345-52978367 CAGGGAGGGAAGAGGAAGAATGG - Intergenic
1024971766 7:55078172-55078194 TGGGGAGGGGAGAAGGAGCAAGG + Intronic
1025120130 7:56294764-56294786 AATGGATGGATGAAGGAGGATGG + Intergenic
1025553369 7:62275626-62275648 ATGGGAGGGAAGAAGGAGAGCGG - Intergenic
1026010568 7:66632595-66632617 TATAGACAGAAGAAGGAGACTGG + Intronic
1026128637 7:67602053-67602075 TATGGAGGGATGGAAGAGAACGG - Intergenic
1026231221 7:68485568-68485590 GAGGGAGGGAGAAAGGAGAAAGG + Intergenic
1026319264 7:69254773-69254795 AAGGGAGAGAGGAAGGAGAAAGG + Intergenic
1026394396 7:69936873-69936895 AAGGGAGAGAAAAAGGAGAAAGG - Intronic
1026580749 7:71614690-71614712 GAGGGAGGGAAGAAAGAGAAAGG + Intronic
1026736603 7:72953035-72953057 TAAGGAGGGAAGAATGCAAAAGG + Intergenic
1026774034 7:73220259-73220281 TATGGAGGGAAGATGGTGAATGG + Intergenic
1027014891 7:74773645-74773667 TATGGAGGGAAGATGGTGAATGG + Intergenic
1027073140 7:75172308-75172330 TATGGAGGGAAGATGGTGAATGG - Intergenic
1027107131 7:75412028-75412050 TAAGGAGGGAAGAATGCAAAAGG - Intergenic
1027271093 7:76519352-76519374 AAAAGAGGGAAGAAGGAGAGAGG + Intergenic
1027320856 7:77009287-77009309 AAAAGAGGGAAGAAGGAGAGAGG + Intergenic
1027426341 7:78065048-78065070 TATGGAGGAAGGAAGGTGACAGG + Intronic
1027802585 7:82774126-82774148 TACAAAGGGAAGAAGGAGAAAGG - Intronic
1027812064 7:82915922-82915944 TTTGGAGGAAAGAAGTAGCATGG - Exonic
1027941410 7:84685723-84685745 ACTGGAGTGGAGAAGGAGAATGG + Intergenic
1028416274 7:90583761-90583783 CATGTTGGGAAGAAGAAGAATGG - Intronic
1028504995 7:91560938-91560960 TAAGGAGGGTAGAAGCAAAATGG - Intergenic
1028630400 7:92927459-92927481 TCTAGAGGGATGATGGAGAAAGG + Intergenic
1028852702 7:95554057-95554079 TATGCAGGAAATAAGGAGACTGG + Intergenic
1028873650 7:95796182-95796204 TAGTGAGGGGAGAAGGAGAATGG + Intronic
1029055936 7:97742858-97742880 TATGGATGGGAGGAGGAGAGTGG + Intergenic
1029093405 7:98066328-98066350 GAGGGAGGAAAGAAGGAGACAGG + Intergenic
1029273546 7:99391333-99391355 AAAGGAGGGAGGCAGGAGAAAGG - Intronic
1029412782 7:100426667-100426689 GAGGGAGGGAAGAGGGAGGAAGG - Intronic
1029535304 7:101154424-101154446 GAGGGAGGGCAGCAGGAGAAAGG + Exonic
1029617573 7:101668752-101668774 TGTGGAGGGAAGAAAGGGAAAGG + Intergenic
1030184759 7:106750725-106750747 GAAGGAGGGATGATGGAGAAGGG - Intergenic
1030577258 7:111304360-111304382 AATGGAGGTAAGGTGGAGAAAGG + Intronic
1030668820 7:112311689-112311711 TATGAAGGAAAGAAAGAGTAAGG + Intronic
1030737371 7:113065568-113065590 TCTGGAGAGAAGAAGGAAGAAGG + Intergenic
1030881522 7:114886218-114886240 AGGGGAGGGAAGAAGGGGAAAGG + Intergenic
1031050886 7:116944289-116944311 GTTGGAGGGAAGAAGGGGTATGG - Intergenic
1031336591 7:120541030-120541052 TAGGGTGGGGAGAAGGATAAAGG - Intronic
1031501129 7:122517815-122517837 TGTGGAGGGAATGAGGAAAATGG + Intronic
1031930961 7:127685574-127685596 TTTGCAGGGGAGAAGAAGAAAGG - Intronic
1032681172 7:134185037-134185059 TCAGGAGGAAGGAAGGAGAAGGG + Intronic
1033327369 7:140390704-140390726 TATTGGGGGATGGAGGAGAAGGG - Intronic
1033476686 7:141699613-141699635 TATCCAGGGATGGAGGAGAAAGG - Intronic
1033478691 7:141716460-141716482 AAGAGAGGGCAGAAGGAGAAGGG - Intronic
1033892013 7:146025106-146025128 GACGGAAGGAAGAAAGAGAAAGG - Intergenic
1034206375 7:149319259-149319281 CAAGGAGGGAGGAGGGAGAATGG - Intergenic
1034420984 7:150990573-150990595 AGAGGAGGGAAGAAGAAGAAGGG + Intergenic
1034427064 7:151019528-151019550 AAGGGAGGGCAGAAAGAGAAAGG - Intronic
1035823745 8:2622249-2622271 GAGGGAGGGAGGAAGGAAAACGG - Intergenic
1036424226 8:8628487-8628509 CAGGGAGGGCAGAAGGAAAATGG - Intergenic
1037126562 8:15358685-15358707 AAGGAAGGGAGGAAGGAGAAAGG - Intergenic
1037140529 8:15513970-15513992 TATGTAAAGAAGAAGGGGAAGGG - Intronic
1037542454 8:19885565-19885587 GGAGGAGGGAAGAGGGAGAAGGG - Intergenic
1037548278 8:19944971-19944993 GAAGGAAGGAAGAAGGGGAAGGG - Intronic
1037552975 8:19992943-19992965 TATGGACGGAAGGGGGAAAATGG - Intergenic
1037599033 8:20378277-20378299 TGTGGAGGGAAGGAGGTGATTGG + Intergenic
1037607447 8:20449614-20449636 GATGGAGGGAACACAGAGAAGGG + Intergenic
1037658672 8:20908735-20908757 TAGGGAAGGGAGGAGGAGAAAGG - Intergenic
1037916557 8:22776736-22776758 TATGGATGGGAGAAGGAGAATGG + Intronic
1038007394 8:23444366-23444388 GATGGAGAGGAGAAGGAGGAAGG + Intronic
1038027324 8:23603337-23603359 CATTGAGGCAAGAAGGAGAAAGG - Intergenic
1038129227 8:24710693-24710715 GAGGGAGGGAAAGAGGAGAAAGG + Intergenic
1038173907 8:25163707-25163729 TAAGGAAGGAGGGAGGAGAATGG + Intergenic
1038820886 8:30951077-30951099 GAGGGAGGAAGGAAGGAGAAAGG - Intergenic
1039836238 8:41258551-41258573 GGGGGTGGGAAGAAGGAGAAAGG - Intergenic
1040375668 8:46822440-46822462 TATGTAGGCAAGGAGAAGAAAGG - Intergenic
1040845618 8:51835236-51835258 TATTAAGGGTAGAAGGAGAGGGG - Intronic
1041089269 8:54287130-54287152 CATGGAGATAGGAAGGAGAATGG - Intergenic
1041190040 8:55344133-55344155 TATGGAGGGGAGAGAGAGAGTGG - Intronic
1041543092 8:59009128-59009150 TAGAAAGGAAAGAAGGAGAAGGG - Intronic
1041726021 8:61018022-61018044 TTTGGAGGGAAGATGAAAAAAGG + Intergenic
1042526802 8:69772547-69772569 GAAGGAGGGAGGGAGGAGAAAGG + Intronic
1042601725 8:70505621-70505643 TAAAGAGGGAGGAAGGGGAAGGG - Intergenic
1043146466 8:76661648-76661670 AAAGGAAGGAAGAAGGAAAAAGG + Intergenic
1043260496 8:78188515-78188537 AGGGGAGGGGAGAAGGAGAAGGG + Intergenic
1043276612 8:78404224-78404246 TCTGGAAGAAAGAAGGAGAAAGG - Intergenic
1043322696 8:79009465-79009487 GATGGAGGGCAGGAGGTGAAGGG - Intergenic
1043726214 8:83614260-83614282 AAGGGAGGGAGGAAGGGGAAGGG - Intergenic
1043820578 8:84858729-84858751 TATAGAGGGAAGTAGGTGAAAGG - Intronic
1043978957 8:86615844-86615866 TAGGGAGGGAGGAAGGAGAATGG + Intronic
1044119960 8:88382496-88382518 AATGGAGGGAAGAGGGAGGAAGG - Intergenic
1044392561 8:91669136-91669158 TGTGGAGGGAGGAAGGCAAAAGG - Intergenic
1044510936 8:93077688-93077710 TGTGAAGGGAAGAGGGAAAAGGG + Intergenic
1044608827 8:94072255-94072277 GACGGAGGGAGGAGGGAGAAGGG - Intergenic
1044635873 8:94323409-94323431 AATGGATGGCAGAAGCAGAATGG + Intergenic
1045214963 8:100139252-100139274 TATGGAGGAAAGATAAAGAAGGG + Intronic
1045385375 8:101667087-101667109 TATGGAGGGGTGAGAGAGAAGGG - Exonic
1045526007 8:102941892-102941914 TATGGATAGAAGCATGAGAAGGG - Intronic
1045576605 8:103428542-103428564 TAAGGAAGGAAGATGGAGGATGG - Intronic
1045887313 8:107113922-107113944 TATTGAAGGAAGAAGGGAAAAGG - Intergenic
1045950719 8:107848930-107848952 GAGGGAGGGAGGAAGGGGAAGGG + Intergenic
1046465400 8:114595794-114595816 TTGGGAGGGATGAAGGAGAATGG - Intergenic
1046588351 8:116175702-116175724 TAAGGAAGAAAGAAAGAGAAGGG + Intergenic
1047463949 8:125094140-125094162 TATGAAGGGGAGAAGGAAACAGG + Intronic
1047536645 8:125726330-125726352 TATGGAGGGCAGAATAAAAAAGG + Intergenic
1047826498 8:128582026-128582048 GAGGGAGGGAGGAAGGAGGAAGG - Intergenic
1047866497 8:129029689-129029711 CATGGAAGGATGAAGGAGTAGGG - Intergenic
1047965274 8:130041816-130041838 TGTGGAGGGAACAAGGAGAGTGG + Intergenic
1047980820 8:130180046-130180068 AAGGGAGGGAGGGAGGAGAAGGG + Intronic
1048122722 8:131599776-131599798 TATTGAGGGAAAAAAAAGAATGG + Intergenic
1048161085 8:132022725-132022747 AAGGGAGGGAAGAAGGAGCCAGG + Intergenic
1048376279 8:133825391-133825413 GATGGTGGGAAGAAGGTGAAAGG - Intergenic
1048516563 8:135116771-135116793 GGAGGAGAGAAGAAGGAGAAAGG - Intergenic
1048680601 8:136837359-136837381 AAAAGAGGGAAGAGGGAGAAAGG - Intergenic
1048690316 8:136955724-136955746 AATGGAGGGAGGAAGGAAGAAGG - Intergenic
1048840032 8:138557607-138557629 GAGGGAGGGAAGAAAGAGGAAGG + Intergenic
1048841287 8:138568673-138568695 AAGGGAGGGAGGAAGGAGGAAGG + Intergenic
1048891827 8:138955204-138955226 AATTTAGGGAAGAGGGAGAATGG - Intergenic
1049069165 8:140343897-140343919 TGTGGAGGGCAGAGGGAGAGAGG + Intronic
1049370377 8:142261416-142261438 GAAGGAGGGATGAAGGAGAGAGG + Intronic
1049392997 8:142381611-142381633 TCTGGAGTGAGGCAGGAGAAGGG + Intronic
1049402147 8:142433234-142433256 GATGAAGGGAAGGAGGAGAGAGG - Intergenic
1049474782 8:142791797-142791819 GATGGATGGAAGATGGAGGATGG - Intergenic
1049474890 8:142792512-142792534 GATGGATGGAAGATGGAGAACGG - Intergenic
1050029416 9:1369646-1369668 TAAGTAGGTGAGAAGGAGAATGG - Intergenic
1050045850 9:1544536-1544558 GGTGGATGGAAGAAGGTGAAGGG - Intergenic
1050458662 9:5858173-5858195 TCTGGAGGCAAGAAAGAGTATGG + Intergenic
1050688239 9:8196539-8196561 TATTGGTGGAAGTAGGAGAAGGG + Intergenic
1051351645 9:16203389-16203411 TCTGGAGGGAAGGGGGAAAAGGG + Intergenic
1051968339 9:22857146-22857168 AATGGAGAGAAGAGGGAGAGAGG - Intergenic
1052739755 9:32382172-32382194 TGTGGAGGGAAGGAGGTGATTGG + Intergenic
1053458142 9:38247092-38247114 TTTGGAAGGAAGAAGGAAAAGGG - Intergenic
1053567903 9:39272193-39272215 TGTGGAGAGATGAAGGAGATGGG + Intronic
1053722144 9:40957533-40957555 TTTGTAGGGAGGAAGGGGAAAGG + Intergenic
1053833906 9:42113137-42113159 TGTGGAGAGATGAAGGAGATGGG + Intronic
1053946368 9:43312943-43312965 AAGGGAGGAAGGAAGGAGAAGGG + Intergenic
1054129243 9:61346811-61346833 TGTGGAGAGATGAAGGAGATGGG - Intergenic
1054343829 9:63894461-63894483 TTTGTAGGGAGGAAGGGGAAAGG - Intergenic
1054596644 9:67074272-67074294 TGTGGAGAGATGAAGGAGATGGG - Intergenic
1054876985 9:70107317-70107339 TTAGGAGGGTAGAGGGAGAAGGG + Intronic
1055002812 9:71472672-71472694 TATGCAGGGAAGAAAGAAACAGG + Intergenic
1055028935 9:71752488-71752510 GAAGGAGGGAGGAAGGGGAAAGG + Intronic
1055068224 9:72140353-72140375 TGTGGAAGAGAGAAGGAGAAGGG + Intronic
1055200062 9:73648458-73648480 CATGGAAGGAAGAAACAGAAGGG + Intergenic
1055495136 9:76846689-76846711 AATGGAGGGGAGGAAGAGAAAGG + Intronic
1055677783 9:78682830-78682852 GAAGGAGGGAAGGGGGAGAAAGG - Intergenic
1056039862 9:82653074-82653096 TGTGGAGGGAAGAAACTGAATGG - Intergenic
1056044994 9:82705658-82705680 TAGTGAGGGAAGTTGGAGAAGGG + Intergenic
1056741351 9:89258015-89258037 TGAGGATGGAAGAAGGAGCAGGG + Intergenic
1057112434 9:92486077-92486099 TATGGAGAGAAGCAGGATAGGGG + Intronic
1057271889 9:93656174-93656196 TGTGGAGGGAAGGAGGAGGTGGG + Intronic
1057827330 9:98381113-98381135 CATGGAGGGATGTAGGAGGAGGG - Intronic
1057971480 9:99562393-99562415 GACGGGGGGAAGAAGGAAAAGGG + Intergenic
1058665759 9:107313908-107313930 GAAGGAGGAAGGAAGGAGAAAGG - Intronic
1058665765 9:107313934-107313956 GAAGGAGGAAGGAAGGAGAAAGG - Intronic
1058960461 9:109988553-109988575 GAGGGAGGGAGGAAGGAGGAAGG + Intronic
1059499322 9:114737533-114737555 TAGGGAGGGAGGGAGGGGAAGGG - Intergenic
1059702874 9:116792944-116792966 TACTGAGGGGGGAAGGAGAAAGG + Intronic
1059835383 9:118146353-118146375 GAGGAAGGGAGGAAGGAGAAGGG - Intergenic
1059876907 9:118645307-118645329 GAAGGAGGAAAGAGGGAGAAAGG - Intergenic
1060033438 9:120234963-120234985 GATCGAGGGAGGAGGGAGAAAGG - Intergenic
1060446185 9:123690150-123690172 GAGGGAGGGAGGAAGGAGGAGGG + Intronic
1060720904 9:125976739-125976761 AAGGGAGGGAAGAAGGAGACAGG - Intergenic
1061366903 9:130176947-130176969 CATGGGGAGGAGAAGGAGAAGGG - Intronic
1061560062 9:131396228-131396250 AAGGGAGGAAGGAAGGAGAAAGG - Intronic
1061653868 9:132072836-132072858 TATGGAGAGAAGAATGAGTCAGG + Intronic
1061943051 9:133893292-133893314 GAGGAAGGGAAGAAGGAGAAAGG + Intronic
1062362613 9:136194769-136194791 AGAGGAGGGAAGAAGGGGAAGGG - Intergenic
1062362633 9:136194821-136194843 AGGGGAGGGAAGATGGAGAAGGG - Intergenic
1062638431 9:137503662-137503684 AGGGGAAGGAAGAAGGAGAAGGG + Intronic
1062644478 9:137540480-137540502 GAAGGAGGGAAGAAAGAGGAGGG - Intronic
1203589498 Un_KI270747v1:41501-41523 AAGGGAGGAAGGAAGGAGAAGGG + Intergenic
1185500818 X:595984-596006 TATAGAGGGATGAAGAAGGAAGG - Intergenic
1185592246 X:1285268-1285290 AAAGGAGGGAAGATGGACAAGGG + Intronic
1185627603 X:1493428-1493450 GAGGGAGGGAAGGAGGAGGAAGG + Intronic
1185680010 X:1880806-1880828 TAGGGAGGGAAGGAGGAGGATGG + Intergenic
1185698741 X:2214367-2214389 GAAGGAGGAAGGAAGGAGAAAGG + Intergenic
1185708521 X:2282879-2282901 GAGGGAGGGAGGAGGGAGAAGGG + Intronic
1185726687 X:2427285-2427307 AGAGGAGGGAAGAAGGAGTAGGG + Intronic
1185734255 X:2485482-2485504 GAGGGAGGGAGGAAGGAAAAAGG + Intronic
1185999153 X:4989064-4989086 TAAGGAAGGAAGAAAGGGAAGGG - Intergenic
1185999221 X:4989347-4989369 TAGGGAGGAAGGAAGGAGACAGG - Intergenic
1186054567 X:5635259-5635281 CAAGGCGGCAAGAAGGAGAATGG - Intergenic
1186156583 X:6732581-6732603 GAGGGAGGGAGGAAGGAGAAGGG + Intergenic
1186206347 X:7204767-7204789 TTAGGAGGAAAGAGGGAGAAAGG - Intergenic
1187472342 X:19580327-19580349 TATGGAAAAAAGATGGAGAATGG - Intronic
1187578666 X:20585476-20585498 AAGGGAGGGAAGAAAGACAAGGG - Intergenic
1187650840 X:21404211-21404233 TAAGGAGTAAAGCAGGAGAAAGG + Intronic
1187990770 X:24869750-24869772 GATGGAGGAAAGAAGGAAAGAGG - Intronic
1188485941 X:30682435-30682457 TTTGGAAGCTAGAAGGAGAAAGG + Intronic
1188894716 X:35653061-35653083 TATGGATGGGACAGGGAGAAGGG - Intergenic
1189106185 X:38238101-38238123 AAAGCAGGAAAGAAGGAGAAGGG - Intronic
1189283529 X:39835946-39835968 TTGGGAGGGATGAAGGAAAAGGG + Intergenic
1189610466 X:42727961-42727983 TGTGGAGGGTAGGAGGAGAGAGG + Intergenic
1190213242 X:48463816-48463838 AAGGGAGGAAAGAAAGAGAAAGG + Intronic
1190417991 X:50199838-50199860 GGGGGAGGGAAGAGGGAGAAAGG - Intronic
1190515892 X:51223274-51223296 AAAGGAGGGAAGAAAGAGGAGGG - Intergenic
1190886464 X:54534781-54534803 GGGGGAGGGAAAAAGGAGAAGGG - Intronic
1190888623 X:54550770-54550792 AATGGAGGGGAGAGGTAGAAAGG + Intronic
1190894104 X:54598910-54598932 TATGAGGAGAAGAAAGAGAATGG + Intergenic
1191112152 X:56812370-56812392 TAGGGAGGGCAGAAAGAGGAGGG - Intergenic
1191822098 X:65321897-65321919 TAGGGAGGGAGGAAGGAGAGAGG + Intergenic
1192040416 X:67614200-67614222 TGTGGAGATAAGAAGGATAAAGG + Intronic
1192103165 X:68287188-68287210 AAGGGAGGGAGGGAGGAGAAGGG + Intronic
1192117192 X:68422651-68422673 GAGGGAGGAAAGAAGAAGAAAGG + Intronic
1192191014 X:68991158-68991180 AAAGGAGGGAAGGAGGAAAAAGG - Intergenic
1192296377 X:69853395-69853417 CATGGAGGATAGAATGAGAAAGG + Intronic
1192432341 X:71120949-71120971 TCTGGAGGAAAGAGGGAAAAAGG - Exonic
1192435010 X:71137704-71137726 CCTGGAGGGAAGAAGGAGAGAGG - Exonic
1192448158 X:71225612-71225634 TTTGGAGGGAGTAAGGAGATAGG - Intergenic
1192638289 X:72841380-72841402 TAGGGAGAGAGGAAGAAGAAAGG + Intronic
1192643425 X:72879428-72879450 TAGGGAGAGAGGAAGAAGAAAGG - Intronic
1192875662 X:75226931-75226953 AATGGAGGGAAGGAGCATAAAGG + Intergenic
1193144137 X:78059959-78059981 CCTGGAGGGAGGAAGAAGAAGGG - Intergenic
1194059708 X:89181890-89181912 TAAGGATGGAAGAAGGAAAGAGG - Intergenic
1194395914 X:93386039-93386061 TTTGGAGGGCAGAAGAAGACAGG - Intergenic
1194745870 X:97627796-97627818 TATCCAGGAAAGAAGGTGAATGG + Intergenic
1194830009 X:98611933-98611955 CATGGGGGGAAGTAGCAGAATGG + Intergenic
1194949076 X:100103496-100103518 TCTGGAGGTAAGAAGGGAAAAGG - Intergenic
1195004548 X:100672991-100673013 CCTGGAGGGAAGAGGGAGAAGGG - Intergenic
1195088001 X:101431078-101431100 AATGGAGGGCAGAAGCTGAAAGG - Intronic
1195343477 X:103926544-103926566 TATGGATGGAGCAGGGAGAAGGG + Intronic
1195705564 X:107735698-107735720 GCTGAGGGGAAGAAGGAGAAGGG - Intronic
1195944776 X:110198135-110198157 CAGGGAAGGAAGAAGGAAAACGG + Exonic
1196086560 X:111689756-111689778 TATGCAGGGTAGAAAGAGCAGGG - Intronic
1196746734 X:119077910-119077932 CATGGAGGGAGGAAGGGAAAGGG - Intergenic
1196901081 X:120383994-120384016 TATGTTGGGAGGAAGGAGAGTGG + Intergenic
1197040201 X:121928031-121928053 TGTGGAGGGTGGAAGGAGATAGG + Intergenic
1197712420 X:129681062-129681084 TAGAGTGGGAAGAAGTAGAAGGG - Intergenic
1197883781 X:131196654-131196676 CATGGAAGGAAGAAGGAAGAGGG - Intergenic
1198131590 X:133701003-133701025 AAGGGAGGAAAGAAGGAGACAGG - Intronic
1198322781 X:135535693-135535715 TATGGAGAGCAGATGGAAAAAGG + Intronic
1198337028 X:135676390-135676412 TATGAAGAGAAGATGGAAAATGG - Intergenic
1198383422 X:136105258-136105280 GAGGGAGGGAAGAAAGAGGAGGG + Intergenic
1198383427 X:136105276-136105298 GAGGGAGGGAAGAAAGAGGAGGG + Intergenic
1198658112 X:138936805-138936827 TGTGGAGGGATGAGGGAGAATGG - Intronic
1199507921 X:148586948-148586970 TATGGAAGGGGGAAGGAGGATGG - Intronic
1199582351 X:149372911-149372933 TATGGGGAGGGGAAGGAGAAGGG + Intergenic
1199598861 X:149528672-149528694 GAGGGAGGGAGGAAGGGGAAAGG - Intronic
1199846725 X:151697041-151697063 GAGGAAGGAAAGAAGGAGAAGGG - Intronic
1200250390 X:154550645-154550667 TAGGGAGGAAACCAGGAGAAGGG + Intronic
1200375486 X:155775314-155775336 GAAGGAGGGGAGAAGGAGAAAGG - Exonic
1201146373 Y:11067356-11067378 GATGGAGGGAAGGAGAGGAAGGG + Intergenic
1201256405 Y:12112282-12112304 GATGGAGGGAAGGAGGGGGAGGG - Intergenic
1201652647 Y:16307382-16307404 GAGAGAGAGAAGAAGGAGAAGGG + Intergenic
1201653335 Y:16315603-16315625 TAATGATGGTAGAAGGAGAAAGG + Intergenic
1201741213 Y:17326084-17326106 GAGAGAGGGAAGAAGGAGAGAGG + Intergenic
1201796458 Y:17901880-17901902 AATGGAGGGAAGAAAGAGTGTGG - Intergenic
1201805097 Y:18004105-18004127 AATGGAGGGAAGAAAGAGTGTGG + Intergenic
1202357842 Y:24070944-24070966 AATGGAGGGAAGAAAGAGTGTGG - Intergenic
1202512936 Y:25599169-25599191 AATGGAGGGAAGAAAGAGTGTGG + Intergenic