ID: 923369338

View in Genome Browser
Species Human (GRCh38)
Location 1:233295274-233295296
Sequence CTGTGGGTATGGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 667
Summary {0: 1, 1: 0, 2: 4, 3: 86, 4: 576}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923369338_923369359 22 Left 923369338 1:233295274-233295296 CCTTCTTCCCTCCATACCCACAG 0: 1
1: 0
2: 4
3: 86
4: 576
Right 923369359 1:233295319-233295341 CACTCACCAGGTGCAGGGCCAGG 0: 1
1: 1
2: 1
3: 46
4: 369
923369338_923369354 16 Left 923369338 1:233295274-233295296 CCTTCTTCCCTCCATACCCACAG 0: 1
1: 0
2: 4
3: 86
4: 576
Right 923369354 1:233295313-233295335 CCTCCCCACTCACCAGGTGCAGG 0: 1
1: 1
2: 3
3: 28
4: 347
923369338_923369360 23 Left 923369338 1:233295274-233295296 CCTTCTTCCCTCCATACCCACAG 0: 1
1: 0
2: 4
3: 86
4: 576
Right 923369360 1:233295320-233295342 ACTCACCAGGTGCAGGGCCAGGG 0: 1
1: 0
2: 3
3: 33
4: 278
923369338_923369361 24 Left 923369338 1:233295274-233295296 CCTTCTTCCCTCCATACCCACAG 0: 1
1: 0
2: 4
3: 86
4: 576
Right 923369361 1:233295321-233295343 CTCACCAGGTGCAGGGCCAGGGG 0: 1
1: 0
2: 2
3: 28
4: 359
923369338_923369355 17 Left 923369338 1:233295274-233295296 CCTTCTTCCCTCCATACCCACAG 0: 1
1: 0
2: 4
3: 86
4: 576
Right 923369355 1:233295314-233295336 CTCCCCACTCACCAGGTGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 294
923369338_923369351 10 Left 923369338 1:233295274-233295296 CCTTCTTCCCTCCATACCCACAG 0: 1
1: 0
2: 4
3: 86
4: 576
Right 923369351 1:233295307-233295329 CCGGACCCTCCCCACTCACCAGG 0: 1
1: 0
2: 2
3: 31
4: 252
923369338_923369344 -9 Left 923369338 1:233295274-233295296 CCTTCTTCCCTCCATACCCACAG 0: 1
1: 0
2: 4
3: 86
4: 576
Right 923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG 0: 1
1: 0
2: 0
3: 9
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923369338 Original CRISPR CTGTGGGTATGGAGGGAAGA AGG (reversed) Intronic
900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG + Intronic
900650747 1:3729053-3729075 CTGTTGGTAGGGGAGGAAGAGGG + Intronic
900691442 1:3982921-3982943 CTGTGGGTACAGGGAGAAGATGG + Intergenic
900750521 1:4394069-4394091 ATGTGGGTATGGAGGGTACTTGG + Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
902122890 1:14182984-14183006 CTGTGGGTATGGAACTGAGAGGG - Intergenic
902466174 1:16620104-16620126 CTGAGGGTATGGGGGCCAGATGG - Intergenic
902508516 1:16953199-16953221 CTGAGGGTATGGGGGCCAGATGG + Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903575136 1:24335178-24335200 CTGTGGGTCTTCAGGGGAGAGGG - Intronic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904623415 1:31789040-31789062 CAGTTGGTATGGAGGGAAACGGG - Intergenic
904645931 1:31966305-31966327 CTCTGAGAATGGAGGAAAGAGGG + Intergenic
905361074 1:37420836-37420858 CTGTGGATACTGAGGGATGATGG - Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907379603 1:54075283-54075305 CTGTGGGAATACAGGGGAGACGG + Intronic
907389884 1:54151404-54151426 CTGTGGGTAGGGCTGGGAGAAGG - Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
909431609 1:75593842-75593864 GTCAGGGGATGGAGGGAAGAGGG + Intronic
911685194 1:100767713-100767735 CTGTGAGTATGCAGAGAAAAAGG + Intergenic
911856365 1:102882136-102882158 CCTTGGCTATGGAGTGAAGATGG - Intronic
912451679 1:109771012-109771034 CCACGGGTATGGAGGGGAGAGGG + Intronic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912922029 1:113877959-113877981 CTGTGGGTATGGAATTGAGAAGG + Intergenic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
912993061 1:114508731-114508753 CTATGGGAATGGAGGGATGGGGG - Intronic
913501783 1:119478401-119478423 CTGTTAGAATGGAGCGAAGAAGG + Intergenic
913610527 1:120505711-120505733 CTGTGGGTTTGGAGTTAAGCTGG + Intergenic
914580663 1:149016528-149016550 CTGTGGGTTTGGAGTTAAGCTGG - Exonic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
915457501 1:156050662-156050684 CTGTGGGAATGACAGGAAGAGGG - Intronic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
915916086 1:159941828-159941850 CTGTGGGAATGGATGAAAGCGGG - Intronic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
916738884 1:167631080-167631102 CTGTGTGTATGGAGGTATGCTGG + Intronic
916772276 1:167922511-167922533 GTGTAGGTAGGGAGAGAAGAAGG + Intronic
917109366 1:171529401-171529423 CTGTGGGTATGCAGGAAAGGTGG - Intronic
917135718 1:171786441-171786463 CTGAGGGTATAAATGGAAGAGGG + Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
920176471 1:204104860-204104882 CTGTCGTTGTGGAGGGAGGAAGG + Intronic
920180175 1:204127550-204127572 CTTTGAGGATGGAGAGAAGACGG - Exonic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
921707862 1:218345158-218345180 CTGTGGGTAAGGGAGGAAGGAGG - Intergenic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
1063015582 10:2073749-2073771 ATGTGGGTATGGAGTCAAGGTGG - Intergenic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1065274154 10:24068273-24068295 CTGAGGGTGTGGAGCTAAGATGG - Intronic
1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG + Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067268349 10:44767133-44767155 CTGTGGCTTTGGAGATAAGAGGG + Intergenic
1068100545 10:52547207-52547229 CCATGGGTATGGAGGGCTGACGG - Intergenic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1069818664 10:71214251-71214273 CTTTGGCTATGGAGGGGGGAAGG - Intronic
1070127158 10:73631811-73631833 TTATGGGAATGGAGGGAAAAAGG - Exonic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071856104 10:89626047-89626069 CTGTAGGCATGAAGGGGAGAAGG - Intronic
1073176401 10:101560074-101560096 CTGTGGGGCTGCAGGGAAGGGGG - Intergenic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1074883384 10:117675931-117675953 CTGGGGGTAGGGAGGAGAGAAGG - Intergenic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076097393 10:127742983-127743005 CTTTAGGTATGGAGGGTAGGGGG - Intergenic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1076772667 10:132675055-132675077 CTTTGGGTATGGAGGACTGAGGG - Intronic
1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG + Intronic
1077009606 11:374339-374361 CTGTGGGGATGGACGGGGGAAGG + Intronic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077077480 11:708099-708121 CTGTTGGTATGGAGGGTCAAGGG - Intronic
1077195625 11:1278648-1278670 GTGTGGGTGTGGAGGAAAGGTGG - Intronic
1077283158 11:1754496-1754518 ATGTGGGGATGGAGGGATGGAGG + Intronic
1077358241 11:2128413-2128435 CTGTGGGGATGGAGGGACAGGGG - Intergenic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078085544 11:8231257-8231279 CTGTGTGTATGTTGGGAAGCTGG - Intronic
1078197309 11:9146696-9146718 TTGTGGGTATGCAGGGAGGGAGG + Intronic
1078919892 11:15819980-15820002 CTGTGGGTGTGGAGTCAAGCAGG - Intergenic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1079642822 11:22828618-22828640 GTGTGGTTATCAAGGGAAGAGGG + Intronic
1080041522 11:27764205-27764227 CTCTGGACATGGAGGGAATAAGG - Intergenic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1080389689 11:31833636-31833658 CTGTGGGTTTGAGGTGAAGAGGG + Intronic
1080445207 11:32331855-32331877 CTGGGGGTGTGGGGGGAATATGG + Intergenic
1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG + Intergenic
1082273774 11:50199892-50199914 TTATGGGTATGGAGCCAAGATGG - Intergenic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1084067885 11:66715802-66715824 CTGTGGTCATGAAGGGAAGTGGG - Intronic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085283721 11:75346714-75346736 GCCTGGGTATGGAGAGAAGAGGG - Intronic
1085305325 11:75482517-75482539 CTGTGGGGATGGCGAGAAAAGGG - Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1085904947 11:80749149-80749171 ATGTGGGTTTACAGGGAAGATGG + Intergenic
1086209187 11:84297721-84297743 CTGGGGGCATGGAAGGAAGTCGG - Intronic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1088321604 11:108560015-108560037 GTGTGGGTAGGGTGGGAAGGAGG - Intronic
1089004034 11:115075772-115075794 CTGTGGGTATAGGGTCAAGATGG + Intergenic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089275969 11:117336384-117336406 CGGTGGGTATGGAGGAAGGTGGG + Intronic
1089350045 11:117816995-117817017 CTGTGGGCATGGGGGCAGGAGGG - Intronic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1089791363 11:120946970-120946992 AAGTTGGTATGGAGGGAAAATGG - Intronic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1090903565 11:131053717-131053739 CTCTTGGTATTGAGGGAAGGTGG - Intergenic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1091828666 12:3534035-3534057 AGGTGGGCAAGGAGGGAAGAAGG + Intronic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG + Intronic
1092354699 12:7784846-7784868 CTGAGGGTAGGGTGGGAAGGAGG + Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1093090311 12:14913093-14913115 TTGTGAGTATGGGGGAAAGATGG + Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1094763413 12:33561706-33561728 GTGTGGGCATGGTGGGATGATGG - Intergenic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1096496167 12:52040620-52040642 CTGTGGGTATGATGGGAAGCAGG - Intronic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1097081150 12:56432026-56432048 CTGTGGATATGCTGGGCAGAGGG + Intronic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1100014028 12:89987234-89987256 GTGTGGGTATGGAGAGACGAAGG + Intergenic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1102033938 12:109760346-109760368 CTCCGGTTATGGAGGAAAGAGGG + Intronic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG + Intronic
1104274965 12:127318308-127318330 CTGTGGGGATGCAGTGAGGATGG - Intergenic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105225108 13:18424758-18424780 CTTTAGGTGTGGAGGGAAAAGGG - Intergenic
1105406889 13:20140628-20140650 GTGTGGGCATGGCTGGAAGACGG - Exonic
1105672920 13:22640814-22640836 CTGTGACTATTGAGGAAAGACGG - Intergenic
1105940970 13:25147692-25147714 CTGGGGGTAGGGAGGGAATCAGG + Intergenic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1106884270 13:34166658-34166680 CTGTGGGTATGTGGAAAAGAAGG + Intergenic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1107598466 13:41988294-41988316 CTGTGGTTATGGCAGGTAGAAGG - Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1114756845 14:25269360-25269382 CTGTGGGGATGGAGGGATTGTGG + Intergenic
1117074787 14:52091046-52091068 CTGTGGGTCTGGGGTCAAGAGGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119415018 14:74464164-74464186 TTGTGGGTAGGGAGTGAAAAAGG + Intergenic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1120121068 14:80680632-80680654 ATGTGGGTATGGACTGCAGAGGG - Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1121088795 14:91167204-91167226 CTCTGGGTATGGTGGGAGAAGGG - Exonic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1122981534 14:105194359-105194381 CTTGGGGGATGGAAGGAAGAGGG - Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1128997954 15:72310519-72310541 CTCTGGCTATGGTGTGAAGAAGG - Intronic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1129980554 15:79865643-79865665 CTGAGGGTAAGCAGGGATGAGGG - Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130921306 15:88347362-88347384 TTGTGAGTCTGGAGGGAACAAGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132471217 16:104435-104457 CTATGGGTATGGAGAAATGAGGG + Intronic
1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG + Intronic
1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133256316 16:4518545-4518567 ATGTGGATATGGAGGGGTGAGGG - Intronic
1133319580 16:4904656-4904678 CTGTGGATAGGGAGGAAACAGGG + Intronic
1133413525 16:5588198-5588220 CTGTGGGAATGGGGGGATGGGGG + Intergenic
1133997741 16:10761165-10761187 CTGTAGGGATGTAGGGATGATGG + Intronic
1134045271 16:11096391-11096413 CTGTGGTTATCCAGGGAAGTGGG - Intronic
1134453015 16:14374813-14374835 TTGGGGTCATGGAGGGAAGAAGG + Intergenic
1134540657 16:15062192-15062214 ATGTGGGTATGTTGGTAAGAAGG - Intronic
1134694608 16:16214330-16214352 CTGGGGGTCTTCAGGGAAGAAGG + Exonic
1134787873 16:16961486-16961508 TTGTGGTTAAGCAGGGAAGAGGG - Intergenic
1134977228 16:18580307-18580329 CTGGGGGTCTTCAGGGAAGAAGG - Intergenic
1135861957 16:26064344-26064366 CTTAGGGTATAGAGGGTAGAAGG + Intronic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136366849 16:29812947-29812969 CTTGGGGTGAGGAGGGAAGAGGG - Intronic
1137445516 16:48529569-48529591 ATGTGGCCATGGAGGGAGGAGGG - Intergenic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1138365707 16:56474937-56474959 CTGTGGCTGTGAAGGTAAGAGGG + Exonic
1139028403 16:62848381-62848403 TTTGGGGGATGGAGGGAAGAGGG - Intergenic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG + Intergenic
1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG + Intronic
1143032259 17:3974297-3974319 CTGTAGAGATGGAGGCAAGAGGG - Intergenic
1143984074 17:10895958-10895980 CTGGGGGTAGGGAGGGCATAGGG + Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144094384 17:11886709-11886731 CTTAGGGGATGGAGTGAAGAGGG - Intronic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1148587376 17:48790669-48790691 TTGTAGGTGTGGTGGGAAGAGGG - Intronic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1150271569 17:63869311-63869333 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150275104 17:63892192-63892214 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150277243 17:63906953-63906975 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150615450 17:66767349-66767371 CTGCTGGTACGGAGTGAAGACGG + Intronic
1151104188 17:71593292-71593314 GTGTGTGTGTGGAGGGAATAGGG + Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152660067 17:81537945-81537967 CTGTGGATGTGGACGGAAGTGGG - Intergenic
1152795286 17:82303443-82303465 CTGTGGGTAAGGAAGGAAAGGGG + Intergenic
1154308915 18:13252780-13252802 CTGTGGATGTGGAGGGCCGACGG - Intronic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155788088 18:29927281-29927303 TTGTGGGTTTGGAGAGAAAAAGG + Intergenic
1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG + Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158497524 18:57969992-57970014 ATGTGGGTGTGGAGTGATGAAGG - Intergenic
1158906054 18:62012910-62012932 CTGTGGTTATGGAGAGAGCAGGG - Intergenic
1159365750 18:67464172-67464194 CTGGGGGTGTGGTGGAAAGATGG + Intergenic
1159784689 18:72698814-72698836 CTGTGACTCTGGAGGCAAGAAGG + Intergenic
1160179715 18:76623756-76623778 CTGTGTGCTTGGAGCGAAGAGGG + Intergenic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1161204436 19:3033721-3033743 CTGTGCTTAGAGAGGGAAGAGGG - Intronic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161913912 19:7214848-7214870 AGGTGGGGACGGAGGGAAGAAGG - Intronic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG + Intronic
1163288864 19:16365627-16365649 CTGTGGGTTTGCAGGGGATAGGG + Intronic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164588751 19:29494674-29494696 CGGGTGGTAAGGAGGGAAGAAGG + Intergenic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1166147616 19:40848380-40848402 CTGCGGGTATGGCGGGAGAAGGG + Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166437278 19:42778170-42778192 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166446988 19:42866615-42866637 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166453917 19:42924284-42924306 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166456389 19:42943566-42943588 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166466181 19:43032837-43032859 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166472325 19:43088905-43088927 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166483456 19:43192854-43192876 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166485926 19:43211941-43211963 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166493082 19:43275894-43275916 CTGTGTGTTTGCAGAGAAGATGG - Intergenic
1166566949 19:43771162-43771184 CTGGGTCTATGGAGGGAAGGAGG + Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1168375614 19:55876866-55876888 CTGTGGATATGGAGGACTGACGG + Intronic
1168387110 19:55973463-55973485 ATGTGGGAATGGTGGGATGAAGG - Intronic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
1168588434 19:57613707-57613729 CAGTGGCTATGGAGGGATGCTGG - Intergenic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925428289 2:3769439-3769461 CTGATGGAATGGAGTGAAGACGG - Intronic
925474699 2:4200073-4200095 TTTTGGGTATGGAGGAAAGTGGG + Intergenic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926197600 2:10773139-10773161 CTGTGTGTCAGGAGGGATGAAGG + Intronic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927964223 2:27259122-27259144 CTCTGTGTATGGAAGGAAAAGGG - Intronic
928111844 2:28516895-28516917 GCGTGTGTATGGAGGGGAGAGGG + Intronic
929212859 2:39377469-39377491 ATGTGGGTTTTGAGGGAAGTAGG + Intronic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
932335053 2:70925971-70925993 CTCTGAGTATCCAGGGAAGAAGG - Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932701330 2:73993979-73994001 CTGTGGGTGTGGTGGGTAGGTGG + Intronic
932740222 2:74285488-74285510 CTATGGATATGGAGGGACAATGG + Intronic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
934902097 2:98167576-98167598 CTGAGGGTCTGGAGGGACCAAGG + Intronic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935552698 2:104475227-104475249 CTGTGGGGACAGAGGGAATATGG - Intergenic
935726022 2:106024629-106024651 CTGAGGGTGTGGAGTCAAGAGGG + Intergenic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
936692753 2:114912489-114912511 CTGTGAGAAGGGAGGCAAGATGG + Intronic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937339164 2:121079968-121079990 CTGAGGGTCTGGAGGGTAGGAGG + Intergenic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
939464871 2:142544368-142544390 CTGTAGGTACGGTGGGAAGCAGG - Intergenic
940677811 2:156746560-156746582 TTCTGGGTGTGGAGGGAAAATGG - Intergenic
941268960 2:163401277-163401299 GTGTTGGTATGGAGGGTAGAAGG - Intergenic
941273244 2:163457150-163457172 CTGAGGGTAAAGAGAGAAGAGGG - Intergenic
941561855 2:167056801-167056823 ATATGGATATGGAGGGAAGGAGG - Intronic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
944732321 2:202529336-202529358 ATTTGGGTATGGAGGGAGGGTGG - Intronic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946184787 2:217974378-217974400 CTGAGGGGATGGAGGAAAGCAGG - Intronic
948127727 2:235576989-235577011 TTTGGGGTATGGAGGGAAGATGG - Intronic
948267376 2:236644887-236644909 CTGTGGTCATGGGGGCAAGATGG - Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948608645 2:239152757-239152779 CTGTAGGCATGGAGGCAAGGAGG + Intronic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1170935483 20:20805663-20805685 TTGTGGGTATGCAGGCAATAGGG + Intergenic
1171022879 20:21602698-21602720 CTGTGGGTAGGGAGGGCTGGAGG + Intergenic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1171188263 20:23138906-23138928 CCCTGGGTAAGGAGGGAAGCCGG + Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171978025 20:31607656-31607678 CTGCGGGTCTGGAGTGAAGGTGG + Intergenic
1172864541 20:38085691-38085713 CTTTGGGTCTGGAGAGATGAAGG - Intronic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1174039268 20:47687447-47687469 CTGGGGAAATGGCGGGAAGATGG + Intronic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1174394372 20:50237580-50237602 CTGTGGGTATGGATGGTGGCTGG + Intergenic
1174882175 20:54292014-54292036 CTGTGGGTTAGGTGGGGAGAGGG - Intergenic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175238161 20:57526810-57526832 GAATGGGTAAGGAGGGAAGAAGG + Intergenic
1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG + Intergenic
1177166769 21:17612637-17612659 CTGTGGGTATCGGGGGAGGGTGG - Intronic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1179229666 21:39489997-39490019 ATGAGGGTATGGAGAAAAGAAGG + Intronic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180173103 21:46071041-46071063 CTGTGGATTTGGAAGCAAGAAGG + Intergenic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180935167 22:19620670-19620692 CTGAGGGCATGGCGAGAAGACGG + Intergenic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181161164 22:20960748-20960770 GTGTGGGCAAGGAGGTAAGATGG - Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181954804 22:26580403-26580425 CCCTGGGTATCCAGGGAAGAAGG + Intronic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182074252 22:27484083-27484105 GTTTGGCTATGGAGGGAAGGAGG - Intergenic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1183359582 22:37376527-37376549 CTTTGGGCATGGAGGAAAGGAGG - Intronic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
1183509570 22:38227011-38227033 CGGAGGGGATGGAGGGACGAAGG + Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184268003 22:43360301-43360323 CTGTGGGTGGGGAGTGAAGCGGG + Intergenic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184707392 22:46224058-46224080 TTGTGGGTGTGGGTGGAAGAGGG - Intronic
1184924165 22:47625835-47625857 TGGTGGGTATGGAGGGACAAGGG - Intergenic
1184924195 22:47625930-47625952 GTGGGAGTATGGAGGGCAGAGGG - Intergenic
1184959466 22:47918563-47918585 CTGTGGGTGTGGAGGGAGTCTGG - Intergenic
1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG + Intronic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949676677 3:6462668-6462690 CTGTGTGTGTGTAGGGAACATGG - Intergenic
951537209 3:23751025-23751047 GTGTGGGTAGGGAGAGAGGAAGG - Intergenic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
953922342 3:46960853-46960875 TTGTGGGTATGGAGGTATAAAGG + Intronic
953925570 3:46980770-46980792 CTGTGGGTACAGAAGGAAAATGG - Intronic
954415268 3:50390394-50390416 CTGAGGGTATGAAGAGAACAGGG + Intronic
954466501 3:50658266-50658288 AGGTGGGTTTGGAAGGAAGATGG + Intergenic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
955884813 3:63586492-63586514 CTGGGGATAGGGATGGAAGAAGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957153416 3:76516286-76516308 GTGTGGGTATGGAGGTAGGATGG - Intronic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
958537168 3:95418558-95418580 GTGTGGGTAGGGAGGGAACCCGG + Intergenic
960538148 3:118835487-118835509 CTTTTGCTATGGAGGGAAGGAGG - Intergenic
961012694 3:123447135-123447157 CTGTGGGAATGCAGTGAGGAAGG - Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962422449 3:135240423-135240445 GTGTGGGATTGGAGGCAAGAAGG + Intronic
962525146 3:136231238-136231260 CTGTAGGTCTGAAGTGAAGAAGG - Intergenic
963237617 3:142971190-142971212 ATGTGGGTAGGGAAGGAAAATGG + Intronic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
966822459 3:183935839-183935861 CTTTGGGTATTGAGGTAATAAGG - Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG + Intronic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG + Intronic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
971132525 4:23828478-23828500 CTGTGGGTTTGGTGTGAGGAGGG + Exonic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
976077090 4:81312144-81312166 CTGAGGATTTGGAGGCAAGAAGG + Intergenic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
979346915 4:119598836-119598858 CTGGGGGGTTGGAAGGAAGATGG + Intronic
979841241 4:125443393-125443415 CTGAGGGAATGTAGTGAAGACGG - Intronic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
983534480 4:168842756-168842778 ATGAGGGCATGGAGAGAAGACGG - Intronic
983565733 4:169149654-169149676 TTGTGGGTAAGTTGGGAAGAGGG - Intronic
983964455 4:173792461-173792483 CTGTGGGCTTTGAGGGCAGAGGG + Intergenic
984874733 4:184357020-184357042 CTGTGGGGATGCAGCAAAGATGG + Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
985968949 5:3360347-3360369 CAGTGGGTATTTAGGGAGGAAGG - Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
986713957 5:10509141-10509163 ATGTGGTTATGGTGGGAAGAAGG - Exonic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
988034790 5:25813288-25813310 CTGTGGGGGTGGAGGAAATAGGG - Intergenic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
990700325 5:58467956-58467978 AGTTGGGTATGGAAGGAAGAGGG - Intergenic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
991991479 5:72344144-72344166 CTGTGGGGTTGGAGGGAATGAGG + Intronic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993275399 5:85850501-85850523 CTGTGGTTATGCAGGGCAGGGGG + Intergenic
993971341 5:94423178-94423200 CTGGGGGGTTGGAGGGATGAAGG + Intronic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
996103489 5:119470292-119470314 GTGTGGGCATGGTGGGATGATGG + Intronic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
997639938 5:135442546-135442568 CTGTAAGGATGGAGGGAGGAGGG - Intergenic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998385412 5:141754510-141754532 CTGGGGGTATGGAGGAACCAAGG - Intergenic
998778865 5:145633903-145633925 CTATGGGAATGCAGGGAACATGG - Intronic
999269631 5:150289328-150289350 CAGTGTGTATGTAGGGATGAAGG - Intronic
999434302 5:151551191-151551213 CTATGGGTATAGGGGGATGATGG - Intronic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002599930 5:180348295-180348317 CTGTGTGTGTTGGGGGAAGAGGG + Intronic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003860680 6:10319418-10319440 CCGTGGGGATGGAGGGATGTGGG + Intergenic
1003860777 6:10319750-10319772 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003860787 6:10319780-10319802 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1005127880 6:22469845-22469867 CTGTGGGGAGGGAGGCAATAGGG + Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005639180 6:27778524-27778546 CTGTAAGTATGGAAGGAGGAGGG - Intergenic
1006089954 6:31622514-31622536 CTGGGGGAAAGGAGGGAACATGG + Intronic
1006519534 6:34563317-34563339 CTGAGGGTAGGGAGGGTAGTGGG + Intergenic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1007825413 6:44596191-44596213 CTAAGGATATGGAGGGAGGAAGG - Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007909467 6:45499047-45499069 GTGTGGGTATGGAGGAGAGTGGG + Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1010176502 6:73033717-73033739 GGGTGGGTATGGGGGGAAGGGGG - Intronic
1010898480 6:81396126-81396148 CTGTTGTTTTGGAGGGAATAAGG - Intergenic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1015503789 6:133960675-133960697 CTTTGGGTATAGAGGAAAAATGG + Intronic
1016521458 6:144951341-144951363 CTGTGGATACTGAGGGATGATGG - Intergenic
1016559909 6:145384410-145384432 GTGGGGGCATGGAAGGAAGAAGG + Intergenic
1017661916 6:156683351-156683373 CTTTGAGTGTGGAGAGAAGAGGG - Intergenic
1018869618 6:167770869-167770891 CTGTCTGGATGGAGGGAAGTGGG - Intergenic
1019103488 6:169650389-169650411 ATGAGGGGATGGAGGGATGACGG - Intronic
1019158938 6:170056885-170056907 CTGTAGGTGTGGGGGAAAGATGG - Intergenic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1023321282 7:39000508-39000530 CTGTGGGTATGTTGAGAAAATGG - Intronic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG + Intergenic
1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG + Intronic
1024858975 7:53815548-53815570 CTATGGGAAAGAAGGGAAGATGG - Intergenic
1025658888 7:63544614-63544636 CTTTGGATATGGAGGGAAATTGG - Intergenic
1026970217 7:74463119-74463141 CTGAGGGTAGGGAAGGAAGGTGG + Intronic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027966093 7:85010508-85010530 CTGTGGGTATGATGAGAAGTAGG + Intronic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029489224 7:100861369-100861391 CTGCGGGCATGGAGGGGAGGAGG - Intronic
1029676186 7:102070588-102070610 CTTTGGGTACGGAGGGAAATTGG + Intronic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1034277154 7:149828991-149829013 CTCCGGGTATGGAGGGAACCTGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034291234 7:149933254-149933276 CTATGGGGATGGTGGGGAGATGG - Intergenic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG + Intronic
1034814864 7:154163677-154163699 CTATGGGGATGGTGGGGAGATGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG + Intergenic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035693093 8:1572586-1572608 CTGCTGGTATGGAGAGGAGAGGG + Intronic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG + Intronic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG + Intergenic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG + Intronic
1038452801 8:27650730-27650752 TTGTTGGCATGGAGGAAAGAGGG - Intronic
1039045907 8:33449200-33449222 CTGTGGGCACTGAGAGAAGAAGG + Intronic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039617298 8:38966297-38966319 CTTTGGGGATGGGGGGATGAGGG + Intronic
1041618316 8:59934358-59934380 CTGTGGATATCTGGGGAAGAGGG + Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1043424310 8:80133445-80133467 ATCTGGTTTTGGAGGGAAGAAGG - Intronic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1044727665 8:95206632-95206654 CTGTTGGGAAGGAGGAAAGAGGG - Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1046212293 8:111092706-111092728 CTGTGGATATGGAAGCAAAAGGG - Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1048905457 8:139083926-139083948 CTGTGGGGAATGAGGGAATAAGG - Intergenic
1049335069 8:142079933-142079955 CTGCAGGTATGGAGGGCACACGG + Intergenic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG + Intronic
1052197894 9:25740373-25740395 GTGTGTGTATGGAGTGGAGAGGG + Intergenic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053307658 9:36995548-36995570 CTGTGAGAATGGAGGAAAGGAGG + Intronic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053728822 9:41031572-41031594 CTGTTGGGGTGGAGGGAACATGG + Intergenic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1054254169 9:62748066-62748088 CTATTGGTATGGAGGACAGAAGG - Intergenic
1054568234 9:66782236-66782258 CTATTGGTATGGAGGACAGAAGG - Intergenic
1054699688 9:68400511-68400533 CTGTTGGGGTGGAGGGAACATGG - Intronic
1056592178 9:87972638-87972660 CTGTGGCTATGGAGAGCAGTGGG + Intronic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057307435 9:93920459-93920481 CTGGGGGTCAGGAGTGAAGAAGG + Intergenic
1057611724 9:96550207-96550229 AGGTGGGTAGGAAGGGAAGAGGG - Intronic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1058777598 9:108300354-108300376 CGGTGGGCATGGAGGCATGATGG - Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059915320 9:119093289-119093311 CTGTGGGGATGGAAGGATGGAGG + Intergenic
1060025605 9:120168228-120168250 GGGTGGGTATGCAGAGAAGAGGG - Intergenic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1060820950 9:126661425-126661447 CTCTGGGTATGGTGGGTGGAGGG + Intronic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG + Intronic
1061659354 9:132118380-132118402 CTGTTGTTATGAAGGGAAGATGG - Intergenic
1062005030 9:134234793-134234815 CCAAGGGTATGGCGGGAAGAGGG - Intergenic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187391359 X:18888436-18888458 CTGTGTGTCAGGAGTGAAGAGGG - Intergenic
1187600602 X:20825139-20825161 CTGGGGGTAGGGAGTGGAGAAGG - Intergenic
1188473868 X:30569345-30569367 GTGTGGGTATGTAGGGGAAATGG + Intronic
1191073016 X:56421765-56421787 CTGGGGGGATGGAGCCAAGATGG - Intergenic
1192268728 X:69558337-69558359 CTTTGGGTCTGAAGGCAAGATGG + Intergenic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195740545 X:108060888-108060910 CCAGGGGTATGGAGGGAACAGGG - Intronic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1195968075 X:110447450-110447472 GTGTGGGGATGTAGGGGAGATGG + Intronic
1196794797 X:119493542-119493564 CTGTGGGTGGCGAGGGAACAGGG - Intergenic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198146171 X:133859517-133859539 GTGTGGGTAGGGAGAGATGAAGG + Intronic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199264872 X:145818178-145818200 CAGTGGGGATTGAGGGTAGAGGG - Exonic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic