ID: 923369339

View in Genome Browser
Species Human (GRCh38)
Location 1:233295281-233295303
Sequence CGGGGAGCTGTGGGTATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 272}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923369339_923369359 15 Left 923369339 1:233295281-233295303 CCCTCCATACCCACAGCTCCCCG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 923369359 1:233295319-233295341 CACTCACCAGGTGCAGGGCCAGG 0: 1
1: 1
2: 1
3: 46
4: 369
923369339_923369361 17 Left 923369339 1:233295281-233295303 CCCTCCATACCCACAGCTCCCCG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 923369361 1:233295321-233295343 CTCACCAGGTGCAGGGCCAGGGG 0: 1
1: 0
2: 2
3: 28
4: 359
923369339_923369354 9 Left 923369339 1:233295281-233295303 CCCTCCATACCCACAGCTCCCCG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 923369354 1:233295313-233295335 CCTCCCCACTCACCAGGTGCAGG 0: 1
1: 1
2: 3
3: 28
4: 347
923369339_923369363 27 Left 923369339 1:233295281-233295303 CCCTCCATACCCACAGCTCCCCG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 923369363 1:233295331-233295353 GCAGGGCCAGGGGCAGCAGCAGG 0: 1
1: 7
2: 41
3: 340
4: 1631
923369339_923369364 30 Left 923369339 1:233295281-233295303 CCCTCCATACCCACAGCTCCCCG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 923369364 1:233295334-233295356 GGGCCAGGGGCAGCAGCAGGAGG 0: 1
1: 2
2: 15
3: 187
4: 1256
923369339_923369355 10 Left 923369339 1:233295281-233295303 CCCTCCATACCCACAGCTCCCCG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 923369355 1:233295314-233295336 CTCCCCACTCACCAGGTGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 294
923369339_923369351 3 Left 923369339 1:233295281-233295303 CCCTCCATACCCACAGCTCCCCG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 923369351 1:233295307-233295329 CCGGACCCTCCCCACTCACCAGG 0: 1
1: 0
2: 2
3: 31
4: 252
923369339_923369360 16 Left 923369339 1:233295281-233295303 CCCTCCATACCCACAGCTCCCCG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 923369360 1:233295320-233295342 ACTCACCAGGTGCAGGGCCAGGG 0: 1
1: 0
2: 3
3: 33
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923369339 Original CRISPR CGGGGAGCTGTGGGTATGGA GGG (reversed) Intronic
900401701 1:2475435-2475457 GGGGCAGCTGTGGGAATGGGAGG - Intronic
900546226 1:3230769-3230791 CGGGCAGGTGTGGGGAAGGAAGG - Intronic
900685204 1:3943966-3943988 CGGGGACGTGCGGGTGTGGAGGG - Intergenic
903816367 1:26067106-26067128 GGGGGAGCTGTGGGCAGGGCAGG + Intronic
904358060 1:29954243-29954265 TGGGGAGCGGGGGGAATGGAGGG + Intergenic
905670372 1:39787255-39787277 CGGGGAGCTGTGGGGCTGAGAGG - Intronic
906102438 1:43272168-43272190 GGAGGAGCTGTGGGGATGGAGGG - Exonic
910977041 1:92917737-92917759 CAGAGAGCTGTGGGAATGGGAGG + Intronic
912679434 1:111719847-111719869 CAGGGAGCTGAGGCTATGCAGGG + Intronic
912863038 1:113232067-113232089 CGGTGAGCTGAGGGGATGGTGGG + Intergenic
914777886 1:150754783-150754805 GTGGAAGCTGTGGATATGGAGGG + Intronic
915351894 1:155232183-155232205 CTGAGACCTGGGGGTATGGATGG + Intergenic
916793663 1:168146139-168146161 CGGGGAGGGGTGGGGAGGGACGG + Intergenic
916793674 1:168146159-168146181 CGGGGAGGGGTGGGGAGGGACGG + Intergenic
916831021 1:168491245-168491267 CGGGGAGCGTTGGGTGTCGAGGG - Intergenic
918151019 1:181798395-181798417 CAGGGAGCTGTAGGAAAGGAGGG - Exonic
918405085 1:184204264-184204286 CTGGGACCTGTGGGTATGGTAGG + Intergenic
920825877 1:209423864-209423886 GGGGGAGGTGTGGGGGTGGAAGG + Intergenic
920826831 1:209430550-209430572 CGGGGTGCCGAGGGTCTGGAGGG + Intergenic
921830503 1:219723190-219723212 CTGGTATCTGTGGGTATGGGTGG + Intronic
922547793 1:226471542-226471564 TGGGGAGCTGTGGGGTAGGAAGG + Intergenic
922752088 1:228075007-228075029 CAGAGGGCTGTGGGTATGGGGGG + Exonic
923364835 1:233248915-233248937 CAGGCAGCTGTGGAAATGGAAGG + Intronic
923369339 1:233295281-233295303 CGGGGAGCTGTGGGTATGGAGGG - Intronic
1062774772 10:135720-135742 CGGGGAGCTTTGTGGATGGCGGG + Intronic
1063128359 10:3155129-3155151 GGTGGAGCGGTGGGCATGGAGGG - Intronic
1063563456 10:7150479-7150501 TGGGGAGCTCCGGGTATGAATGG - Intergenic
1066048406 10:31614208-31614230 CAGTGAGCTGAGGGTCTGGAGGG + Intergenic
1067281836 10:44879255-44879277 CGGGGAGCTGAGGGAAGGGAAGG - Intergenic
1067298626 10:44990508-44990530 CGGGGAGCTGCGGGAAGGGAAGG + Intronic
1069678995 10:70270415-70270437 GGGGGATCTGTGGGTATGGATGG + Intronic
1070626915 10:78057620-78057642 TGGGGAAGTGTGGGTGTGGATGG + Intergenic
1070791344 10:79191261-79191283 TGGGGAGCTGGGGGTAGGGAGGG + Intronic
1070918154 10:80168014-80168036 GGGGAACGTGTGGGTATGGAAGG + Intronic
1073035723 10:100562973-100562995 CGGGGAGGTGGGGGTGTGGGTGG + Intergenic
1073435071 10:103511265-103511287 GGGGGAGCTCTGGGTCTGCAGGG + Intronic
1074404135 10:113165899-113165921 CAGGGAGCTGTGGGAATGTAAGG - Exonic
1074824196 10:117202739-117202761 GGGGGAGCAGTGGGTCTGCAGGG + Intronic
1075471638 10:122695129-122695151 AGGGGAGCTGTGGCTCTGAAAGG + Intergenic
1075982080 10:126748748-126748770 AGGGGAGCTGTGGCTCTGGATGG - Intergenic
1076156246 10:128207762-128207784 CAGGGAGCTGTGGGTATTGGTGG - Intergenic
1076688202 10:132207716-132207738 CGGGGAGCTGGGGCCATGGATGG - Exonic
1076839886 10:133040678-133040700 CGGGGGGCTGTGGGTGAGGTGGG + Intergenic
1076937807 10:133577274-133577296 CGGGGTGCTGTGGGACTGGGGGG - Intergenic
1076980923 11:204296-204318 CAGGGAGAGGTGGGTAGGGAGGG + Exonic
1077035254 11:491385-491407 CGGGGAGCTGGGGGGAGGGCTGG - Exonic
1077212024 11:1375488-1375510 GGGTGAGCTGGGGGTATTGAGGG + Intergenic
1077327082 11:1968555-1968577 CGGGGTGCTGTGGGGATGCAAGG + Intronic
1077480858 11:2813850-2813872 CGGGGAGCTGCAGGGAGGGAGGG + Intronic
1078611076 11:12820026-12820048 CAGGGAGTTGTGGGGAGGGAGGG + Intronic
1079643026 11:22830005-22830027 GGCGGAGCTGTGGGTGAGGAAGG - Intronic
1080196920 11:29622085-29622107 CAGGTAATTGTGGGTATGGAGGG - Intergenic
1082006514 11:47422368-47422390 CTGGCAGCTGTGGGAATGAATGG + Intronic
1082868090 11:57918065-57918087 TGTGGAGCTGTGGGTCTGCATGG + Intergenic
1083659157 11:64244307-64244329 TGGGGAGCTGTGGGGGTGGGGGG - Intergenic
1085076387 11:73596782-73596804 CCTGGAGCTGTTGGTATGGATGG - Intronic
1085163547 11:74373297-74373319 GGGGGAGGTGTGGGTGAGGAAGG + Intronic
1089348761 11:117809307-117809329 GTGGGAGCTGTGGGAAGGGAGGG + Intronic
1089648277 11:119894684-119894706 CAGGCAGGTGTGGGTAGGGATGG + Intergenic
1090804849 11:130196502-130196524 CGGGGGGCTGGGGGTCTGGTGGG - Intronic
1091301337 11:134510014-134510036 CTGGGAGCTGAGGATGTGGAGGG - Intergenic
1202810064 11_KI270721v1_random:23735-23757 CGGGGTGCTGTGGGGATGCAAGG + Intergenic
1092138097 12:6163667-6163689 GGATGAGCTGTGGGTATGGCAGG - Intergenic
1092324772 12:7518776-7518798 TGGGGAGCTGGGGGTAAGGTGGG - Intergenic
1094461926 12:30705235-30705257 GTGGGACCTGTGGCTATGGAGGG - Intergenic
1095953418 12:47793797-47793819 CGGGGAGCTGGTGGAATGGGTGG - Intronic
1095964636 12:47858582-47858604 GGGGCAGCTGTGGGGGTGGAGGG + Intronic
1097727763 12:63094232-63094254 GGGGGAGGGGTGGGGATGGAAGG + Intergenic
1101883417 12:108641347-108641369 TGGGGAGCTGTAGGTGGGGATGG + Intergenic
1102805383 12:115775000-115775022 CTGGTAACTGTGGATATGGATGG - Intergenic
1102877312 12:116458509-116458531 GGGGGGGCTGGGGGGATGGAGGG - Intergenic
1103441879 12:120969070-120969092 GGGTGAGGTCTGGGTATGGAGGG + Intergenic
1106228061 13:27799916-27799938 CGGGCAGTAGTGGGTAAGGAAGG + Intergenic
1107378405 13:39829547-39829569 AGGGTAGGTGTGGTTATGGAAGG + Intergenic
1107658402 13:42614865-42614887 CAGGGAGCTGTAGGTGTGGGAGG + Intergenic
1109820717 13:67649837-67649859 CTGGAAGCTATGGATATGGAGGG + Intergenic
1109924373 13:69115810-69115832 AGGGGAGGTGTGGGCAGGGAAGG + Intergenic
1111291540 13:86177501-86177523 GTGGAAGCTGTGGATATGGAGGG + Intergenic
1113572991 13:111372011-111372033 CGGGGAGCAGGAGGTGTGGAGGG - Intergenic
1113591717 13:111506199-111506221 CGTGGAGCTGTGGCCCTGGAAGG + Intergenic
1116800591 14:49439480-49439502 GAGGGAGCTTTGAGTATGGAGGG + Intergenic
1117481582 14:56151128-56151150 CGGGGTGCTGTGGGCAGGAATGG - Intronic
1119667686 14:76496872-76496894 CAGGGAGCTTTGGGGATGGCTGG - Intronic
1121044948 14:90780987-90781009 CGGGGAGCTGTGGGGTTTTACGG - Intronic
1121320426 14:92988627-92988649 AGGGGAACTGGGGGTGTGGAAGG + Intronic
1121857003 14:97279642-97279664 TGTGGAGCTGTGGGTATGTGAGG + Intergenic
1122278104 14:100605513-100605535 CTGGGGGCTGGGGGTATGGAGGG + Intergenic
1122416615 14:101552812-101552834 TGGGGAGCTTCGGATATGGAGGG - Intergenic
1122770084 14:104093943-104093965 GGCGGGGCTGTGGGTATGGGCGG + Intronic
1122803440 14:104244684-104244706 CAGGCAGCTGTGTGCATGGAAGG - Intergenic
1122866041 14:104604384-104604406 GGGGGCGCTGGGGGCATGGAAGG + Intronic
1123467943 15:20530009-20530031 CTGAGAGCTGTGGGTAGGGAAGG + Intergenic
1123650170 15:22471033-22471055 CTGAGAGCTGTGGGTAGGGAAGG - Intergenic
1123728257 15:23125218-23125240 CTGAGAGCTGTGGGTAGGGAAGG + Intergenic
1123740576 15:23279875-23279897 CTGAGAGCTGTGGGTAGGGAAGG - Intergenic
1123746422 15:23322683-23322705 CTGAGAGCTGTGGGTAGGGAAGG + Intergenic
1124117708 15:26862873-26862895 AGCGAAGCTGTGGGTATGCAGGG + Intronic
1124278689 15:28346000-28346022 CTGAGAGCTGTGGGTAGGGAAGG + Intergenic
1124304011 15:28565608-28565630 CTGAGAGCTGTGGGTAGGGAAGG - Intergenic
1124532892 15:30522083-30522105 CTGAGAGCTGTGGGTAGGGAAGG - Intergenic
1124765764 15:32485561-32485583 CTGAGAGCTGTGGGTAGGGAAGG + Intergenic
1125076902 15:35630123-35630145 CGGGGAGCTGTGGCAAAAGAGGG + Intergenic
1125852894 15:42921092-42921114 CGGGGAGTTGCGGCTATGGCTGG - Intergenic
1126376812 15:48005269-48005291 TGGGGAGGTGTGGGTGTAGATGG - Intergenic
1126443708 15:48719136-48719158 TGGGGAGCTCTGGGGAAGGATGG + Intronic
1127260332 15:57322740-57322762 CACGGAGCTGGGGGCATGGAAGG + Intergenic
1127657728 15:61071526-61071548 GGGGAAGCGGTGGGGATGGAAGG + Intronic
1127702497 15:61514707-61514729 TGGGGAGCTCTGGGGCTGGATGG + Intergenic
1128474732 15:67987634-67987656 AGAGGAGCTGTAGGTATGGGGGG + Intergenic
1128565689 15:68699353-68699375 AGGGGACCTGTGTGGATGGAGGG + Intronic
1129229459 15:74188788-74188810 GGGGGAGCTGAGGGTGGGGAAGG - Intronic
1129826156 15:78636387-78636409 CTGAGAGTTGTGGGTAGGGAAGG - Intronic
1132310459 15:100853910-100853932 CAGGGAGCTGGGGGCAGGGAGGG - Intergenic
1132887870 16:2190350-2190372 CCAGGAGCTCTGGGGATGGAAGG + Exonic
1133221621 16:4321379-4321401 AGGGGAGGGGTAGGTATGGAGGG - Intronic
1133994794 16:10740193-10740215 GGTGGATCTGTGGGTCTGGATGG + Intergenic
1133994813 16:10740259-10740281 GGTGGATCTGTGGGTCTGGATGG + Intergenic
1135627260 16:24006827-24006849 CGGGGAGCAGGGGGTGGGGAGGG + Intronic
1136534662 16:30892796-30892818 CGGGGGGCTGTGGGGACTGAAGG - Intronic
1139504503 16:67392309-67392331 CGGAGGGCTGTGGGTGTGGGGGG - Intronic
1139547883 16:67658172-67658194 TGGGGAGCTGGGGGTACGGCTGG + Exonic
1142434593 16:90048042-90048064 CGGGGGGATGGGGGGATGGAGGG + Intergenic
1143564993 17:7715863-7715885 TGGGGAGCTGTGGGAATGGCCGG + Intergenic
1143984072 17:10895951-10895973 CAGGGTGCTGGGGGTAGGGAGGG + Intergenic
1144038409 17:11387451-11387473 GGAGGAGCTGTGGGGCTGGAGGG + Intronic
1144727337 17:17508386-17508408 AGGGGGGCTGTGGGTCTGGCTGG - Intronic
1144951118 17:18993985-18994007 GAGGGAGCTGTGGGTCTGGTGGG - Intronic
1145055217 17:19698781-19698803 GCAGAAGCTGTGGGTATGGAGGG - Intronic
1145960703 17:28885088-28885110 AGTGTAGGTGTGGGTATGGAAGG + Intronic
1146565466 17:33909232-33909254 AGAGGAGCTGTGGGGATGTAAGG + Intronic
1146656119 17:34636224-34636246 CAGGGAGTTGGTGGTATGGAAGG + Intronic
1146925104 17:36739106-36739128 CAGGGAGCTGGGGGTAGGGAGGG + Intergenic
1146931322 17:36780184-36780206 GGGGGAGCTGTGGCTAAGAAAGG - Intergenic
1147159686 17:38562817-38562839 CGGGGACCTCCGGGTATGGCTGG - Exonic
1148666932 17:49382039-49382061 CTTGGAGCTGTGGGTGTAGATGG - Intronic
1149597779 17:57874390-57874412 CGTGGAGATGTGAGTGTGGAAGG + Intronic
1152231780 17:79117529-79117551 GGGGGATGTGTGGGTGTGGAGGG - Intronic
1152397629 17:80043987-80044009 AGGGGAGATGGGAGTATGGAAGG + Intronic
1152542635 17:80984052-80984074 CGGGGGGAAGTGGGGATGGAAGG + Intergenic
1152896442 17:82914082-82914104 CGGGGAGCAGTGGGTGTGGTGGG - Intronic
1152926286 17:83089220-83089242 CAGGGAGCAGTGGGTAGGGGTGG - Intronic
1153617475 18:6947900-6947922 AGGGGAGCTGAGGCCATGGAGGG + Intronic
1154355022 18:13618327-13618349 AGGGGCGCTGTGGGTTGGGATGG + Intronic
1158537740 18:58323022-58323044 CTGTGTGCTGTGGGTATGGGTGG + Intronic
1158537752 18:58323060-58323082 CTGTGTGCTGTGGGTATGGGTGG + Intronic
1158537764 18:58323098-58323120 CTGTGTGCTGTGGGTATGGGTGG + Intronic
1159327071 18:66936116-66936138 TGGTGAGCTGTGGGTAAGCATGG + Intergenic
1160722810 19:604776-604798 TGGGGAGCTGTGGATTTGGGGGG + Intronic
1160722845 19:604871-604893 GTGGGGGCTGTGGGTTTGGAGGG + Intronic
1160845174 19:1163115-1163137 CGGGTAGATGTGAGTCTGGAGGG - Intronic
1161594555 19:5144486-5144508 CGGTGAGCTGTGGGGGTGGGCGG + Intronic
1164609240 19:29621070-29621092 CGGGGGGCTGTGGCTGTGGCTGG - Intergenic
1164995904 19:32720287-32720309 CTGGGAGGAGTGGGTGTGGAGGG - Intronic
1165007807 19:32820761-32820783 TGGGCAGCAGTGAGTATGGAAGG + Intronic
1166950873 19:46427391-46427413 CCAGGAGCTGGGGATATGGAAGG - Intergenic
1166953785 19:46448119-46448141 TGGGGAGCTGGGGGCCTGGAGGG + Intergenic
1167448551 19:49553918-49553940 CATGGAACTCTGGGTATGGAGGG + Intergenic
1168136461 19:54355463-54355485 CGAGGGGCTGTGGGGAGGGAGGG + Intronic
1168229230 19:55018387-55018409 CTGGGAGCAGTGCGTAGGGATGG + Intronic
1168531931 19:57137129-57137151 GGGGGAGTTGTGTGGATGGATGG + Intronic
925493760 2:4423770-4423792 CTGGGGGCTGTGGGGCTGGACGG - Intergenic
926008765 2:9392486-9392508 CCGGGAGCAGTGGGTCTGGGAGG + Intronic
926129288 2:10290816-10290838 GGGGAAGCTGTAGGTGTGGACGG - Intergenic
927245235 2:20952290-20952312 GGGGGAGCTTTGGGCACGGAGGG - Intergenic
927522795 2:23710623-23710645 GGGGAACCTCTGGGTATGGAGGG - Intergenic
928436378 2:31257217-31257239 CTCAGAGCTGTGGGTAGGGAGGG - Intronic
929998272 2:46843210-46843232 TGGGGAGGTGTGTGTGTGGAAGG + Intronic
931184351 2:59935214-59935236 GGGGGAGCTCTGGGTATGCTCGG + Intergenic
932366302 2:71155599-71155621 CCGAGAGTTGTGGGTAGGGAAGG - Intergenic
934819239 2:97357598-97357620 TGGGGAGATGTGACTATGGAGGG + Intergenic
934860573 2:97760967-97760989 CGGGGAGGTGTGGGGCTGGCAGG + Intronic
935310460 2:101778143-101778165 AGGGGACCTGTGGGTCTGGGGGG + Intronic
936053011 2:109239813-109239835 CTGTGAGCTGTGGGGATGAAAGG - Intronic
936346242 2:111677539-111677561 GGGGGAGGTGTGGGGATGGGCGG - Intergenic
938729652 2:134136757-134136779 AGGGGAGCAGTGGGTGTGCAGGG - Intronic
939172217 2:138709446-138709468 GGGGCAGCTGTGGGTAGGGAGGG - Intronic
940987730 2:160064991-160065013 CTGGGAGCTGTGGGTGTGTGGGG + Intergenic
943488432 2:188518496-188518518 TGGGGTGGTGTGGGTATGGGAGG + Intronic
944506842 2:200421245-200421267 CTGGGAGCATTGGGTATTGAAGG + Intronic
946227419 2:218271432-218271454 TGGGGAGCTGTGGCTTTGCAGGG - Exonic
946285179 2:218697388-218697410 CTGGGAGCTGTGGGGAAGCAGGG + Intronic
1168984697 20:2038265-2038287 CTTGGAGCTGTGGCTCTGGAAGG - Intergenic
1169392215 20:5199343-5199365 CGGGGGGCTCTGGATATGGAAGG - Intergenic
1172217575 20:33247198-33247220 CAGGGAGCTGTGTTTATGTAAGG + Intergenic
1172468672 20:35175298-35175320 CTGGGGGCTGTGGGAAGGGAAGG - Intronic
1172888169 20:38245804-38245826 CGGGGAGCTGAGGGTGTGGGGGG - Intronic
1173616652 20:44407512-44407534 CGGGGAGCTGTGGGTGCAGGTGG - Intronic
1173825257 20:46043962-46043984 GGGGGAGGGGTGGGTATAGAAGG + Intronic
1174538765 20:51273319-51273341 AGTGGGGCTGTGGGTTTGGAGGG + Intergenic
1175206067 20:57312304-57312326 CTGGGAGCTGTGGGCATGAGAGG + Intergenic
1175688009 20:61045374-61045396 TGGGTAGATGTGTGTATGGATGG - Intergenic
1179175064 21:39002234-39002256 CGGAGAGGTGTGAGCATGGAAGG + Intergenic
1180013525 21:45067667-45067689 GAGGCAGCTGTGGCTATGGAGGG + Intergenic
1180230780 21:46425706-46425728 CGGGCAGCTGTGGAGAGGGAGGG - Intronic
1180620536 22:17159048-17159070 CGGGGAGCCGCGGGGAAGGAGGG - Intronic
1180709939 22:17832723-17832745 AGGAGAGCTGTGGGTGTGGTGGG + Intronic
1181235784 22:21446967-21446989 CGGGGAGCTGGGGGCCTGGGTGG - Exonic
1181847003 22:25718822-25718844 TGGGGATCTGTGGATATGGAGGG - Intronic
1181986313 22:26802209-26802231 CGGGGAGCAGTGTGGATGGGTGG - Intergenic
1182696446 22:32202222-32202244 GGAGGAGATGTGGGGATGGAGGG - Intronic
1182763969 22:32745265-32745287 GGGGGAGCTGAGGGTGTGCATGG - Intronic
1183409145 22:37644854-37644876 CCAGGAGCTGTGGGGATGAAGGG - Exonic
1183521659 22:38299203-38299225 GGAAGAGCTGTGGGCATGGATGG - Intronic
1184652185 22:45924509-45924531 GGAGGAGGTGTGGGTATTGATGG + Intronic
1184959467 22:47918570-47918592 GGGGGCACTGTGGGTGTGGAGGG - Intergenic
1185024199 22:48398317-48398339 GGTGGAGCTGAGGGGATGGATGG - Intergenic
1185254606 22:49825419-49825441 CGAGGAGCTGGAGGTATGGGAGG - Intronic
1185341522 22:50293369-50293391 CGGGTGGCTGTGGGTAGGGGAGG - Intronic
950683946 3:14603087-14603109 CAGGGAGCCGCGGGCATGGACGG + Intergenic
952886102 3:38011757-38011779 CAGGGAGCTGTGGCTATAGGTGG - Intronic
954373688 3:50183404-50183426 CACGGAGCTGTGGGCATGGCAGG - Exonic
955919625 3:63941794-63941816 CTGGGAGTTGTGCTTATGGAAGG + Intronic
956971086 3:74526697-74526719 CACAGAACTGTGGGTATGGAAGG - Intergenic
961793228 3:129391556-129391578 CTGGGAGCTGTGTGCCTGGATGG + Intergenic
964794350 3:160481222-160481244 TGGGGAGCTGTGGGTGTGTCAGG + Intronic
965930640 3:174038906-174038928 CTGGTTACTGTGGGTATGGAAGG - Intronic
968234067 3:197021479-197021501 GGAGAAGCTGTGGGTCTGGATGG + Intronic
968434428 4:576992-577014 CCGGGAGCTGGGGGTAAGGGAGG + Intergenic
968500116 4:945983-946005 AGGGGAGCTATGGGGATGGAAGG - Intronic
969311039 4:6353410-6353432 GGGGGGGCTGTCGGTGTGGAGGG - Intronic
972358304 4:38303347-38303369 GGGGGAGCTGAGGGCAGGGAGGG - Intergenic
972745090 4:41924593-41924615 CCTGGAGCTGTGGGCAAGGAAGG + Intergenic
974364353 4:60927024-60927046 TGGGGAGAAGTGGGTATGGCAGG - Intergenic
978759647 4:112342996-112343018 TGGGGAGCTGAAGGGATGGAAGG - Intronic
980081349 4:128347726-128347748 CCAGGAGCTGTGGGTAGGGGAGG - Intergenic
980430615 4:132689310-132689332 TAGGGAACTGTTGGTATGGATGG - Intergenic
982366672 4:154586478-154586500 CTGGGAGCTCTGGGACTGGAGGG - Exonic
983608093 4:169612732-169612754 CGGGGTGCTGTGCGAAGGGACGG + Intronic
984693157 4:182751976-182751998 AGGCGAGATGTGGGGATGGAGGG + Exonic
985564303 5:607658-607680 CGAGGAGCTGTGGGCAGGGTGGG + Intergenic
985931197 5:3059054-3059076 GTGGGAGCTGTGTGTAAGGATGG + Intergenic
986862480 5:11943574-11943596 CAGGGAGTTGGAGGTATGGAGGG + Intergenic
990400037 5:55429004-55429026 CAGGGAGATGTGGGTATGCAAGG - Intronic
990945754 5:61247634-61247656 CTGGGAGCTGTTGGTAAGGTTGG + Intergenic
991468898 5:66946180-66946202 AGAGGAGCTGTGTGTGTGGAAGG + Intronic
991947385 5:71912560-71912582 CCAGGAGCTGGGGGTAGGGAGGG + Intergenic
993933097 5:93967207-93967229 CTGGGAGCTGTGTTTATAGATGG + Intronic
993971340 5:94423171-94423193 TGGGGAGCTGGGGGGTTGGAGGG + Intronic
996015339 5:118527844-118527866 TGAGGAGCAGTGGGAATGGAAGG - Intergenic
996837679 5:127811873-127811895 CAGGGAGCAGTGTGTATGGAGGG - Intergenic
997341446 5:133148089-133148111 CGGGGTGCAGAGGCTATGGAGGG - Intergenic
997858192 5:137391943-137391965 CAGGGAGCTGTGGCAATAGAAGG - Intronic
998482035 5:142470593-142470615 AGGGGAACTGTGGGAATTGACGG + Intergenic
998794825 5:145807694-145807716 CGGGGGGTTGTGGGTAGGAAAGG - Intronic
999591196 5:153148400-153148422 CGGGGAGGTGAGGGTAAAGATGG - Intergenic
1001286316 5:170426598-170426620 AGGGGCGCTGTGAGCATGGAGGG + Intronic
1001415183 5:171540652-171540674 CGGTGAGATGTGGGTAAAGATGG - Intergenic
1001552310 5:172611973-172611995 AGAGGAGCTGTGGGCATGGGCGG + Intergenic
1002312070 5:178320826-178320848 CGGAGAGCTGTGGCTTTAGAGGG - Intronic
1004179543 6:13369131-13369153 CAGGGTGCTGTGGGTATTAATGG - Intronic
1004503227 6:16227197-16227219 CGGGTGGCTGTGGGCATGGCGGG - Intergenic
1005849662 6:29812029-29812051 CGGGGAGATGTGGGGGAGGAGGG + Intergenic
1006392666 6:33767827-33767849 CGTGGAGCTGAGGGCTTGGATGG - Intergenic
1006431594 6:34000578-34000600 CTGGGAGAAGTGGGGATGGAAGG - Intergenic
1007360784 6:41353677-41353699 GGGGGAGCTGTTTATATGGAGGG - Intergenic
1007589658 6:43013658-43013680 CGGGGAGCCGGGGTTCTGGAAGG - Intronic
1008405302 6:51112494-51112516 AGGTGAGCTGTGTTTATGGAGGG - Intergenic
1011227584 6:85124825-85124847 CTGGGAGGTGTGGGTAAGAAGGG + Intergenic
1012247045 6:96937724-96937746 AGGGCAGCTGTGAGGATGGAGGG - Intronic
1013418187 6:109943336-109943358 AGGGGAGGAGTGGGTTTGGAGGG - Intergenic
1014787738 6:125637717-125637739 CAGAGAGCTGTGGAGATGGATGG - Intergenic
1015569309 6:134604784-134604806 CGGGGAACTGTGGAGTTGGATGG - Intergenic
1019319380 7:408715-408737 CCGGCAGCTGTGGGGATGGAGGG + Intergenic
1019378948 7:711711-711733 CGGGGGTCTGTGGGGAGGGAAGG - Intronic
1019599618 7:1874756-1874778 CGGGGAGGGGTGGGGCTGGAGGG + Intronic
1019701387 7:2476410-2476432 CGGGGAGCCTGGGGTATAGATGG + Intronic
1020350921 7:7217305-7217327 CGGGGAGCTGAGGGGGTGGGGGG + Intronic
1020966224 7:14871800-14871822 TGGGGAGGTGTGGTGATGGATGG + Intronic
1033482855 7:141759436-141759458 CGGGAATCTGTGGATACGGAGGG - Intronic
1033573688 7:142658921-142658943 CAGGGAGCTCTGAGTCTGGATGG + Intergenic
1034885287 7:154794206-154794228 CGCGGGGCTGTGGGGGTGGAGGG + Intronic
1035230996 7:157465374-157465396 CAGGGAGCTGGGGTTCTGGAAGG + Intergenic
1035394709 7:158527328-158527350 CAGGGAGCTGTGGCCAGGGAAGG - Intronic
1036644128 8:10601500-10601522 CTGGGAGCTGGGGGTGGGGATGG + Intergenic
1036782757 8:11660783-11660805 CGCGGAGCTTTGGGTAAGGCAGG - Intergenic
1037935223 8:22911004-22911026 GGGGGAGCTGAGGGTAGGGGAGG + Intronic
1037946037 8:22990345-22990367 TGGGGTGCTGGGGGTGTGGAGGG - Intronic
1038953090 8:32437231-32437253 GGGGAAGCTGCGGGAATGGAGGG - Intronic
1039287309 8:36056120-36056142 TGGGGAGTTGTGGGAAAGGAGGG - Intergenic
1041088980 8:54284207-54284229 CCAGGGGCTGGGGGTATGGAGGG - Intergenic
1042867598 8:73369312-73369334 CGCTGAGCTGTGGGGTTGGAGGG + Intergenic
1044727562 8:95205626-95205648 CTGGGGGATGTGGGTAAGGAGGG + Intergenic
1045072788 8:98527919-98527941 GGGGGAGCTGTAGGTTTGAAGGG - Intronic
1047468566 8:125144236-125144258 AGGGCAGCTGTGGTTAGGGAAGG + Intronic
1047948003 8:129901636-129901658 CAGGGATCTGTGAATATGGATGG + Intronic
1048349982 8:133608318-133608340 CAGGGAGCTCTGGGTATGAATGG - Intergenic
1048887886 8:138923203-138923225 GGGTGAGGTGTGGGTCTGGAGGG - Intergenic
1052886291 9:33651300-33651322 CAGGGAGCTCTGAGTCTGGATGG + Intergenic
1055299645 9:74869795-74869817 CGGAGAGCGGTGGGGAGGGAAGG + Intronic
1055567187 9:77581156-77581178 CAGGGAGATGTGGGAGTGGAAGG + Intronic
1055661955 9:78512710-78512732 CAGGGTGCAGTGGGTATGGATGG - Intergenic
1057576185 9:96244511-96244533 TGGGGAGCTCTGGGTACGGAGGG + Intronic
1057701427 9:97365848-97365870 TGGGGAGCTGTGGTCATGGCGGG - Intronic
1059476529 9:114551966-114551988 TGGGGAGGTGTGGGTCTGGGTGG + Intergenic
1060003245 9:119977451-119977473 TGAGGACCTGTGGGAATGGAAGG - Intergenic
1060112453 9:120916282-120916304 CCTGGAGCTGTGGGTGGGGAGGG + Intronic
1060396660 9:123321216-123321238 CTGGGAGCAGAGGCTATGGAAGG - Intergenic
1061306448 9:129735799-129735821 CGGGGAGTGGTGGGTATGGAAGG - Intergenic
1062055615 9:134468428-134468450 GGGGGAGCTGAGGGTTTAGAGGG + Intergenic
1062388444 9:136324504-136324526 TGGGGAGCTGGGGCTCTGGACGG - Intergenic
1062588707 9:137263436-137263458 CGGGGAGTTGGGGGGAAGGAGGG - Intronic
1186487118 X:9942021-9942043 CAGGGAACTGTGGATAAGGAAGG - Intronic
1186762881 X:12741681-12741703 CGTGCAGGTGTGGGTGTGGAAGG - Intergenic
1188032784 X:25283001-25283023 CTAGGAGCTGTGGGTAGGGGAGG - Intergenic
1188379420 X:29472907-29472929 CGGGAAGCTGTGTGTCTGGCTGG - Intronic
1189630067 X:42943294-42943316 CAGGGCCCTGTGGCTATGGAAGG + Intergenic
1192359025 X:70426804-70426826 GGGAGAGCTCTGGGGATGGAAGG - Intronic
1192630794 X:72776884-72776906 CCCGGAGCTGTGGGAATGGGCGG - Intergenic
1192650916 X:72943920-72943942 CCCGGAGCTGTGGGAATGGGCGG + Intergenic
1194641372 X:96407334-96407356 GGGGGAGTTGAAGGTATGGAGGG - Intergenic
1200765625 Y:7078530-7078552 CAGGGAGCTCTGGGTTTTGAGGG - Intronic