ID: 923369340

View in Genome Browser
Species Human (GRCh38)
Location 1:233295282-233295304
Sequence CCGGGGAGCTGTGGGTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 269}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923369340_923369363 26 Left 923369340 1:233295282-233295304 CCTCCATACCCACAGCTCCCCGG 0: 1
1: 0
2: 0
3: 27
4: 269
Right 923369363 1:233295331-233295353 GCAGGGCCAGGGGCAGCAGCAGG 0: 1
1: 7
2: 41
3: 340
4: 1631
923369340_923369364 29 Left 923369340 1:233295282-233295304 CCTCCATACCCACAGCTCCCCGG 0: 1
1: 0
2: 0
3: 27
4: 269
Right 923369364 1:233295334-233295356 GGGCCAGGGGCAGCAGCAGGAGG 0: 1
1: 2
2: 15
3: 187
4: 1256
923369340_923369361 16 Left 923369340 1:233295282-233295304 CCTCCATACCCACAGCTCCCCGG 0: 1
1: 0
2: 0
3: 27
4: 269
Right 923369361 1:233295321-233295343 CTCACCAGGTGCAGGGCCAGGGG 0: 1
1: 0
2: 2
3: 28
4: 359
923369340_923369355 9 Left 923369340 1:233295282-233295304 CCTCCATACCCACAGCTCCCCGG 0: 1
1: 0
2: 0
3: 27
4: 269
Right 923369355 1:233295314-233295336 CTCCCCACTCACCAGGTGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 294
923369340_923369351 2 Left 923369340 1:233295282-233295304 CCTCCATACCCACAGCTCCCCGG 0: 1
1: 0
2: 0
3: 27
4: 269
Right 923369351 1:233295307-233295329 CCGGACCCTCCCCACTCACCAGG 0: 1
1: 0
2: 2
3: 31
4: 252
923369340_923369359 14 Left 923369340 1:233295282-233295304 CCTCCATACCCACAGCTCCCCGG 0: 1
1: 0
2: 0
3: 27
4: 269
Right 923369359 1:233295319-233295341 CACTCACCAGGTGCAGGGCCAGG 0: 1
1: 1
2: 1
3: 46
4: 369
923369340_923369360 15 Left 923369340 1:233295282-233295304 CCTCCATACCCACAGCTCCCCGG 0: 1
1: 0
2: 0
3: 27
4: 269
Right 923369360 1:233295320-233295342 ACTCACCAGGTGCAGGGCCAGGG 0: 1
1: 0
2: 3
3: 33
4: 278
923369340_923369354 8 Left 923369340 1:233295282-233295304 CCTCCATACCCACAGCTCCCCGG 0: 1
1: 0
2: 0
3: 27
4: 269
Right 923369354 1:233295313-233295335 CCTCCCCACTCACCAGGTGCAGG 0: 1
1: 1
2: 3
3: 28
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923369340 Original CRISPR CCGGGGAGCTGTGGGTATGG AGG (reversed) Intronic
900183780 1:1323936-1323958 CTGGGGGGCTGAGGGTCTGGGGG + Intronic
900525783 1:3127912-3127934 CCTGGGTGCTGTGGCCATGGAGG + Intronic
903446158 1:23424175-23424197 CCGGGGAGCGGCGGCGATGGCGG - Intronic
903859789 1:26357614-26357636 CCGGGGAGCTGTGGGGCTCTCGG + Intergenic
904081827 1:27877057-27877079 GTGGCGGGCTGTGGGTATGGGGG + Intronic
904358059 1:29954242-29954264 CTGGGGAGCGGGGGGAATGGAGG + Intergenic
906102439 1:43272169-43272191 GGGAGGAGCTGTGGGGATGGAGG - Exonic
908328889 1:63051068-63051090 ACGGGGACCTGTGTGTACGGGGG + Intergenic
910725494 1:90333966-90333988 CTGGGGGACTGTGGGGATGGTGG + Intergenic
911174396 1:94804645-94804667 CTTGGGAGCTGTGGGTCTTGGGG - Intergenic
912062202 1:105687126-105687148 CCAGGGAGCTGTGGGCATTGTGG - Intergenic
912863037 1:113232066-113232088 CCGGTGAGCTGAGGGGATGGTGG + Intergenic
914407612 1:147391683-147391705 GGGGGGAGCAGTGGGGATGGAGG + Intergenic
915651203 1:157312139-157312161 CTGGAGAGCTGTGGGCATAGGGG - Intergenic
920448388 1:206037939-206037961 GGGGGGAGCGGTGGATATGGGGG - Intronic
920785278 1:209034986-209035008 CTGGGGAGCTCTTGGTCTGGTGG + Intergenic
922107516 1:222525420-222525442 CCGGGGTGATGTGTGGATGGTGG - Intronic
922752087 1:228075006-228075028 ACAGAGGGCTGTGGGTATGGGGG + Exonic
923369340 1:233295282-233295304 CCGGGGAGCTGTGGGTATGGAGG - Intronic
924385027 1:243492213-243492235 CCGGGGAGCGGGGAGGATGGGGG - Intronic
1062774771 10:135719-135741 CCGGGGAGCTTTGTGGATGGCGG + Intronic
1063470800 10:6283308-6283330 CTTGGGAGGTGTGCGTATGGGGG + Intergenic
1065478110 10:26163220-26163242 CCTGGGAGCAGTGGGAATGTCGG - Intronic
1066048405 10:31614207-31614229 CCAGTGAGCTGAGGGTCTGGAGG + Intergenic
1067718674 10:48709842-48709864 CCAGAGAGCTGTGGGGCTGGAGG - Exonic
1070791343 10:79191260-79191282 TTGGGGAGCTGGGGGTAGGGAGG + Intronic
1071733970 10:88277324-88277346 CCGGGGAGGTGGGGGGTTGGGGG + Intronic
1072519963 10:96222630-96222652 CAGGGCAGCTGTGGGGAGGGAGG + Intronic
1074184690 10:111090172-111090194 CCTGTGAGCTGTAGGTCTGGGGG + Intergenic
1074984354 10:118643796-118643818 CCGGGGACGTCTGGGGATGGGGG - Intergenic
1075024248 10:118972237-118972259 CCAGGGACCTGTGGGGAGGGAGG + Intergenic
1075515372 10:123104121-123104143 CCGGGCAGCTGCGGGCATGTTGG + Intergenic
1075640892 10:124063728-124063750 CCGGAGAGATGTGGGTATTCTGG - Intronic
1076614889 10:131748812-131748834 CCGTGGAGCTGTGGCTGTGTTGG - Intergenic
1076839885 10:133040677-133040699 GCGGGGGGCTGTGGGTGAGGTGG + Intergenic
1076937808 10:133577275-133577297 CCGGGGTGCTGTGGGACTGGGGG - Intergenic
1076980922 11:204295-204317 CCAGGGAGAGGTGGGTAGGGAGG + Exonic
1077155501 11:1089208-1089230 CTGGGGATGTGTGGGCATGGGGG - Intergenic
1077187679 11:1242795-1242817 GCTGGTAGCTGTGGGTGTGGTGG - Exonic
1077188102 11:1244466-1244488 GCTGGTAGCTGTGGGTGTGGTGG - Exonic
1077188639 11:1246566-1246588 GCTGGTAGCTGTGGGTGTGGTGG - Exonic
1077189057 11:1248237-1248259 GCTGGTAGCTGTGGGTGTGGTGG - Exonic
1077189620 11:1250421-1250443 GCTGGTAGCTGTGGGTGTGGTGG - Exonic
1077317363 11:1925476-1925498 CTGGGGGGCTGTGGGGAAGGGGG - Intronic
1078792725 11:14560560-14560582 CCTGGGATTTGTGGGTTTGGAGG - Intronic
1080422565 11:32124466-32124488 GCGTGGTGCTGTGGGCATGGAGG + Intergenic
1083659158 11:64244308-64244330 CTGGGGAGCTGTGGGGGTGGGGG - Intergenic
1083759928 11:64810216-64810238 CAGGGGAGCTGTGCGTGTGTCGG - Intronic
1084473382 11:69375810-69375832 CCAGGGAGGAGTGGGTGTGGTGG + Intergenic
1084978398 11:72815526-72815548 CCAGGGAGCTGTGAGTCTGAGGG + Intronic
1085173506 11:74467619-74467641 CCGGGGAGAAGTGGGTGTGCTGG - Exonic
1085300632 11:75456267-75456289 CCTGGGAGCGGTGGGAGTGGTGG + Intronic
1085511723 11:77091602-77091624 CCCAGTGGCTGTGGGTATGGTGG - Intronic
1090804850 11:130196503-130196525 CCGGGGGGCTGGGGGTCTGGTGG - Intronic
1091301338 11:134510015-134510037 CCTGGGAGCTGAGGATGTGGAGG - Intergenic
1202807688 11_KI270721v1_random:13925-13947 CCGGTGTGCTGTGGAGATGGGGG - Intergenic
1091846448 12:3659740-3659762 CTCTGGAGCTGTGGGTGTGGGGG + Intronic
1092056450 12:5511980-5512002 CCAGGCAGCTGTGTGCATGGGGG + Intronic
1092071805 12:5637307-5637329 CTGGGGAGGTGAGGGTATTGAGG + Intronic
1092324773 12:7518777-7518799 GTGGGGAGCTGGGGGTAAGGTGG - Intergenic
1092701931 12:11241540-11241562 CCAGGTAGATGTGCGTATGGTGG - Intergenic
1092861650 12:12724480-12724502 CTGGGGAAATGTGGGTTTGGGGG + Intergenic
1096258791 12:50078386-50078408 CCGGGGAGCTGGGGGAGTGCGGG - Intronic
1097066250 12:56322829-56322851 ACAGGGAGTTGGGGGTATGGGGG + Intronic
1097189252 12:57211692-57211714 CCTGGCAGCAGTGGCTATGGAGG + Intronic
1101996821 12:109531683-109531705 CCGGAGACCTGTGGGGATGTGGG - Intronic
1103665691 12:122563505-122563527 CCTGGGAGCTGTGGGTTAGCGGG - Intronic
1103667169 12:122578001-122578023 CCTGGGAGCTGTGGGTTAGCAGG + Intronic
1103704349 12:122863240-122863262 CAGGGAAGCTGTGGGCATTGAGG - Intergenic
1103781849 12:123403995-123404017 CAGGGGAGAGGTGGGGATGGTGG - Intronic
1104376374 12:128267727-128267749 CGGGGCAGCTCTGGGTCTGGGGG - Intronic
1105642839 13:22284214-22284236 CCGGGGAGCGGTGGGGAACGTGG - Intergenic
1106101483 13:26697582-26697604 CCTGGGAGCTGAGGATATGGAGG + Intergenic
1106628201 13:31442360-31442382 CTGGGGAGCTCTGGGGATGCAGG + Intergenic
1109820716 13:67649836-67649858 CCTGGAAGCTATGGATATGGAGG + Intergenic
1111474318 13:88725446-88725468 CCTGGGTGCTGTGGGCATTGTGG + Intergenic
1111898278 13:94168858-94168880 CCTGGGTGCTGTGGGTAAGTAGG + Intronic
1112355531 13:98671971-98671993 CCGGGGAACACTGGGCATGGTGG + Intergenic
1114451658 14:22830318-22830340 ACGGGGAGCTGGGGGTATCAAGG + Intronic
1116944269 14:50821802-50821824 CCGGGGTGCTGGGGGTGGGGCGG - Intronic
1117905783 14:60584139-60584161 CCGGGGGGCGGAGGGTAGGGGGG + Intergenic
1119173489 14:72552345-72552367 CCGGGAAGCTGTGGGAACTGGGG + Intronic
1119541565 14:75441874-75441896 CCAGCGAGCTGTGGCTGTGGTGG + Intronic
1119643908 14:76334915-76334937 TGGGGGCCCTGTGGGTATGGAGG + Intronic
1122278103 14:100605512-100605534 GCTGGGGGCTGGGGGTATGGAGG + Intergenic
1122773568 14:104107566-104107588 CTGTGCACCTGTGGGTATGGGGG + Intronic
1123032623 14:105458989-105459011 CTGGGGAGCTGTGTGCCTGGGGG + Intronic
1123032645 14:105459048-105459070 CTGGGGAGCTGTGTGCCTGGGGG + Intronic
1123032666 14:105459107-105459129 CTGGGGAGCTGTGTGCCTGGGGG + Intronic
1123032708 14:105459225-105459247 CTGGGGAGCTGTGTGCCTGGGGG + Intronic
1123032729 14:105459284-105459306 CTGGGGAGCTGTGTGCCTGGGGG + Intronic
1123032751 14:105459343-105459365 CTGGGGAGCTGTGTGCCTGGGGG + Intronic
1123032772 14:105459402-105459424 CTGGGGAGCTGTGTGCCTGGGGG + Intronic
1123032794 14:105459461-105459483 CTGGGGAGCTGTGTGCCTGGGGG + Intronic
1123032815 14:105459520-105459542 CTGGGGAGCTGTGTGCCTGGGGG + Intronic
1123032835 14:105459579-105459601 CTGGGGAGCTGTGTGCCTGGGGG + Intronic
1123032857 14:105459638-105459660 CTGGGGAGCTGTGTGCCTGGGGG + Intronic
1123032878 14:105459697-105459719 CTGGGGAGCTGTGTGCCTGGGGG + Intronic
1123032899 14:105459756-105459778 CTGGGGAGCTGTGTGCCTGGGGG + Intronic
1123032921 14:105459815-105459837 CTGGGGAGCTGTGTGCCTGGGGG + Intronic
1123032942 14:105459874-105459896 CTGGGGAGCTGTGTGCCTGGGGG + Intronic
1123032963 14:105459933-105459955 CTGGGGAGCTGTGTGCCTGGGGG + Intronic
1123032983 14:105459992-105460014 CTGGGGAGCTGTGTGCCTGGGGG + Intronic
1123033023 14:105460110-105460132 CTGGGGAGCTGTGTGCCTGGGGG + Intronic
1124466045 15:29940904-29940926 TCTGGGTGCTGTGGTTATGGTGG - Intronic
1128474731 15:67987633-67987655 AAGAGGAGCTGTAGGTATGGGGG + Intergenic
1128557454 15:68641419-68641441 CTGGGGAGCTGGGGATTTGGGGG + Intronic
1128582767 15:68820574-68820596 CCCGGGAGGTGCGGGTTTGGGGG - Intronic
1129183151 15:73889548-73889570 CAGGGGAGCAGTGGGGGTGGGGG - Intergenic
1129291208 15:74569262-74569284 CGGAGGAGCTGTGGGGTTGGAGG + Intronic
1129512706 15:76136771-76136793 CAGGGTTGCTGTGGGTATGTGGG + Intronic
1131270929 15:90947298-90947320 CCTGGGAGCTGGTGGTTTGGGGG + Intronic
1133264418 16:4574849-4574871 CCTGGGTGCTGAGGGTAGGGAGG + Intronic
1134326338 16:13211220-13211242 CCGGGGGGCAGTGGGGGTGGAGG + Intronic
1134601399 16:15536458-15536480 CCAGGGAGCTGGGGAGATGGCGG - Intronic
1135920128 16:26642308-26642330 CCAGAGAGCTGTGGATGTGGAGG - Intergenic
1139504504 16:67392310-67392332 GCGGAGGGCTGTGGGTGTGGGGG - Intronic
1139733474 16:68967717-68967739 CCGGGTTGCTGTGGGTATTTTGG + Intronic
1141638711 16:85329107-85329129 CCAGGGAGCTGTGGGGGAGGGGG - Intergenic
1141670424 16:85488885-85488907 CCGGGGGGCTGTTAGAATGGGGG - Intergenic
1142629686 17:1216744-1216766 CTGGGGAACTCTGGGTCTGGTGG + Intronic
1143449679 17:7028436-7028458 CCTGGAGGCTGTGGGTGTGGGGG + Exonic
1143636055 17:8164203-8164225 CAGGGGAGCTGTCGCTCTGGTGG + Intergenic
1143984071 17:10895950-10895972 CCAGGGTGCTGGGGGTAGGGAGG + Intergenic
1144852362 17:18250527-18250549 CAGGGGAGCTGAGAGTAGGGTGG - Intronic
1144951119 17:18993986-18994008 AGAGGGAGCTGTGGGTCTGGTGG - Intronic
1146198373 17:30832332-30832354 CCGGGAAGCGGGGAGTATGGTGG + Exonic
1146925103 17:36739105-36739127 ACAGGGAGCTGGGGGTAGGGAGG + Intergenic
1147760700 17:42795824-42795846 CCGTGCAGCTGAGGGTCTGGGGG + Exonic
1151956851 17:77384417-77384439 CCGGGGAGGTGGGGGCAGGGTGG + Intronic
1152855882 17:82664286-82664308 CCGGGGTGCTGTGCTGATGGTGG + Intronic
1152896443 17:82914083-82914105 GCGGGGAGCAGTGGGTGTGGTGG - Intronic
1153771764 18:8422390-8422412 TCGGGGAGCTTTGACTATGGTGG - Intergenic
1155845210 18:30696367-30696389 CAGCGGTGCTGTGGGTTTGGCGG + Intergenic
1156285866 18:35695338-35695360 CAGGGCAGCTGTAGGTTTGGAGG + Intronic
1156971523 18:43162880-43162902 CCCGGGAGCAATGGGGATGGGGG - Intergenic
1160494006 18:79358899-79358921 GAGGGGTGCTGTGGGTCTGGAGG + Intronic
1160583049 18:79898553-79898575 ACTGGGAGCTGTGGGTGGGGTGG + Intronic
1160613483 18:80107406-80107428 CTGGGGAGTAGTGGGTGTGGGGG + Intergenic
1160722809 19:604775-604797 GTGGGGAGCTGTGGATTTGGGGG + Intronic
1160982674 19:1823523-1823545 CCGGGGGGCCGTGGGCATGTGGG - Intronic
1161219214 19:3110366-3110388 CTGGGCAGCTGTGGGCTTGGTGG + Intronic
1161602576 19:5193490-5193512 CTGGGGGGCTGTGGGGGTGGGGG + Intronic
1162302163 19:9850153-9850175 TCGGGGGGCTGTGGGTCTGATGG + Intergenic
1162806390 19:13139943-13139965 CCTGGGAGCAGTGGGTAGGTGGG - Exonic
1162930694 19:13956093-13956115 CCAGGCAGCTGAGGGTATGCTGG + Intronic
1163124723 19:15238730-15238752 CCGGGAAGCCGTGAGTCTGGAGG - Exonic
1163640181 19:18457672-18457694 CAGGGGAGCAGTGGTTAAGGAGG - Intronic
1163719788 19:18893694-18893716 CCAGGTGGCTGTGGGCATGGGGG - Intronic
1163831225 19:19548021-19548043 CTGGGGAGGGGTGGGAATGGGGG + Intergenic
1163884869 19:19956606-19956628 CCGGGGTGATGTGGCTGTGGCGG - Intergenic
1165521961 19:36321716-36321738 CAGAGGAGCTGTGGGGATGGTGG - Intergenic
1165633850 19:37323827-37323849 CAGAGGAGCTGTGGGGACGGTGG + Intronic
1165830499 19:38728149-38728171 CCAGGGAGATGTGGGCAGGGAGG - Intronic
1166234057 19:41443087-41443109 CTGGGGAGCTGTGTGCGTGGTGG - Intergenic
1166830846 19:45638941-45638963 CCGGGGAGCGGTGGGGGTGGAGG - Intronic
1166953784 19:46448118-46448140 CTGGGGAGCTGGGGGCCTGGAGG + Intergenic
1167462930 19:49635845-49635867 CGGGGGACCTGGGGGTAGGGGGG + Exonic
1168232973 19:55044997-55045019 CCAGGAAGCTGCGGGCATGGCGG + Exonic
1168675984 19:58278566-58278588 CCGGGGAGCAGAGGGTAAAGCGG + Intronic
925959642 2:9003403-9003425 CCAGGGAGCGGCGGGTAGGGGGG + Intronic
928085848 2:28345854-28345876 CAGGGGAGCTGTGGGAAGAGAGG - Intergenic
928436379 2:31257218-31257240 CCTCAGAGCTGTGGGTAGGGAGG - Intronic
935121362 2:100186209-100186231 CAGGGGAGGTGTGGGGAGGGAGG - Intergenic
935310459 2:101778142-101778164 AAGGGGACCTGTGGGTCTGGGGG + Intronic
935736679 2:106111930-106111952 CCGGGGAGCTGGGGGTGGGAGGG + Intronic
936433478 2:112483247-112483269 CCGTGGACATGTGGGTATGGTGG - Intronic
936574979 2:113645477-113645499 CCAGGGAGCTGTGGGTTTTTTGG - Intergenic
937908858 2:127065662-127065684 CTGGGGAGTTGTGGGGGTGGTGG - Intronic
938064913 2:128276752-128276774 GCGGGGAGCTCTGGGGACGGAGG - Intronic
939172218 2:138709447-138709469 TGGGGCAGCTGTGGGTAGGGAGG - Intronic
940987729 2:160064990-160065012 TCTGGGAGCTGTGGGTGTGTGGG + Intergenic
945251002 2:207766936-207766958 CCGGAGAGCTGAGGGGAGGGGGG - Exonic
946227420 2:218271433-218271455 CTGGGGAGCTGTGGCTTTGCAGG - Exonic
946285178 2:218697387-218697409 CCTGGGAGCTGTGGGGAAGCAGG + Intronic
948190654 2:236055662-236055684 CCGAGGAGCCGTGGGTTTGCAGG + Intronic
948367254 2:237465068-237465090 CAGGGGAGCTGGAGCTATGGGGG - Intergenic
948826486 2:240575636-240575658 CCAGGGAGCCGTGGGTATGATGG + Intronic
948850679 2:240703931-240703953 CCAGGGAGCTGAGGGTTGGGTGG - Intergenic
1169194384 20:3675352-3675374 CCGGGGAGGAGTGGGAATAGGGG + Intronic
1169473778 20:5911660-5911682 CCTGGGAGCCGTGGGGCTGGCGG + Exonic
1169528149 20:6453360-6453382 CTGGGGAGCTGTGGGGCTGGGGG - Intergenic
1172888170 20:38245805-38245827 ACGGGGAGCTGAGGGTGTGGGGG - Intronic
1173609404 20:44355766-44355788 CCGGAGAGCTGGGGGCATGGAGG - Intronic
1174557361 20:51405393-51405415 CCAGGGAACTGTGGGTGTGCAGG + Intronic
1175883526 20:62274343-62274365 CCGGGGAGCTGTGGATGAGAGGG + Intronic
1176098266 20:63353851-63353873 CGGGGGGGCTGTGGTTCTGGGGG + Intronic
1176203535 20:63875614-63875636 CAGGTGAGCTGTGGGTATAGCGG - Intronic
1178915062 21:36701439-36701461 CCGGGGAGCCGCGGGGCTGGAGG - Intronic
1179789791 21:43749732-43749754 CTGGGGAGCTGTGGGCTTGTCGG + Intronic
1179937147 21:44613039-44613061 CTGGGGAGCAGTGAGGATGGAGG - Intronic
1180617989 22:17141110-17141132 ACGGGGAGGTGGGGGTAGGGGGG + Exonic
1180709938 22:17832722-17832744 CAGGAGAGCTGTGGGTGTGGTGG + Intronic
1180825076 22:18856171-18856193 CCGTGGTGCTGGGGGTCTGGTGG + Intronic
1181015948 22:20068860-20068882 GCTGTGAGCTGAGGGTATGGGGG - Intergenic
1181387889 22:22558320-22558342 CGGGGGAGGGGTGGGGATGGGGG + Intronic
1181465754 22:23109770-23109792 CCTGGAAGCTGTGGGAGTGGTGG + Intronic
1181847004 22:25718823-25718845 ATGGGGATCTGTGGATATGGAGG - Intronic
1182578403 22:31289490-31289512 CCTGGGAACTCTGGGTATGACGG - Exonic
1183174414 22:36212453-36212475 CCGGGGAGCAGTGTGTTTAGTGG - Intergenic
1183664881 22:39241573-39241595 CCGTGGAGCTGTGGGAAAGAAGG + Intronic
1184375815 22:44111973-44111995 CCGGGGAGCTGGGAGGATCGTGG + Intronic
1184769520 22:46589281-46589303 TGGGGGAGCCGTGGGTGTGGGGG + Intronic
1184775117 22:46619240-46619262 CCAGGGAGCTGTGTGTGTGCTGG + Intronic
1185057523 22:48588639-48588661 ACGGGGACCTGCGGGGATGGGGG + Intronic
1185393967 22:50577595-50577617 ACAGGGAGCTGTGGGTGTGGCGG - Intronic
1185425195 22:50765398-50765420 CCAGGGAGCTGTGGGTTTTTTGG + Intergenic
950621828 3:14212144-14212166 CTGGGGAGCTGTGATTATTGTGG - Intergenic
951660162 3:25054452-25054474 CAGGAGAGCTGTGGAGATGGTGG + Intergenic
954779085 3:53046103-53046125 CCGCGGAGCTGGGGGTGGGGGGG - Intronic
955056591 3:55460770-55460792 CCCAGGAGCTGTGAGTCTGGAGG - Intergenic
955234703 3:57129611-57129633 CCGGGGACCTGTTGGGGTGGAGG - Intronic
958995722 3:100902781-100902803 CCCTGGAGCTGCGGTTATGGAGG - Intronic
961654626 3:128434291-128434313 CCGGGCAGCTGTGGGACAGGTGG + Intergenic
963770767 3:149384081-149384103 CCAGGAAGCTGTGTGTAAGGTGG - Intergenic
964814334 3:160700905-160700927 CTGGGGAGCTTGGGGTATGCAGG - Intergenic
966875749 3:184320700-184320722 CTGGGGAGGGGTGGGTGTGGAGG - Exonic
968490264 4:886397-886419 CCCAGCAGCTGTGGGGATGGTGG - Intronic
968704974 4:2073487-2073509 CCGGGCAGTAGTGGGGATGGGGG - Intronic
968817063 4:2827694-2827716 CCGGGGAGCTCTGGGTGTGTAGG + Intronic
968960380 4:3740246-3740268 CAGGGGTGCTGTGGGCAGGGTGG - Intergenic
969373796 4:6750071-6750093 CAGGGCAGGTGTGGGGATGGGGG + Intergenic
969626441 4:8308002-8308024 TGGGAGAGCTGTGGGAATGGGGG - Intergenic
972381858 4:38526734-38526756 CCAGAGAGCTCTGGGTAGGGTGG + Intergenic
974385702 4:61200831-61200853 CCGGGCAGCTGCGGGCATGTGGG - Intergenic
976360691 4:84174610-84174632 TCAGGGAGCTGTGACTATGGAGG + Intergenic
982366673 4:154586479-154586501 CCTGGGAGCTCTGGGACTGGAGG - Exonic
983735047 4:171046701-171046723 CCTAGGAGCTATGGGTGTGGGGG - Intergenic
985564302 5:607657-607679 CCGAGGAGCTGTGGGCAGGGTGG + Intergenic
985842395 5:2317919-2317941 CCTGGCTGCTGTGGGTTTGGTGG + Intergenic
987148745 5:15017737-15017759 CCTGGGAGGTGGGGGTCTGGTGG + Intergenic
987503648 5:18744109-18744131 GTGGGGAGCCCTGGGTATGGGGG + Intergenic
987870926 5:23615503-23615525 TGGGGGAGCTGTTGGAATGGAGG + Intergenic
992936917 5:81717274-81717296 CTGAGGAGCTCTGGGCATGGAGG - Intronic
993366152 5:87036003-87036025 CAGGGGAGCTGTGTGTTTGGAGG + Intergenic
995527405 5:113061207-113061229 CTGGAGAGCTGTGAGAATGGTGG - Intronic
996837680 5:127811874-127811896 GCAGGGAGCAGTGTGTATGGAGG - Intergenic
997341447 5:133148090-133148112 CCGGGGTGCAGAGGCTATGGAGG - Intergenic
998148158 5:139742129-139742151 CAGGGTATATGTGGGTATGGGGG + Intergenic
998907531 5:146922541-146922563 GCGGGGAGCTCAGGGTCTGGTGG + Intronic
1001788024 5:174430634-174430656 TAGGGGAGGTGTGGGGATGGGGG + Intergenic
1002522719 5:179800449-179800471 GCGGGTTGCTGAGGGTATGGGGG + Intronic
1004503228 6:16227198-16227220 CCGGGTGGCTGTGGGCATGGCGG - Intergenic
1005707467 6:28469655-28469677 CCGGGGAGACGTGGGCTTGGCGG - Intergenic
1006119360 6:31795005-31795027 CCGGTGGGCTCTGGGTGTGGGGG - Exonic
1007407917 6:41645321-41645343 CTGGGGAGCTGTGGGTTTGAAGG + Intronic
1008405303 6:51112495-51112517 CAGGTGAGCTGTGTTTATGGAGG - Intergenic
1008562660 6:52737470-52737492 CACGGGAGCTTTGGGTGTGGTGG - Intergenic
1010863041 6:80937442-80937464 CTGGGCTGCTATGGGTATGGGGG + Intergenic
1012425914 6:99114291-99114313 AAGGGGAGCTGTGGTCATGGAGG - Intergenic
1017960809 6:159218893-159218915 CCAAGGAGCTGTGGGAGTGGGGG + Intronic
1018185300 6:161261403-161261425 GCTGGGAGCTGTGGATATGATGG - Intronic
1018362968 6:163090470-163090492 CTGAAGAGCTGTGGGTAAGGTGG + Intronic
1019319378 7:408714-408736 ACCGGCAGCTGTGGGGATGGAGG + Intergenic
1019494765 7:1332560-1332582 GGGGGGAGCTGTGGCTCTGGAGG - Intergenic
1020350920 7:7217304-7217326 CCGGGGAGCTGAGGGGGTGGGGG + Intronic
1022807524 7:33837644-33837666 CCGGGGCGCTCTGTGGATGGAGG - Intergenic
1024355855 7:48412664-48412686 GGGGGGAGATGTGGGTAAGGGGG + Intronic
1026508676 7:71009157-71009179 CCTGGGAGCTGTAGTCATGGGGG + Intergenic
1026528252 7:71174386-71174408 CTGGGGACCTGTGGGGAAGGTGG + Intronic
1034355103 7:150445186-150445208 CCAGGAAGCTGTGGCTCTGGGGG + Intergenic
1041934103 8:63317860-63317882 CAGTGGAGCTGTGGCTGTGGAGG - Intergenic
1042943915 8:74136091-74136113 CTGTGGAGCTGTGGAAATGGTGG + Intergenic
1045072789 8:98527920-98527942 CGGGGGAGCTGTAGGTTTGAAGG - Intronic
1045390177 8:101707423-101707445 ATGGGGAGCTATGGGGATGGGGG - Intronic
1045401653 8:101825107-101825129 GCGGTGACCTGTGGGTCTGGAGG - Intronic
1047868138 8:129051812-129051834 CCTGGGAGCTGGGGATGTGGTGG + Intergenic
1049530475 8:143152006-143152028 CGGGGGTGCTGTGGGTGTGGGGG - Intergenic
1049654543 8:143791884-143791906 CCGGGGAGGTGCTGGTCTGGGGG + Exonic
1049678442 8:143904028-143904050 CCAGGGAGCTGTGGGTTGGTCGG + Intergenic
1049773450 8:144394195-144394217 CTGGGGAGCTGAGGCTCTGGGGG - Intronic
1051418941 9:16871302-16871324 CCGGGGAGCTGCGGGCGTGGAGG + Intergenic
1053016091 9:34663141-34663163 CAGGGGAGTTGTGGGTGGGGTGG + Intronic
1054489456 9:65762703-65762725 CCGGGGGGGTGGGGGTGTGGGGG - Intergenic
1055557832 9:77493106-77493128 CAGTGGTGGTGTGGGTATGGGGG + Intronic
1056659532 9:88534408-88534430 GCGGGGCGCAGTGGGGATGGGGG + Intergenic
1057173471 9:92977376-92977398 CAGAGAAACTGTGGGTATGGGGG + Intronic
1057354028 9:94320705-94320727 CCGGGGCGCTGTGGTTCAGGTGG - Intronic
1057576184 9:96244510-96244532 GTGGGGAGCTCTGGGTACGGAGG + Intronic
1057653737 9:96936930-96936952 CCGGGGCGCTGTGGTTCAGGTGG + Intronic
1057701428 9:97365849-97365871 CTGGGGAGCTGTGGTCATGGCGG - Intronic
1058159011 9:101547167-101547189 GCGGGGAGCAGTCTGTATGGCGG + Exonic
1058435738 9:104961378-104961400 ATAGGGAGCTGTGAGTATGGAGG - Intergenic
1060997835 9:127885135-127885157 CCTGGGGGCTCTGGGGATGGTGG - Intergenic
1061621949 9:131816281-131816303 CCCCAGAGCTGTGGGTCTGGGGG + Intergenic
1061768948 9:132902542-132902564 CCGGAGAGCAGTGGGGAGGGAGG - Intronic
1062547930 9:137072085-137072107 CAGGGTAGGTGTGGGGATGGGGG - Intergenic
1062588708 9:137263437-137263459 CCGGGGAGTTGGGGGGAAGGAGG - Intronic
1189120064 X:38385029-38385051 CCGAGGGGCTGGGGGAATGGGGG + Intronic
1189928993 X:45987995-45988017 CCTGGGAGCTGTGAGAATTGTGG - Intergenic
1190689355 X:52900690-52900712 CCGGGCAGCTGTGGACATGCGGG + Intronic
1190696628 X:52955102-52955124 CCGGGCAGCTGTGGACATGCGGG - Intronic
1192870590 X:75179821-75179843 CCGGGTAGGTGTGGGCTTGGCGG - Intergenic
1195868473 X:109459448-109459470 CCTGGTAGAGGTGGGTATGGGGG - Intronic
1198539505 X:137621723-137621745 CCTGGGAGCTGAGGTTGTGGTGG + Intergenic
1199815005 X:151389270-151389292 CCCTGGAGAGGTGGGTATGGTGG + Intergenic
1200142037 X:153907188-153907210 CCGGGTAACGGTGGGTGTGGAGG + Intronic