ID: 923369343

View in Genome Browser
Species Human (GRCh38)
Location 1:233295285-233295307
Sequence GTCCCGGGGAGCTGTGGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 189}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923369343_923369364 26 Left 923369343 1:233295285-233295307 CCATACCCACAGCTCCCCGGGAC 0: 1
1: 0
2: 1
3: 17
4: 189
Right 923369364 1:233295334-233295356 GGGCCAGGGGCAGCAGCAGGAGG 0: 1
1: 2
2: 15
3: 187
4: 1256
923369343_923369354 5 Left 923369343 1:233295285-233295307 CCATACCCACAGCTCCCCGGGAC 0: 1
1: 0
2: 1
3: 17
4: 189
Right 923369354 1:233295313-233295335 CCTCCCCACTCACCAGGTGCAGG 0: 1
1: 1
2: 3
3: 28
4: 347
923369343_923369355 6 Left 923369343 1:233295285-233295307 CCATACCCACAGCTCCCCGGGAC 0: 1
1: 0
2: 1
3: 17
4: 189
Right 923369355 1:233295314-233295336 CTCCCCACTCACCAGGTGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 294
923369343_923369351 -1 Left 923369343 1:233295285-233295307 CCATACCCACAGCTCCCCGGGAC 0: 1
1: 0
2: 1
3: 17
4: 189
Right 923369351 1:233295307-233295329 CCGGACCCTCCCCACTCACCAGG 0: 1
1: 0
2: 2
3: 31
4: 252
923369343_923369359 11 Left 923369343 1:233295285-233295307 CCATACCCACAGCTCCCCGGGAC 0: 1
1: 0
2: 1
3: 17
4: 189
Right 923369359 1:233295319-233295341 CACTCACCAGGTGCAGGGCCAGG 0: 1
1: 1
2: 1
3: 46
4: 369
923369343_923369360 12 Left 923369343 1:233295285-233295307 CCATACCCACAGCTCCCCGGGAC 0: 1
1: 0
2: 1
3: 17
4: 189
Right 923369360 1:233295320-233295342 ACTCACCAGGTGCAGGGCCAGGG 0: 1
1: 0
2: 3
3: 33
4: 278
923369343_923369363 23 Left 923369343 1:233295285-233295307 CCATACCCACAGCTCCCCGGGAC 0: 1
1: 0
2: 1
3: 17
4: 189
Right 923369363 1:233295331-233295353 GCAGGGCCAGGGGCAGCAGCAGG 0: 1
1: 7
2: 41
3: 340
4: 1631
923369343_923369361 13 Left 923369343 1:233295285-233295307 CCATACCCACAGCTCCCCGGGAC 0: 1
1: 0
2: 1
3: 17
4: 189
Right 923369361 1:233295321-233295343 CTCACCAGGTGCAGGGCCAGGGG 0: 1
1: 0
2: 2
3: 28
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923369343 Original CRISPR GTCCCGGGGAGCTGTGGGTA TGG (reversed) Intronic
900772812 1:4559273-4559295 GTCCAGGGGAGCTGGGAGGAAGG + Intergenic
901137951 1:7009773-7009795 GACATGGGGAGCTGTGGGTTTGG + Intronic
902472506 1:16658451-16658473 GTGCCGGGCAGCGGTGGGTGCGG + Intergenic
902486299 1:16748995-16749017 GTGCCGGGCAGCGGTGGGTGCGG - Intronic
904566489 1:31431581-31431603 GTGCCAGGGAGCTGTGGGTGTGG - Intronic
905173420 1:36122537-36122559 GTGCAGGGGAGATGTGGGTTTGG - Intronic
905812578 1:40923381-40923403 ATCCCAGGCAGCTGTGGGTGAGG + Intergenic
907595105 1:55712542-55712564 GTCCCTGGGAGCTTTAGGTCTGG - Intergenic
909643117 1:77888680-77888702 GTCCCGCCTGGCTGTGGGTAGGG - Exonic
910016741 1:82534465-82534487 GTCCCGGGGTGATGGGGGTGCGG + Intergenic
912640962 1:111346103-111346125 ATCCCGGGGGGCCGTGGGGAGGG - Intergenic
915234257 1:154468947-154468969 GTCCCGTGCAGCCGTGGGCAGGG + Exonic
915475444 1:156150247-156150269 GACCTGGGAAGCTCTGGGTAAGG + Intronic
915972837 1:160366462-160366484 GTCCCAGGGTGATGAGGGTAGGG + Intergenic
916724926 1:167515003-167515025 GTCCTGGGGAGCTCTGGCTTAGG - Intronic
918405082 1:184204260-184204282 ATCCCTGGGACCTGTGGGTATGG + Intergenic
919758939 1:201084898-201084920 GTCTCAGGGAGCTGGGGGTTGGG + Intronic
920653092 1:207853183-207853205 GTCCCGGCGATCTGGGGGCAGGG - Intergenic
922535462 1:226377266-226377288 GTCCTGGGGCCGTGTGGGTACGG - Exonic
923369343 1:233295285-233295307 GTCCCGGGGAGCTGTGGGTATGG - Intronic
1067683566 10:48454731-48454753 GTCCCTGGGAGGGGTGGGTCCGG - Intronic
1067718677 10:48709845-48709867 GTCCCAGAGAGCTGTGGGGCTGG - Exonic
1067739004 10:48880873-48880895 GGCCCGGGGAGGTGGGGGCAGGG + Intronic
1069024125 10:63521615-63521637 GCCCAGGGGAGCTGTGGGAAGGG + Intronic
1070791341 10:79191257-79191279 GCCTTGGGGAGCTGGGGGTAGGG + Intronic
1071431622 10:85611419-85611441 TTCCTGGGCAGCTGTGGGCAAGG - Intronic
1073459861 10:103660352-103660374 GCCCCGGGCAGCTGTCAGTACGG + Intronic
1076615610 10:131752221-131752243 GGCCGGGGGAGCTGTGGGGCTGG + Intergenic
1076799504 10:132814059-132814081 GACCCAGGGAGCCGGGGGTAGGG + Intronic
1076980919 11:204292-204314 GGCCCAGGGAGAGGTGGGTAGGG + Exonic
1077035255 11:491389-491411 GACACGGGGAGCTGGGGGGAGGG - Intronic
1077058009 11:605342-605364 CTCCCTGGGGGCTGTGGGCACGG + Intronic
1081364043 11:42213498-42213520 GTCTAGTGGAGCTGTGGGAAGGG + Intergenic
1083159933 11:60848582-60848604 GTCCCTGGCAGATGTGGGTGAGG - Intronic
1083886940 11:65577536-65577558 GTCACAGGCGGCTGTGGGTAGGG + Intronic
1084662906 11:70557624-70557646 GCCTGGGGGAGCTGTGGGTGGGG + Intronic
1085390600 11:76180178-76180200 GTTCAGGGGAGCTTTGGGGAAGG + Intergenic
1088796766 11:113271958-113271980 TTGGCCGGGAGCTGTGGGTAGGG - Intronic
1089260888 11:117223294-117223316 GTCCCTAGGAGCTGTGGATGAGG - Exonic
1089336273 11:117725943-117725965 GTGCATGGGACCTGTGGGTAGGG - Intronic
1089642960 11:119859663-119859685 GAGCAGGGCAGCTGTGGGTAGGG + Intergenic
1089800696 11:121024431-121024453 GTCTCGAGCAGCTGTGGGGATGG + Intronic
1091005250 11:131947424-131947446 GTCCCGGGGAGGGGAGGGTCTGG - Intronic
1091899813 12:4135662-4135684 CTCCCGAGTAGCTGTGGCTACGG + Intergenic
1092324774 12:7518780-7518802 GTAGTGGGGAGCTGGGGGTAAGG - Intergenic
1093742843 12:22707911-22707933 GTTTTGGGGAGCTGGGGGTAGGG + Intergenic
1095953422 12:47793801-47793823 GGCCCGGGGAGCTGGTGGAATGG - Intronic
1095983065 12:47983623-47983645 GTCCCAGGGAGCCCTGGGTATGG + Intronic
1097156624 12:57016572-57016594 GTCTAGGGGAGCTGAGGGGAGGG + Intronic
1105702579 13:22944265-22944287 GTGCGGGGGAGCTATGGGTAGGG - Intergenic
1105855203 13:24366048-24366070 GTGCGGGGGAGCTGTGGGTAGGG - Intergenic
1105868394 13:24481792-24481814 GTTCCAGGGAGCTATGGCTATGG + Intronic
1109924371 13:69115806-69115828 TTCCAGGGGAGGTGTGGGCAGGG + Intergenic
1113663446 13:112123309-112123331 GTCCTGGGGAGGTTTGGTTAGGG + Intergenic
1117736382 14:58773085-58773107 GTCCGTGGGAACCGTGGGTAAGG + Intergenic
1118992577 14:70809534-70809556 GTCCCGGCGAGCTGGCGGTGCGG - Exonic
1119480671 14:74955796-74955818 GGCCCGGGGAGCTGCGGGCTGGG - Intergenic
1121094162 14:91204399-91204421 GCCCATGGGAGATGTGGGTATGG - Intronic
1122969331 14:105146119-105146141 CTCCCTGGGAGCCCTGGGTAGGG - Intronic
1125759656 15:42088042-42088064 CTCCCTGGGAGCTCTGGGAATGG - Intronic
1125886384 15:43232833-43232855 GTCCAGGGGAGCTGTGCAAATGG + Exonic
1125932745 15:43611950-43611972 GCCCCCGGGAGCTGCGGGTCTGG - Exonic
1125945844 15:43711412-43711434 GCCCCCGGGAGCTGCGGGTCTGG - Intergenic
1128273840 15:66335680-66335702 GTGGCGGGGGACTGTGGGTAGGG + Intergenic
1130886255 15:88095014-88095036 TTACCTGGGAGCTGTGGCTATGG + Intronic
1132630845 16:916613-916635 GTCCCGGGGCCATGTGGGTGTGG - Intronic
1136402575 16:30026582-30026604 GTCCCGGGGAGCTGGGCGGGCGG - Intronic
1136612070 16:31372342-31372364 GTCGCGGGGAGCGGAGGGTAAGG - Intronic
1136783751 16:32922804-32922826 GTCCCCAGGAGCTGAGGGTCAGG - Intergenic
1137036740 16:35574897-35574919 GTCTGGAGGAGCTGTGGGCATGG - Intergenic
1137627851 16:49920925-49920947 GTCCCTGGGGGCTGCGGGGAAGG - Intergenic
1139215317 16:65121375-65121397 GCCCCGGGGAGCTTTCGGCAGGG + Intronic
1139296164 16:65902932-65902954 GGCCCGGGAAGCTGGTGGTATGG - Intergenic
1140043458 16:71424712-71424734 GCCCCGGGGAGCTGATGGTCAGG - Intergenic
1141638716 16:85329110-85329132 GGCCCAGGGAGCTGTGGGGGAGG - Intergenic
1141697865 16:85628552-85628574 GGGCTGGGGAGCTGTGGGTGAGG + Intronic
1143551739 17:7634547-7634569 GTCACAGAGAGATGTGGGTAGGG + Intergenic
1143922242 17:10339209-10339231 GTCACACGGAGCTGTGGCTATGG - Intronic
1147364887 17:39953065-39953087 GTGCGGGGGAGGTGTGGGTGGGG + Intergenic
1148107044 17:45124339-45124361 TTCCTGGGGAGCTGAGGGTAAGG - Intronic
1151956848 17:77384414-77384436 CTCCCGGGGAGGTGGGGGCAGGG + Intronic
1151977069 17:77489088-77489110 GTCTTGGGGAGCTGAGGGTCAGG + Intronic
1152618399 17:81348440-81348462 GTCCTGGGGAGATGGGGGTGGGG + Intergenic
1152836857 17:82538831-82538853 GTGGCTGTGAGCTGTGGGTATGG - Intronic
1155982886 18:32199014-32199036 GTCCTGGGTAGCTGAGGGCATGG + Intronic
1160586465 18:79916062-79916084 GTACGGGAGCGCTGTGGGTATGG - Intronic
1160619621 18:80161641-80161663 GTCTCGGGGAGCAGAGGGAAGGG + Intronic
1160876072 19:1296737-1296759 GTCCCGGGGAGATGCGGGGGTGG - Intronic
1161167545 19:2796462-2796484 GTCCCAGGGAGCACTGGGCATGG + Intronic
1161849192 19:6730187-6730209 GTCCCGGGGAGCTGGGCGCCTGG + Exonic
1163425083 19:17236490-17236512 GTCCCCAGGAGCTGGGGGTGGGG - Intronic
1163831221 19:19548018-19548040 GTCCTGGGGAGGGGTGGGAATGG + Intergenic
1167156829 19:47743693-47743715 GTCCCGGGACGCCGTGGGTGTGG - Intergenic
1167493152 19:49803194-49803216 GTCCCGGGGGACTGTGGGAATGG + Intronic
1167719522 19:51168778-51168800 GTCCATGGGAGCTGAGGATAGGG - Intergenic
1168405507 19:56108319-56108341 GAGCCGGGGAGCTCTGGGCAGGG - Intronic
1202704897 1_KI270713v1_random:15256-15278 GTGCCGGGCAGCGGTGGGTGCGG + Intergenic
928436382 2:31257221-31257243 GTCCCTCAGAGCTGTGGGTAGGG - Intronic
929997234 2:46836380-46836402 CTCCTGGGGAGCTGGGGGTGGGG - Intronic
931208036 2:60166435-60166457 ATCCTGGGGAGCTGTGGGGAAGG + Intergenic
931270077 2:60693761-60693783 GTCCAGAGGAGTTGGGGGTAGGG - Intergenic
931705754 2:64944893-64944915 GACCCGGGGAGGTGAGGGTCTGG - Intergenic
932445050 2:71775441-71775463 GCCCTGGGGAGCTGGGGCTAAGG - Intergenic
932873185 2:75424446-75424468 GTCCCCAGGGGCTGTGGGGAGGG + Intergenic
934860572 2:97760963-97760985 GTCTCGGGGAGGTGTGGGGCTGG + Intronic
935319142 2:101868638-101868660 GTCACAGGGTGATGTGGGTAAGG + Intronic
937278668 2:120702668-120702690 GTAACGGGGTGATGTGGGTAGGG + Intergenic
937890616 2:126935709-126935731 GTCCTGGGGAACTGTGGGTTGGG - Intergenic
943736041 2:191355753-191355775 GTCCTGGGGAGGAGTGAGTAAGG + Intronic
948407832 2:237735915-237735937 GTCCCAGGGACCTGTGGAAACGG + Intronic
948850682 2:240703934-240703956 ATCCCAGGGAGCTGAGGGTTGGG - Intergenic
1169561980 20:6811393-6811415 GTCCCTGGGTTCTTTGGGTAAGG + Intergenic
1169801464 20:9516029-9516051 GACCCGGGGAGCTGAGGTGAAGG + Exonic
1172888173 20:38245808-38245830 TTCACGGGGAGCTGAGGGTGTGG - Intronic
1174484234 20:50851357-50851379 GTCCCTGGGAGCCGTGGGGAGGG - Intronic
1175816409 20:61885302-61885324 GGCTGGGGGAGCTGGGGGTAAGG - Intronic
1175844497 20:62051440-62051462 GTCCCAGGGCCCTGTGGGGAGGG - Intronic
1180045823 21:45304646-45304668 GCCCCAGGGATCTGTGGGCACGG - Intergenic
1181440324 22:22932314-22932336 TTCCTGGGGAGCTGTGAGGAGGG - Intergenic
1184716615 22:46286209-46286231 GTCCTTGGGAGCTGTGAGTCAGG - Intronic
1185341527 22:50293373-50293395 CCCCCGGGTGGCTGTGGGTAGGG - Intronic
1185393968 22:50577598-50577620 GACACAGGGAGCTGTGGGTGTGG - Intronic
1185398259 22:50603507-50603529 GCTCCAGGGAGCTGTGGGTCCGG - Intronic
949991722 3:9584767-9584789 GTCCCGGAGAGATATGAGTAAGG - Intergenic
952901625 3:38115167-38115189 GTCCAGGGGGCCTGTGGTTACGG + Intronic
954367122 3:50152110-50152132 GTCCAGAGGAGCTGAGAGTAGGG + Intergenic
954613508 3:51958241-51958263 GCCAGGGGGAGCTGTGGGCAGGG + Exonic
954661377 3:52228737-52228759 CTCCCGGGGAGCTGAGACTAGGG - Exonic
954902750 3:54034002-54034024 TTCCCGGGCTGCTGTGGGTCTGG + Intergenic
959568137 3:107853503-107853525 GTTCCTGGGAGCTGGGGGTTAGG - Intergenic
959708872 3:109364350-109364372 CTCCAGGGTAGCTGTGGGAAGGG + Intergenic
960998610 3:123357061-123357083 TTGCCAGGGAGCAGTGGGTAGGG + Intronic
961654624 3:128434288-128434310 GTGCCGGGCAGCTGTGGGACAGG + Intergenic
962281867 3:134058194-134058216 GTGTCGGAGAGCTGTGGGTGAGG - Intergenic
962378502 3:134877972-134877994 GTCCCTGGGAGCGGTGGCTGAGG + Intronic
962479639 3:135787333-135787355 GTCCCTGGTTGCTGGGGGTAGGG - Intergenic
964645742 3:158956836-158956858 GTCCCAGGCAGCAGTGGGGAGGG + Intergenic
967602400 3:191405387-191405409 GCCTCGTGGAGCTGTGGGAAGGG - Intergenic
969447677 4:7254845-7254867 GTCCCCGGGGGCTGTGTGCATGG - Intronic
969682744 4:8652325-8652347 CTCCCAGGAAGATGTGGGTAAGG + Intergenic
969886155 4:10217414-10217436 GACCCTGGGAGTTGTGGGGAAGG - Intergenic
974354438 4:60794456-60794478 GTCGGGGGGAGGTGGGGGTAGGG - Intergenic
977994153 4:103482420-103482442 TCCCCGGTGAGCTGTGGGTCAGG - Intergenic
980081352 4:128347730-128347752 GTTTCCAGGAGCTGTGGGTAGGG - Intergenic
982205612 4:152995402-152995424 GTCCCCGGCAGCTGTGGTGAAGG + Intergenic
982214054 4:153065013-153065035 CTCCCGTGGAGCCGTGGGAAGGG + Intergenic
984987590 4:185346318-185346340 CTCCCGGGGATCTGTAGGTTTGG + Intronic
985231334 4:187821201-187821223 GTCTGGTGGAGCTGTGGGGATGG + Intergenic
986464983 5:8012006-8012028 GTCCGTGGGTGCTGAGGGTAGGG + Intergenic
990945753 5:61247630-61247652 TTCACTGGGAGCTGTTGGTAAGG + Intergenic
993694800 5:91048508-91048530 GTCCCCTGGAGCTGAGGGGAAGG - Intronic
997296141 5:132769818-132769840 TTCCCGGGGAGAGGTGGGAATGG + Intronic
997353895 5:133249925-133249947 GGCCAGGGGAGCTGTGAGCAGGG - Intronic
1001596654 5:172902973-172902995 GGCCTGGGGAGGTGTGGGTGGGG - Intronic
1001993451 5:176135201-176135223 GTCCCTGGGAAGTGTGGGGAGGG - Intergenic
1003492135 6:6632289-6632311 GTCCATGGCAGCTGTGGGGAGGG - Intronic
1004503230 6:16227201-16227223 GTTCCGGGTGGCTGTGGGCATGG - Intergenic
1005930605 6:30481358-30481380 GTCCCGGGGCGCTTCGGGCAGGG + Intergenic
1005964473 6:30717208-30717230 CTCCCGGGGAGCCGTGGGCCAGG + Intronic
1006090711 6:31627140-31627162 GCCCCGGTGAGGTGGGGGTAGGG - Exonic
1008893627 6:56525772-56525794 TTCCCAGGGAGCTGTGGCTAAGG + Intronic
1011219063 6:85034893-85034915 GGCCTGGGGAGGTGTGGGTGGGG + Intergenic
1015897939 6:138035062-138035084 GAGCCGGGGAGCAGTGTGTAGGG - Intergenic
1017533216 6:155318164-155318186 GACTCAGGGAGCTATGGGTAGGG + Intergenic
1019701409 7:2476450-2476472 GTGCCGGGGGGCTGGGGGTGGGG + Intronic
1022467944 7:30663837-30663859 GGTCCGGGGAGCTGTGCGTCAGG + Intronic
1022794133 7:33718669-33718691 GTCCTGGGGAGAAGTGAGTATGG - Intergenic
1027218820 7:76201655-76201677 GTCCCCGGGGGCTGGGGATAGGG + Intergenic
1028939736 7:96507921-96507943 GTCCCAGGGATCTGTGGGATTGG - Intronic
1032188791 7:129750661-129750683 ATCCCTGGGAGCTTTGGGTGGGG + Intronic
1036591639 8:10173917-10173939 GTCCCAGCGTGCTGTGGGTTTGG + Intronic
1036782758 8:11660787-11660809 GACACGCGGAGCTTTGGGTAAGG - Intergenic
1037704743 8:21309620-21309642 GTCAGGGGGAGCTGGGAGTAAGG + Intergenic
1037776476 8:21838945-21838967 GTCCCGGGGGTCTGTGGGGAGGG + Intergenic
1037914043 8:22761213-22761235 GCCCCGGGGAACTGTGGGGTGGG + Intronic
1039287311 8:36056124-36056146 GTCATGGGGAGTTGTGGGAAAGG - Intergenic
1046973531 8:120248730-120248752 CTCCCAGGTAGCTGGGGGTACGG - Intronic
1047420592 8:124704892-124704914 GTCCCGGGGAGAAGTGGGGTTGG - Intronic
1048315146 8:133356232-133356254 GTCCCGGGAGGCTGTGGCTCTGG + Intergenic
1048967782 8:139626665-139626687 GTCCCAGGGAACTGTGGGCTGGG - Intronic
1049654538 8:143791881-143791903 GTCCCGGGGAGGTGCTGGTCTGG + Exonic
1050886750 9:10776438-10776460 GTCCCCGGGCCCTGTGGGTTAGG + Intergenic
1051278181 9:15416979-15417001 TTCCTGGGCAGCAGTGGGTAAGG - Intergenic
1052355997 9:27505273-27505295 TTCCCGGGGAGGTCTAGGTACGG - Intronic
1055006950 9:71518502-71518524 GTCCAGGGGAGCTCTGTGTATGG - Intergenic
1055432474 9:76258038-76258060 GTACCTGGGAGCTGTGGAAAAGG - Intronic
1056935202 9:90911060-90911082 GGCCCGGGGAGGTGGGGGCATGG - Intergenic
1057042502 9:91857732-91857754 ATCGCTGGGAGCTGTGGGGAGGG - Intronic
1057314630 9:93960486-93960508 GTGCCGGGGCTCTGTGGGCACGG + Intergenic
1060256006 9:122031611-122031633 GTCCCAGGGAGCTGCGACTAAGG - Intronic
1060295910 9:122342868-122342890 GGCCCGGGGAGCAGGGGGTAGGG + Intergenic
1060485824 9:124045617-124045639 CCCCCGGGGAGCTGTCGGGACGG + Intergenic
1061067673 9:128288731-128288753 GTCCCTGGGAGCTGTGGACAAGG - Exonic
1061306449 9:129735803-129735825 GTGTCGGGGAGTGGTGGGTATGG - Intergenic
1062287242 9:135778621-135778643 ATCCCGGGGTCCTGTGGGTGGGG + Intronic
1062388089 9:136322748-136322770 GTCCCTGGGAACTGTGCGTGGGG + Intergenic
1062670548 9:137706183-137706205 ATCCCGGGGAGTTGTAGGTTGGG + Intronic
1185749211 X:2597190-2597212 GTCCCAGGGAGCAGTGGGAGGGG + Intergenic
1185763868 X:2708775-2708797 GGTCCGGGGAGCAGTGGGTTTGG + Intronic
1186364238 X:8874615-8874637 GCCTGAGGGAGCTGTGGGTAGGG + Intergenic
1188852662 X:35150905-35150927 GTCCAGAGAAGCTGTGGTTAGGG - Intergenic
1189594348 X:42548356-42548378 GTCTAGTGGAGCTGTGGGAAGGG - Intergenic
1189778521 X:44491853-44491875 GTGCTGGGGGGCTGTGGGCAAGG - Intergenic
1190107374 X:47570037-47570059 AGCCCAGGGAACTGTGGGTAAGG - Intronic
1192244444 X:69361000-69361022 GGCCAGGGAAGCTGTGGGAAGGG + Intergenic
1196858724 X:120007609-120007631 GTAACGGGGAGCTGGGAGTAGGG + Intergenic
1198874030 X:141203892-141203914 GTCCAGTTGAGCTGTGGGAAGGG - Intergenic
1199743542 X:150757594-150757616 GTACAGGGGAGATGTGGCTAAGG - Intronic