ID: 923369344

View in Genome Browser
Species Human (GRCh38)
Location 1:233295288-233295310
Sequence TACCCACAGCTCCCCGGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 143}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923369335_923369344 26 Left 923369335 1:233295239-233295261 CCGTGAGGCTGATGGCACGTCTG 0: 1
1: 0
2: 1
3: 15
4: 100
Right 923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG 0: 1
1: 0
2: 0
3: 9
4: 143
923369337_923369344 -2 Left 923369337 1:233295267-233295289 CCTTTCTCCTTCTTCCCTCCATA 0: 1
1: 1
2: 13
3: 128
4: 1189
Right 923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG 0: 1
1: 0
2: 0
3: 9
4: 143
923369334_923369344 27 Left 923369334 1:233295238-233295260 CCCGTGAGGCTGATGGCACGTCT 0: 1
1: 0
2: 0
3: 4
4: 87
Right 923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG 0: 1
1: 0
2: 0
3: 9
4: 143
923369338_923369344 -9 Left 923369338 1:233295274-233295296 CCTTCTTCCCTCCATACCCACAG 0: 1
1: 0
2: 4
3: 86
4: 576
Right 923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG 0: 1
1: 0
2: 0
3: 9
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923369344 Original CRISPR TACCCACAGCTCCCCGGGAC CGG Intronic
900422334 1:2560998-2561020 CACCCACAGCCCCAGGGGACAGG - Intronic
900762704 1:4483567-4483589 CACCTCCAGCCCCCCGGGACTGG - Intergenic
901229583 1:7634347-7634369 TTCCCACAGCTGCCCAGGTCTGG - Intronic
901794674 1:11673439-11673461 TACCCACTCCTCCCAGGGCCAGG + Intronic
902214043 1:14923761-14923783 TCCCCACAGCTGACCGGGAGAGG - Intronic
902472505 1:16658448-16658470 CACCCACCGCTGCCCGGCACCGG - Intergenic
902486300 1:16748998-16749020 CACCCACCGCTGCCCGGCACTGG + Intronic
903018455 1:20377143-20377165 TACCCTCAGCTCCTCGTGGCTGG + Intergenic
907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG + Intronic
912948644 1:114105493-114105515 TACCCCCAGCTTCCCAGGAAGGG + Intronic
916203547 1:162294333-162294355 TCCCCACATCTCCCAGGGACGGG + Intronic
923015128 1:230120645-230120667 GACGCACAGCTCCCCAGGGCTGG + Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1062919304 10:1267159-1267181 CACCCACACCTACCCGGGAGGGG - Intronic
1067829913 10:49605660-49605682 TCTCTACAGCTCCCAGGGACAGG - Intergenic
1069270628 10:66522612-66522634 GACCCACAGCTCCACAGGGCTGG - Intronic
1075999902 10:126905884-126905906 TACCCCCAACTCCCCGGCCCCGG + Intronic
1076620167 10:131781968-131781990 AACTCACAGCTCCCAGGGCCAGG - Intergenic
1077058008 11:605339-605361 TGCCCACAGCCCCCAGGGAGAGG - Intronic
1077059553 11:611834-611856 TCCCGACAGCTCCCCGGGCATGG - Exonic
1077059567 11:611873-611895 TCCCGACAGCTCCCCGGGCATGG - Exonic
1078606918 11:12785138-12785160 TCCCCACGGCTCCCAGGCACAGG - Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG + Intronic
1084968466 11:72756560-72756582 CACCCACAGCACCCCTGGAGGGG + Intronic
1084978393 11:72815520-72815542 GACTCACAGCTCCCTGGGTCGGG - Intronic
1089800695 11:121024428-121024450 TCCCCACAGCTGCTCGAGACAGG - Intronic
1093931140 12:24956099-24956121 TAATCCCAGCTCCCCGGGGCGGG - Intergenic
1095810768 12:46371928-46371950 AACCCCCAGCTCCCGGGGCCCGG - Intronic
1096325960 12:50662239-50662261 TACCCAGAGATCCCCAGAACAGG - Intronic
1103359096 12:120342973-120342995 TGCCCCCAACTCCCCGGGCCCGG - Exonic
1104532916 12:129589346-129589368 GACCCACAGTTCCACGTGACTGG - Intronic
1105642841 13:22284220-22284242 TCCCCACCGCTCCCCGGCCCTGG + Intergenic
1105916619 13:24922865-24922887 TTCCCACAGGACCTCGGGACGGG - Exonic
1106534211 13:30624496-30624518 TAGCCCCAGCTACCCGGGAGGGG + Intronic
1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG + Intronic
1112436503 13:99394505-99394527 TACTCACAGCTCCCAAGGAGAGG - Intergenic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1117546598 14:56798420-56798442 GGCCCACAGCGCCCTGGGACCGG + Intergenic
1117736381 14:58773082-58773104 TACCCACGGTTCCCACGGACTGG - Intergenic
1117942874 14:60987739-60987761 AACCCACAGCTCCCCTCCACTGG + Intronic
1121743059 14:96267378-96267400 TCCCCACAGCTGCACGGGAAGGG + Intronic
1122157240 14:99756972-99756994 TACACACACATCCCCAGGACCGG + Intronic
1124124797 15:26929544-26929566 GCCCCACAGCTCTCTGGGACTGG + Intronic
1129335187 15:74847841-74847863 TTCCCTCACCTCCCCTGGACAGG - Intronic
1130044113 15:80430822-80430844 TGCCCACTGCTGCCCTGGACAGG - Intronic
1130886254 15:88095011-88095033 TAGCCACAGCTCCCAGGTAATGG - Intronic
1130995534 15:88901769-88901791 GATCCACAGCTCCCAGGGGCAGG + Intronic
1136551755 16:30985759-30985781 GACCCGCAGCTCCCCGAGCCGGG - Exonic
1136750226 16:32628888-32628910 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1137622793 16:49887359-49887381 TACCCACAGATTCCAGAGACTGG + Intergenic
1139636211 16:68260067-68260089 TACCCAGAGGTCCCAGGGATCGG + Exonic
1140913281 16:79472880-79472902 TACCCAAATCTCTCCAGGACAGG - Intergenic
1140914328 16:79481172-79481194 TACCCAAATCTCTCCAGGACGGG + Intergenic
1203052357 16_KI270728v1_random:888093-888115 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1143401880 17:6651617-6651639 ATCCCACAGTGCCCCGGGACCGG - Exonic
1144029116 17:11304081-11304103 TACCCAAAGCTTCCCAGGAAAGG - Intronic
1144044989 17:11447438-11447460 CCCCCACAGCTTCCCGGAACTGG + Intronic
1144786249 17:17833490-17833512 GATCCACAGCTGCCCGGGGCTGG + Intronic
1145862020 17:28218864-28218886 TGCACAGAGCTTCCCGGGACTGG + Intergenic
1147471507 17:40666429-40666451 TACCCACAGCTCCTGGTGAGAGG + Intergenic
1147763931 17:42820182-42820204 TACCCACAGCTGCCAGTCACTGG - Intronic
1147931380 17:43983672-43983694 CACCCAACGCTCCCCGGGGCCGG + Intronic
1152048957 17:77958282-77958304 GAGCCACAGCGCCCAGGGACCGG + Intergenic
1152220671 17:79063452-79063474 TACCCACCGCTTCCCTGGGCTGG - Intergenic
1157426059 18:47585148-47585170 CACCCACAGCACCCTGGGTCTGG + Intergenic
1157467038 18:47956227-47956249 TAGCCACTGGTCCCCTGGACAGG - Intergenic
1157601615 18:48896671-48896693 TACCCACAGCTTCCAGGCAGAGG + Intergenic
1160302705 18:77700193-77700215 CACCCACAGCTCCCCTGCGCTGG - Intergenic
1160982677 19:1823529-1823551 TGCCCACGGCCCCCCGGCACAGG + Intronic
1162248778 19:9425322-9425344 TACTCACAGATCCCCAGGATGGG - Intronic
1163648189 19:18502130-18502152 GCCCCACAGCTCCACGGGGCAGG + Intronic
1163826099 19:19525796-19525818 TGCACACAGCTGCCAGGGACAGG - Intronic
1165730481 19:38141634-38141656 AACCCAGAGCTCCCCAGCACTGG - Intronic
1166383885 19:42369849-42369871 TCCACACATCTCCCTGGGACAGG - Intronic
1166945184 19:46391872-46391894 TCCACACAGCTCCACGGGAGAGG - Intronic
1167158133 19:47751511-47751533 TATCCACAGACCCCCTGGACAGG + Exonic
1202704896 1_KI270713v1_random:15253-15275 CACCCACCGCTGCCCGGCACCGG - Intergenic
928415763 2:31090300-31090322 CACTCAGAGCTCCCTGGGACTGG + Intronic
932314812 2:70772908-70772930 TATCCACAGCTCTCCAGGTCTGG - Intergenic
932373491 2:71213044-71213066 TCCCCACTGCTCCCCAGGCCAGG - Intronic
933724842 2:85420865-85420887 TCCCCACAGTGGCCCGGGACGGG + Intronic
934860571 2:97760960-97760982 GCCCCACACCTCCCCGAGACAGG - Intronic
935332267 2:101985844-101985866 TACCCTCATCACCCCGGGCCAGG - Intergenic
937252539 2:120533798-120533820 TTCCCACAGCTGCCGGGGACCGG + Intergenic
937278666 2:120702665-120702687 TACCCACATCACCCCGTTACTGG - Intergenic
940876963 2:158907481-158907503 TACCCCCACCACCCTGGGACTGG - Intergenic
942988202 2:182166478-182166500 TACCAACAGCCTCCCGGGAAGGG + Intronic
948850685 2:240703937-240703959 AACCCTCAGCTCCCTGGGATGGG + Intergenic
948909522 2:240996150-240996172 AACCCCCAGCTCCCCGGGCCCGG + Intergenic
1169325664 20:4673557-4673579 TACTCACAGGTCCCAGAGACCGG + Intergenic
1169416807 20:5424160-5424182 TACTCACAGGTTCCAGGGACTGG + Intergenic
1172933861 20:38605159-38605181 TACCCACAGCTCTCCAGCACTGG + Intronic
1175190887 20:57211493-57211515 TACCCACAGCTTCCTGGGTCAGG - Intronic
1179183176 21:39062275-39062297 TACCCACAGCTGCCCACGGCAGG + Intergenic
1181361100 22:22336745-22336767 GACCCCCAGCCCCCCCGGACAGG - Intergenic
1181490128 22:23256383-23256405 TTCCCACAGCACCCCGGGCAAGG - Intronic
1183323909 22:37181069-37181091 TACCCACTGCTCCCCAAGGCTGG - Exonic
953240005 3:41140496-41140518 TATCCAGAGGTCCCCGGGAGAGG + Intergenic
954367120 3:50152107-50152129 TACTCTCAGCTCCTCTGGACTGG - Intergenic
954609937 3:51939037-51939059 TACCCCCAGCTCCCAGGAGCAGG - Intronic
960970878 3:123139323-123139345 CACCCACGGCTCCCCAAGACAGG + Intronic
961001644 3:123378212-123378234 TATCCACCCCTCCCAGGGACTGG - Intronic
963080010 3:141382759-141382781 TTCCCACAGTTCCCAGGGCCTGG + Intronic
967938013 3:194744750-194744772 TCCCCAGAGCTCCTAGGGACTGG + Intergenic
968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG + Intergenic
968727691 4:2255892-2255914 CACCCCCAGCTCCCCGGCAGCGG - Intronic
984530466 4:180909624-180909646 TACCCACAGGTCCCTGGAAGAGG - Intergenic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
986307819 5:6528732-6528754 CACCCTCAGCTTCCCGGGCCAGG + Intergenic
986705747 5:10453316-10453338 TACCCAGCGCACCCCGAGACAGG - Intronic
999512927 5:152271633-152271655 TACCCACAGCTCTCAGAGAGAGG + Intergenic
999832425 5:155333249-155333271 TACTCACAGCTCCTGGGGATAGG - Intergenic
1006166857 6:32070359-32070381 CACCCACAGCTCCCCAAGGCGGG + Intronic
1009929483 6:70160169-70160191 GACCCACAGCTCCACGTGGCTGG + Intronic
1013155382 6:107488424-107488446 TCCCCTCGCCTCCCCGGGACGGG + Intergenic
1013188466 6:107782403-107782425 CACACTCAGCCCCCCGGGACCGG - Intronic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1019133569 6:169894580-169894602 GACCCCCAGCTCCCGGGGACAGG + Intergenic
1019259492 7:72899-72921 CACCCACACCTCCCCTGGGCCGG - Intergenic
1019395936 7:817478-817500 TCCCCAGGGCTCCCCAGGACAGG + Intronic
1022794134 7:33718672-33718694 TACTCACTTCTCCCCAGGACAGG + Intergenic
1023200048 7:37687158-37687180 TTCCCACAGCTACCCAGGGCAGG + Intronic
1024702569 7:51920619-51920641 TACCCACAGCTGATGGGGACTGG - Intergenic
1024896233 7:54265448-54265470 AACCCTCAGCTTCCAGGGACTGG - Intergenic
1034564775 7:151904390-151904412 TTCCCACAGGGCCCCGGGTCAGG - Intergenic
1035412040 7:158652269-158652291 TACTCAGAACTCCCCAGGACGGG - Intronic
1037884370 8:22588697-22588719 TCCCCAAAGCTCCACGGGGCAGG + Intronic
1037914041 8:22761210-22761232 ACCCCACAGTTCCCCGGGGCAGG - Intronic
1039979159 8:42391956-42391978 GGCCCACCGCTCTCCGGGACTGG - Intronic
1041678713 8:60564288-60564310 TACCCACAGCACCAAGGGAAAGG - Intronic
1041803450 8:61824409-61824431 TACTCACAGTTCCCCAGGACTGG + Intergenic
1044709109 8:95038462-95038484 TAGCCCCAGCTACCCGGGCCTGG - Intronic
1048315145 8:133356229-133356251 GAGCCACAGCCTCCCGGGACAGG - Intergenic
1048967784 8:139626668-139626690 AGCCCACAGTTCCCTGGGACAGG + Intronic
1049223166 8:141437016-141437038 GACCCACAGCTCCCCATGGCGGG - Intergenic
1049223181 8:141437053-141437075 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223196 8:141437090-141437112 GACCCACAGCTCCCCATGGCGGG - Intergenic
1049223211 8:141437127-141437149 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223226 8:141437164-141437186 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223241 8:141437201-141437223 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223256 8:141437238-141437260 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223271 8:141437275-141437297 GACCCACAGCTCCCCACGGCGGG - Intergenic
1052355998 9:27505276-27505298 TACCTAGACCTCCCCGGGAAAGG + Intronic
1055432475 9:76258041-76258063 TTTCCACAGCTCCCAGGTACAGG + Intronic
1060266131 9:122112384-122112406 TACCCACAGCTGCCCTGGGAGGG + Intergenic
1060829735 9:126706036-126706058 TACCCGCAGCTCCTCGAGCCCGG + Intergenic
1061545432 9:131301645-131301667 CTCCCACAGCTTCCCGGGCCAGG + Intronic
1061744234 9:132727974-132727996 TACTCACAGCTCCCAGGAAAAGG - Intronic
1062745210 9:138207564-138207586 CACCCACACCTCCCCTGGGCCGG + Intergenic
1186473539 X:9839349-9839371 CACCCACATCTCCCTGGGTCTGG + Intronic
1188761778 X:34041356-34041378 GACTCACAGCTCCACAGGACTGG - Intergenic
1197758284 X:130011195-130011217 CACCCACAGCTCCCAAGGGCAGG + Intronic