ID: 923369345

View in Genome Browser
Species Human (GRCh38)
Location 1:233295290-233295312
Sequence GTCCGGTCCCGGGGAGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923369345_923369355 1 Left 923369345 1:233295290-233295312 CCCACAGCTCCCCGGGACCGGAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 923369355 1:233295314-233295336 CTCCCCACTCACCAGGTGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 294
923369345_923369361 8 Left 923369345 1:233295290-233295312 CCCACAGCTCCCCGGGACCGGAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 923369361 1:233295321-233295343 CTCACCAGGTGCAGGGCCAGGGG 0: 1
1: 0
2: 2
3: 28
4: 359
923369345_923369354 0 Left 923369345 1:233295290-233295312 CCCACAGCTCCCCGGGACCGGAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 923369354 1:233295313-233295335 CCTCCCCACTCACCAGGTGCAGG 0: 1
1: 1
2: 3
3: 28
4: 347
923369345_923369360 7 Left 923369345 1:233295290-233295312 CCCACAGCTCCCCGGGACCGGAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 923369360 1:233295320-233295342 ACTCACCAGGTGCAGGGCCAGGG 0: 1
1: 0
2: 3
3: 33
4: 278
923369345_923369364 21 Left 923369345 1:233295290-233295312 CCCACAGCTCCCCGGGACCGGAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 923369364 1:233295334-233295356 GGGCCAGGGGCAGCAGCAGGAGG 0: 1
1: 2
2: 15
3: 187
4: 1256
923369345_923369363 18 Left 923369345 1:233295290-233295312 CCCACAGCTCCCCGGGACCGGAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 923369363 1:233295331-233295353 GCAGGGCCAGGGGCAGCAGCAGG 0: 1
1: 7
2: 41
3: 340
4: 1631
923369345_923369359 6 Left 923369345 1:233295290-233295312 CCCACAGCTCCCCGGGACCGGAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 923369359 1:233295319-233295341 CACTCACCAGGTGCAGGGCCAGG 0: 1
1: 1
2: 1
3: 46
4: 369
923369345_923369351 -6 Left 923369345 1:233295290-233295312 CCCACAGCTCCCCGGGACCGGAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 923369351 1:233295307-233295329 CCGGACCCTCCCCACTCACCAGG 0: 1
1: 0
2: 2
3: 31
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923369345 Original CRISPR GTCCGGTCCCGGGGAGCTGT GGG (reversed) Intronic
902472504 1:16658446-16658468 CTCCGGTGCCGGGCAGCGGTGGG + Intergenic
905223875 1:36466893-36466915 GTCTGGGTCCGGGCAGCTGTGGG + Exonic
908868211 1:68576329-68576351 GACTGGTTCTGGGGAGCTGTGGG + Intergenic
910200215 1:84690816-84690838 GTCCGGGGCCGGGGCTCTGTGGG + Intergenic
910494085 1:87806585-87806607 GCCCGGTCCCAGGGAGCTGGCGG + Intergenic
915850210 1:159313844-159313866 GTCCTGTCCCAGGGAACTCTGGG + Exonic
916203549 1:162294335-162294357 GGCCCGTCCCTGGGAGATGTGGG - Intronic
923369345 1:233295290-233295312 GTCCGGTCCCGGGGAGCTGTGGG - Intronic
1064392468 10:14953859-14953881 GCCCGCTCCCGGGGCGCTGGGGG - Intronic
1074916432 10:117960280-117960302 GACAGGTACAGGGGAGCTGTGGG + Intergenic
1076741946 10:132490064-132490086 GTCCCGTCCCGCGGGGCTGGTGG + Intergenic
1076746707 10:132518179-132518201 GTCAGGTTCACGGGAGCTGTTGG - Intergenic
1077059551 11:611832-611854 GGCCATGCCCGGGGAGCTGTCGG + Exonic
1077059565 11:611871-611893 GGCCATGCCCGGGGAGCTGTCGG + Exonic
1077551901 11:3204184-3204206 GCCCGGGCCCAGGGAGCTGCAGG + Intergenic
1078093757 11:8283915-8283937 GGCCGGGCCCCGGGGGCTGTGGG - Intergenic
1078160099 11:8832719-8832741 GTCAGGGCCCAGGAAGCTGTGGG - Intronic
1081771525 11:45653049-45653071 GTCTGGTCCTGTGGATCTGTTGG + Intronic
1087008118 11:93488751-93488773 GACAGGACCCTGGGAGCTGTGGG + Intronic
1089292220 11:117444215-117444237 GTTTGGTCCCTGGGAGCTGATGG + Intronic
1095810766 12:46371926-46371948 GCCCGGGCCCCGGGAGCTGGGGG + Intronic
1096650685 12:53060668-53060690 GTCCTGTCGCCGGGTGCTGTAGG - Exonic
1097439914 12:59596470-59596492 CTCAGTTCCCGGGCAGCTGTCGG - Intronic
1103359095 12:120342971-120342993 GGCCGGGCCCGGGGAGTTGGGGG + Exonic
1103922176 12:124404729-124404751 GTCAGCTCTCGGGGATCTGTGGG - Intronic
1106165148 13:27238602-27238624 GTCCGGTACCTGGCAGCTGGTGG - Intergenic
1107735095 13:43391067-43391089 GGCCGTTCTGGGGGAGCTGTGGG - Intronic
1117546599 14:56798422-56798444 CGCCGGTCCCAGGGCGCTGTGGG - Intergenic
1127284715 15:57522254-57522276 TTCCGGTCCCTGGGCTCTGTTGG - Intronic
1128468009 15:67928888-67928910 TTCAGGTCCTGGGGAGCTGTTGG + Intergenic
1128799893 15:70490607-70490629 GGCGGGTCCCTGGGTGCTGTAGG - Intergenic
1129462711 15:75707901-75707923 GTGTGCTCCCGGGGAGCTGCTGG + Intronic
1129722161 15:77883515-77883537 GTGTGCTCCCGGGGAGCTGCTGG - Intergenic
1133006051 16:2882545-2882567 GTCCGGGCACAGGGAGCTGTGGG - Intergenic
1134208734 16:12258600-12258622 GTCAGGGCCCTGGGACCTGTGGG - Intronic
1137988812 16:53131537-53131559 GTCCCGACCCCGGGGGCTGTGGG - Intronic
1138973142 16:62170714-62170736 GTGGGTTCCAGGGGAGCTGTGGG - Intergenic
1142029126 16:87829706-87829728 TTCCAGTCCCAGGGAGCTGCAGG - Intergenic
1142547493 17:714873-714895 TTCCGGGACCGGGGAACTGTGGG + Intronic
1143401879 17:6651615-6651637 TTCCGGTCCCGGGGCACTGTGGG + Exonic
1143493003 17:7294696-7294718 GTGCGGTCCGGGGGTGCTGCTGG - Intergenic
1150582040 17:66483048-66483070 GTGCTGTCCCGTAGAGCTGTCGG + Intronic
1151764271 17:76124191-76124213 GTCTGGTCCTGAGGAGCTGCAGG - Intergenic
1152608808 17:81305802-81305824 CTCCCGGCCCTGGGAGCTGTAGG + Intergenic
1152920528 17:83064326-83064348 GTCCAGGCCTGGGGAGCTGGAGG + Intergenic
1159277798 18:66243686-66243708 GTGCAGTCCCTGGAAGCTGTGGG - Intergenic
1160302704 18:77700191-77700213 GTCCAGCGCAGGGGAGCTGTGGG + Intergenic
1161038047 19:2096354-2096376 GTCCGGTCCGCGGGTGCGGTCGG - Intronic
1161951986 19:7472645-7472667 GTCCAGTCCCCAGGAGTTGTTGG + Intergenic
1162827533 19:13262902-13262924 GTAGGGTCCCATGGAGCTGTGGG - Intronic
1162931433 19:13959700-13959722 GGACAGTCCCGGGGAGCTGCCGG + Intronic
1162967897 19:14164588-14164610 GTCCGGGCCAGGGGAGGTGGGGG - Intronic
1163648191 19:18502132-18502154 CTCCTGCCCCGTGGAGCTGTGGG - Intronic
1163829536 19:19541121-19541143 GTCCCTGCTCGGGGAGCTGTGGG + Exonic
1163862486 19:19749535-19749557 CTCAGGGCACGGGGAGCTGTTGG - Intergenic
1202704895 1_KI270713v1_random:15251-15273 CTCCGGTGCCGGGCAGCGGTGGG + Intergenic
931241931 2:60461559-60461581 GCCGGGTTCCGGGGAGCTGGCGG + Exonic
934860568 2:97760958-97760980 GCCCTGTCTCGGGGAGGTGTGGG + Intronic
935840378 2:107102791-107102813 GTCGGGTGCTGGAGAGCTGTCGG + Intergenic
937252540 2:120533800-120533822 AGCCGGTCCCCGGCAGCTGTGGG - Intergenic
947152828 2:227132130-227132152 GTCAGGGCACAGGGAGCTGTGGG - Intronic
948572468 2:238926427-238926449 GTCAGGTCCTTGGGAGATGTCGG - Intergenic
948909523 2:240996152-240996174 AGCCGGGCCCGGGGAGCTGGGGG - Intergenic
1172296025 20:33811698-33811720 GTCCGGGCCCGGGGAGCCTGGGG - Intronic
1175190886 20:57211491-57211513 GTCCTGACCCAGGAAGCTGTGGG + Intronic
1176302975 21:5107501-5107523 GGCTGGACCCGGGGAGCAGTGGG - Intergenic
1179854050 21:44154423-44154445 GGCTGGACCCGGGGAGCAGTGGG + Intergenic
1183715731 22:39532508-39532530 GGAGGGTCCCGGGGGGCTGTAGG + Exonic
954060460 3:48062002-48062024 GCCCGTTCCCAGTGAGCTGTTGG - Intronic
963920673 3:150901979-150902001 GTCCTGTCTCGGGGAGCTTAAGG + Intronic
982191926 4:152866360-152866382 GCCCGTTCCCAGTGAGCTGTTGG + Intronic
986292401 5:6410656-6410678 GTGCAGCTCCGGGGAGCTGTGGG + Intergenic
1019133570 6:169894582-169894604 GGCCTGTCCCCGGGAGCTGGGGG - Intergenic
1019198903 6:170297683-170297705 GGCCCGTGCTGGGGAGCTGTTGG + Intronic
1019277276 7:182395-182417 GGCGGCTCCCGGGGGGCTGTGGG - Intergenic
1019639641 7:2096633-2096655 GTCCTCTGCCGAGGAGCTGTAGG - Intronic
1020257252 7:6509114-6509136 GTCCGGGCTTGGGGGGCTGTCGG + Exonic
1022092035 7:27114028-27114050 GTCTGGTCCGGGGGTGCGGTGGG + Intronic
1029461067 7:100694126-100694148 GTCCGGTCCCGGGGCGTGGGCGG + Intergenic
1036910525 8:12754549-12754571 GTCGGGTCTCGGGGTGCTGGGGG - Intronic
1037914039 8:22761208-22761230 GGCCTGCCCCGGGGAACTGTGGG + Intronic
1038424230 8:27454163-27454185 GTCCGGTCCAGGTTAGCTGTGGG - Exonic
1039979158 8:42391954-42391976 CTCCAGTCCCGGAGAGCGGTGGG + Intronic
1043368233 8:79560272-79560294 GTTCTGTCCCAGGGAGATGTGGG + Intergenic
1049321383 8:141998715-141998737 GCCTGGGCCCTGGGAGCTGTAGG - Intergenic
1049653562 8:143787989-143788011 GTCGGGGCCCGAGGAGCTGCTGG - Intergenic
1061054470 9:128215102-128215124 GTCCGGACCTGGGGACCTGCTGG + Intronic
1061766162 9:132882717-132882739 GTCCAGTCCAAGGGAGATGTTGG - Intronic
1062217871 9:135398973-135398995 TCCTGGGCCCGGGGAGCTGTGGG + Intergenic
1185479721 X:437444-437466 GGCGGGCCCCGGGGAGCTGCGGG - Intergenic