ID: 923369346

View in Genome Browser
Species Human (GRCh38)
Location 1:233295291-233295313
Sequence GGTCCGGTCCCGGGGAGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 175}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923369346_923369354 -1 Left 923369346 1:233295291-233295313 CCACAGCTCCCCGGGACCGGACC 0: 1
1: 0
2: 1
3: 9
4: 175
Right 923369354 1:233295313-233295335 CCTCCCCACTCACCAGGTGCAGG 0: 1
1: 1
2: 3
3: 28
4: 347
923369346_923369359 5 Left 923369346 1:233295291-233295313 CCACAGCTCCCCGGGACCGGACC 0: 1
1: 0
2: 1
3: 9
4: 175
Right 923369359 1:233295319-233295341 CACTCACCAGGTGCAGGGCCAGG 0: 1
1: 1
2: 1
3: 46
4: 369
923369346_923369351 -7 Left 923369346 1:233295291-233295313 CCACAGCTCCCCGGGACCGGACC 0: 1
1: 0
2: 1
3: 9
4: 175
Right 923369351 1:233295307-233295329 CCGGACCCTCCCCACTCACCAGG 0: 1
1: 0
2: 2
3: 31
4: 252
923369346_923369364 20 Left 923369346 1:233295291-233295313 CCACAGCTCCCCGGGACCGGACC 0: 1
1: 0
2: 1
3: 9
4: 175
Right 923369364 1:233295334-233295356 GGGCCAGGGGCAGCAGCAGGAGG 0: 1
1: 2
2: 15
3: 187
4: 1256
923369346_923369355 0 Left 923369346 1:233295291-233295313 CCACAGCTCCCCGGGACCGGACC 0: 1
1: 0
2: 1
3: 9
4: 175
Right 923369355 1:233295314-233295336 CTCCCCACTCACCAGGTGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 294
923369346_923369360 6 Left 923369346 1:233295291-233295313 CCACAGCTCCCCGGGACCGGACC 0: 1
1: 0
2: 1
3: 9
4: 175
Right 923369360 1:233295320-233295342 ACTCACCAGGTGCAGGGCCAGGG 0: 1
1: 0
2: 3
3: 33
4: 278
923369346_923369361 7 Left 923369346 1:233295291-233295313 CCACAGCTCCCCGGGACCGGACC 0: 1
1: 0
2: 1
3: 9
4: 175
Right 923369361 1:233295321-233295343 CTCACCAGGTGCAGGGCCAGGGG 0: 1
1: 0
2: 2
3: 28
4: 359
923369346_923369363 17 Left 923369346 1:233295291-233295313 CCACAGCTCCCCGGGACCGGACC 0: 1
1: 0
2: 1
3: 9
4: 175
Right 923369363 1:233295331-233295353 GCAGGGCCAGGGGCAGCAGCAGG 0: 1
1: 7
2: 41
3: 340
4: 1631

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923369346 Original CRISPR GGTCCGGTCCCGGGGAGCTG TGG (reversed) Intronic
900629108 1:3624568-3624590 GTCGCGGTGCCGGGGAGCTGAGG - Intergenic
901235679 1:7666409-7666431 AGTCAGATCCCCGGGAGCTGAGG - Intronic
901426113 1:9183075-9183097 TCTCGGGTCCCGGGGGGCTGGGG + Intergenic
901653589 1:10756535-10756557 GGGCCTGTCCAGGGGCGCTGGGG + Intronic
901817828 1:11805212-11805234 GGTCCTGTCTCAGGGAACTGGGG - Intronic
902600876 1:17539660-17539682 CGCCCGGTCCCGGGGCGCCGCGG - Intergenic
904079290 1:27862113-27862135 GGGACAGTCCCGGGGAGGTGAGG + Intergenic
904500080 1:30908400-30908422 GGGGCGGCCCCGGGGAGCCGTGG + Intronic
905037879 1:34929492-34929514 GGCCCGGGCCGGGGGCGCTGCGG + Exonic
906090040 1:43171557-43171579 GGTCCGGTACCGGAGATCGGTGG - Exonic
907938129 1:59061014-59061036 GGTCAGGTCCTGGGGAGATCGGG + Intergenic
912401586 1:109397868-109397890 GGAGCGGCCCTGGGGAGCTGCGG - Exonic
915737534 1:158094447-158094469 GGTCCTGTAGCGGGGAGGTGAGG + Intronic
916265732 1:162888271-162888293 GAACCTGTCCCGGGGAGGTGGGG + Intergenic
918434861 1:184500896-184500918 GGTCAGCTGCCGGGGGGCTGGGG - Intronic
921903954 1:220476453-220476475 GGTCCGGGGCCAGGGAGCTGGGG - Intergenic
923369346 1:233295291-233295313 GGTCCGGTCCCGGGGAGCTGTGG - Intronic
923735942 1:236607746-236607768 GGTCGGGTCCCGGCCAGGTGCGG + Intergenic
1064392469 10:14953860-14953882 CGCCCGCTCCCGGGGCGCTGGGG - Intronic
1066063971 10:31749403-31749425 GGCACGGCCCCGGGGAGCAGAGG - Intergenic
1066677896 10:37907839-37907861 GGTCCGCTACCTGGGAGTTGGGG - Intergenic
1070603823 10:77884412-77884434 GGTCCTTTCCCAGTGAGCTGAGG - Intronic
1070843603 10:79504919-79504941 GGTCTGGTTCAGTGGAGCTGCGG - Intergenic
1070930063 10:80254681-80254703 GGTCTGGTTCAGTGGAGCTGCGG + Intergenic
1073485910 10:103819179-103819201 GCTCCAGTCCCAGGGAGCTCTGG + Intronic
1075032045 10:119030070-119030092 GGGCCGGGCCTGGGGCGCTGGGG + Exonic
1076944524 10:133637321-133637343 GGTCCTCTCCCTGGGAGGTGGGG + Intergenic
1077010227 11:376360-376382 GGTGCGGGCCAGGGGCGCTGCGG - Intronic
1077564938 11:3291694-3291716 GGTCAGGTGCAGTGGAGCTGTGG - Intergenic
1077570824 11:3337511-3337533 GGTCAGGTGCAGTGGAGCTGTGG - Intergenic
1078093758 11:8283916-8283938 GGGCCGGGCCCCGGGGGCTGTGG - Intergenic
1078246184 11:9574419-9574441 GGTCCGGCCGCGGCGAGCGGCGG - Exonic
1079128513 11:17734900-17734922 GGTCCGGGCGCGGCGAGGTGAGG - Exonic
1080496937 11:32829866-32829888 GGCCCGGCCCCCGGGAGGTGGGG + Intergenic
1083644686 11:64165556-64165578 GGTCCGTTCCAGGGCAGATGGGG + Intronic
1085471115 11:76758719-76758741 GGTCTGGAGCTGGGGAGCTGGGG + Intergenic
1085726852 11:78962016-78962038 GGTGGGATCCGGGGGAGCTGGGG - Intronic
1087175483 11:95091252-95091274 GGTGTGGTCCTGGGCAGCTGTGG - Intronic
1090347120 11:126080468-126080490 GGTCCTCTCCCCTGGAGCTGGGG - Intergenic
1091643789 12:2257630-2257652 GGACCGGTACCTGGGGGCTGGGG + Intronic
1095810765 12:46371925-46371947 CGCCCGGGCCCCGGGAGCTGGGG + Intronic
1096549102 12:52360545-52360567 GGTCTTGTCCCTGAGAGCTGGGG + Exonic
1096700529 12:53380241-53380263 GGTCCTGTCCGGGGGGGTTGGGG - Exonic
1097236985 12:57546989-57547011 GGCGCGGTCCTGGGGAGCCGGGG + Intronic
1098943688 12:76566067-76566089 GGTCCTGACCCGGGAGGCTGAGG + Intergenic
1103359094 12:120342970-120342992 GGGCCGGGCCCGGGGAGTTGGGG + Exonic
1104678428 12:130731663-130731685 GGTGCTGTCCAGGGGAGCTGGGG + Intergenic
1104735400 12:131133178-131133200 GGTGAGGGCCTGGGGAGCTGAGG - Intronic
1107359423 13:39603012-39603034 GGTCGGGCCCCGGGGTTCTGCGG - Exonic
1107735096 13:43391068-43391090 GGGCCGTTCTGGGGGAGCTGTGG - Intronic
1108247431 13:48532417-48532439 GGGCCGGTGCCCGGGACCTGGGG + Intronic
1113985817 13:114314723-114314745 GGGACGGTCCCGGGAAGCCGCGG + Intronic
1117055821 14:51911111-51911133 GGTCAGGGCCCTGGAAGCTGGGG + Intronic
1117546600 14:56798423-56798445 GCGCCGGTCCCAGGGCGCTGTGG - Intergenic
1119168771 14:72516664-72516686 GGTCCTGTGAGGGGGAGCTGAGG - Intronic
1121636217 14:95455514-95455536 GCTCCGGTCCAGGGGAGCCTGGG - Exonic
1122316134 14:100827059-100827081 GGTCTGGACGCTGGGAGCTGGGG + Intergenic
1122960529 14:105091929-105091951 GGCCCAGGCCCTGGGAGCTGGGG - Intergenic
1123033495 14:105462107-105462129 GGCACGGTCTCGGGGGGCTGCGG + Intronic
1202904456 14_GL000194v1_random:60221-60243 GGTCAGGTCCGGGGGAGGTCAGG - Intergenic
1124698341 15:31887380-31887402 AGGCAGGTCGCGGGGAGCTGGGG + Intergenic
1129053715 15:72804980-72805002 GGTCAGGTCCCAGGGAAATGCGG - Intergenic
1130995535 15:88901772-88901794 GCTCCTGCCCCTGGGAGCTGTGG - Intronic
1133006052 16:2882546-2882568 GGTCCGGGCACAGGGAGCTGTGG - Intergenic
1133017544 16:2951266-2951288 GGTCAGGTCCCGGGGGGCCAGGG - Intergenic
1133203567 16:4219325-4219347 TGCCCTGTCCCTGGGAGCTGGGG + Intronic
1134208735 16:12258601-12258623 GGTCAGGGCCCTGGGACCTGTGG - Intronic
1136999991 16:35221493-35221515 GGTCCTCTCCCTGGGAGGTGGGG + Intergenic
1137026826 16:35485683-35485705 GGTCCTCTCCCTGGGAGGTGGGG + Intergenic
1137033018 16:35543196-35543218 GGTCCTCTCCCTGGGAGGTGGGG + Intergenic
1137683226 16:50368836-50368858 GGTCCGGGCCAGGCGAGCGGAGG + Intronic
1137723459 16:50641377-50641399 GGTACGGTCCCGGTGAGCAGAGG - Intergenic
1138575388 16:57904217-57904239 GGTGTGGTCCCAGGGACCTGAGG - Intronic
1139774999 16:69311441-69311463 GGTCCGGCCCCGGGGAGCCGAGG - Exonic
1143401878 17:6651614-6651636 CTTCCGGTCCCGGGGCACTGTGG + Exonic
1143444688 17:7000528-7000550 GGTTGGGTCCCTGGGAGCAGAGG - Intronic
1145077407 17:19867480-19867502 GCTCCGGGCCCGCGGAGCCGCGG - Exonic
1147163408 17:38580419-38580441 GGTCAGGCCCTGGTGAGCTGCGG - Intronic
1148235756 17:45967943-45967965 GGTGAGGTCCCTGGGTGCTGTGG - Intronic
1152048958 17:77958285-77958307 CCTCCGGTCCCTGGGCGCTGTGG - Intergenic
1152721943 17:81927614-81927636 GGTCCGGGCCCGGGGCTCGGAGG + Exonic
1157577260 18:48751665-48751687 GGGCAGGACCCTGGGAGCTGGGG + Intronic
1160302703 18:77700190-77700212 GGTCCAGCGCAGGGGAGCTGTGG + Intergenic
1160717185 19:581750-581772 GGTCTAGCCCCGGGCAGCTGCGG + Intronic
1160788315 19:912082-912104 GGCGCGGCCCCGGGGAGGTGGGG + Intronic
1160788387 19:912230-912252 GGCGCGGCCCCGGGGAGGTGGGG + Intronic
1161939734 19:7395013-7395035 GGGGCGCTCCCGGGGACCTGGGG - Intronic
1162827534 19:13262903-13262925 GGTAGGGTCCCATGGAGCTGTGG - Intronic
1162967898 19:14164589-14164611 GGTCCGGGCCAGGGGAGGTGGGG - Intronic
1163103353 19:15110088-15110110 TGTACGGTCTCGGGGGGCTGCGG + Exonic
1163648192 19:18502133-18502155 GCTCCTGCCCCGTGGAGCTGTGG - Intronic
1163829535 19:19541120-19541142 GGTCCCTGCTCGGGGAGCTGTGG + Exonic
1167015521 19:46838596-46838618 GGCCCGGACCCTGGAAGCTGGGG + Intronic
929857542 2:45650029-45650051 GCTCCGCTGCCGGGGAGCTGGGG - Intergenic
930825508 2:55693283-55693305 GGCCCGGACCCTGGAAGCTGGGG - Intronic
931614719 2:64144291-64144313 GGTGCGCTCCCGGAGGGCTGGGG + Exonic
932314811 2:70772905-70772927 GGTCCAGACCTGGAGAGCTGTGG + Intergenic
932478306 2:72022931-72022953 GGTCCAGTCCTTGGGAGATGCGG + Intergenic
934979441 2:98827834-98827856 GGTCCTGTCTCTGGAAGCTGAGG + Intronic
947152829 2:227132131-227132153 GGTCAGGGCACAGGGAGCTGTGG - Intronic
947911581 2:233804176-233804198 GGTCCGGTACCTGGAAGGTGAGG + Exonic
948726693 2:239938583-239938605 GGTCTGCTCCCGGGCAGCTGTGG + Intronic
948909524 2:240996153-240996175 CAGCCGGGCCCGGGGAGCTGGGG - Intergenic
949018700 2:241728336-241728358 GGTCTGGGGCCGGGCAGCTGTGG - Exonic
1169065583 20:2692849-2692871 GGCCAGGCCCCGGGGAGCGGCGG + Intergenic
1171010885 20:21508895-21508917 GGTGCGCTCCCAGGGCGCTGGGG + Intergenic
1172061526 20:32190158-32190180 GGCCCGGGCCCGAGAAGCTGGGG - Intergenic
1172221175 20:33276107-33276129 GGGCAGGTCCCTGGGAGATGGGG - Intronic
1172296026 20:33811699-33811721 AGTCCGGGCCCGGGGAGCCTGGG - Intronic
1175190885 20:57211490-57211512 GGTCCTGACCCAGGAAGCTGTGG + Intronic
1176098139 20:63353506-63353528 GCTGCGGTCCTGGGGGGCTGTGG + Intronic
1176131650 20:63498974-63498996 GGGCCGGTCCTGGGGGGCAGAGG - Intronic
1176302976 21:5107502-5107524 GGGCTGGACCCGGGGAGCAGTGG - Intergenic
1178948392 21:36966679-36966701 GGGCCGGGCCTGGGGCGCTGGGG - Intronic
1179854049 21:44154422-44154444 GGGCTGGACCCGGGGAGCAGTGG + Intergenic
1180784050 22:18537094-18537116 GCCCCGGCCCCAGGGAGCTGGGG - Intergenic
1180842756 22:18966936-18966958 GTCCCGGTGCCAGGGAGCTGGGG - Intergenic
1180967510 22:19798278-19798300 GTTCTGGTCCCTGAGAGCTGGGG - Intronic
1181240951 22:21476446-21476468 GCCCCGGCCCCAGGGAGCTGGGG - Intergenic
1181361098 22:22336742-22336764 GGGCCTGTCCGGGGGGGCTGGGG + Intergenic
1183207350 22:36428605-36428627 GTTCTGGTCCCTGGAAGCTGTGG - Intergenic
1183614479 22:38935177-38935199 GGCACGGTGCCCGGGAGCTGGGG - Intergenic
1184738990 22:46416306-46416328 GGGCAGGTGCCGGGGCGCTGGGG - Intronic
1184807322 22:46803458-46803480 GGCCCGGCCCCCAGGAGCTGAGG + Intronic
1184856452 22:47149123-47149145 GGTCCAGTCCCCTGGGGCTGGGG + Intronic
1184867602 22:47210119-47210141 GGTCCTGTCCAGGGGAGAAGAGG - Intergenic
1185065409 22:48629443-48629465 GGTTGGGGCCCAGGGAGCTGTGG - Intronic
1185271934 22:49933852-49933874 GGGCAGGTCCTGGGGAGCCGGGG + Intergenic
950704754 3:14772905-14772927 GGCCCCGGCCCGGGGTGCTGGGG + Exonic
957083625 3:75659084-75659106 GGTCCTCTCCCTGGGAGGTGGGG - Intergenic
960256037 3:115512590-115512612 GGCTCGGTCCAGAGGAGCTGCGG - Intergenic
961467040 3:127088418-127088440 CGTCCAGTCCCTGGGATCTGGGG + Intergenic
964757374 3:160100767-160100789 GGTCCGGGCCAGGCGAGCGGAGG - Intergenic
965307350 3:167083038-167083060 GGTCCGGTGCCTGGGAGCACCGG - Intergenic
972671404 4:41216287-41216309 GGCCGGGTTCCGGGGATCTGAGG - Intronic
982212067 4:153045823-153045845 GGTCCAGCCCAGGGGAGGTGTGG - Intergenic
984443098 4:179798020-179798042 GGTCCGTTGCTGGGCAGCTGTGG + Intergenic
984928526 4:184826575-184826597 GCGCCGGTGCAGGGGAGCTGAGG + Exonic
993426455 5:87770890-87770912 GGTGGGGAGCCGGGGAGCTGGGG - Intergenic
1001170762 5:169416976-169416998 GGCCGGGCCCTGGGGAGCTGTGG + Intergenic
1001571606 5:172733844-172733866 GGTGTGGACTCGGGGAGCTGGGG - Intergenic
1001961760 5:175883905-175883927 GGTCAGGTTCAGGGGGGCTGAGG - Exonic
1006342591 6:33454698-33454720 GGTCTGCTCCCGGGAAGCCGCGG - Exonic
1013369800 6:109458845-109458867 GGTCCTGGGCCGGGAAGCTGTGG + Intergenic
1017125590 6:151061234-151061256 GGTCAAGTCCAGGGGAGCTCAGG + Intronic
1017929379 6:158939063-158939085 GGTTGGGTTCCCGGGAGCTGAGG - Intergenic
1018794051 6:167172198-167172220 GGACCCGTGCCCGGGAGCTGGGG + Exonic
1019133571 6:169894583-169894605 CGGCCTGTCCCCGGGAGCTGGGG - Intergenic
1019486923 7:1293639-1293661 GGCCCGGACCCTGGGGGCTGCGG + Intergenic
1020004618 7:4775751-4775773 GGCCAGGTACGGGGGAGCTGCGG + Exonic
1022843754 7:34190056-34190078 TGTCCGGTCTCAGGGGGCTGTGG + Intergenic
1023338757 7:39197134-39197156 CGTCCTGTCCTGGGGAGGTGAGG - Intronic
1027159150 7:75789781-75789803 GCTCCAGTCCCTGGGATCTGCGG + Exonic
1029185814 7:98737523-98737545 GGTCTGGTGCCGGGGAGGGGAGG + Intergenic
1030033551 7:105389179-105389201 GGTCCGGTGCCCGGGAGAGGCGG - Intronic
1032532724 7:132635612-132635634 GAGCCCGTCCTGGGGAGCTGAGG - Intronic
1034433179 7:151050983-151051005 GGGCAGGGCCCAGGGAGCTGAGG + Intronic
1034493934 7:151409371-151409393 GGTCTGGGGCCGGTGAGCTGCGG + Intronic
1034911805 7:155003359-155003381 GAGCCGGTCCCGGGGAGGAGGGG + Intergenic
1036910526 8:12754550-12754572 TGTCGGGTCTCGGGGTGCTGGGG - Intronic
1037914038 8:22761207-22761229 GGGCCTGCCCCGGGGAACTGTGG + Intronic
1038424231 8:27454164-27454186 AGTCCGGTCCAGGTTAGCTGTGG - Exonic
1039979157 8:42391953-42391975 GCTCCAGTCCCGGAGAGCGGTGG + Intronic
1041271942 8:56117706-56117728 GGTGCGCGCCCCGGGAGCTGGGG - Intergenic
1044242268 8:89902002-89902024 GGGCGGGTCCCGGGCACCTGTGG + Intronic
1045459361 8:102412608-102412630 GGTCCGGACTAGGGGAGGTGAGG + Exonic
1046547436 8:115669117-115669139 GGGCCGGTCCCGGCGGGCGGCGG - Intronic
1047951562 8:129939701-129939723 GGTCCGGAGCGGGGGAGCGGCGG + Exonic
1049553880 8:143272830-143272852 GGGCAGTTCCCAGGGAGCTGGGG + Intronic
1052995517 9:34549893-34549915 GGTCTGGTCCCTGTGAGGTGTGG - Intergenic
1056710637 9:88990132-88990154 GCTCTGGCCCCCGGGAGCTGGGG - Intergenic
1058866599 9:109167017-109167039 GGTGCGGGCCCGGGGGGCCGGGG - Exonic
1060481227 9:124017840-124017862 GGCCCGGGCCCGAGGGGCTGCGG - Intronic
1060520380 9:124290809-124290831 GGCCAGGTCACGGGGAGCTTTGG - Intronic
1061015930 9:127980792-127980814 GGGCCGGCCCCGGGCAGCGGAGG + Intergenic
1061365984 9:130172626-130172648 GGTCCGGCCCGGGGGGGCGGGGG + Exonic
1061575441 9:131503205-131503227 GGTTCGGGCCCGGGCAGATGCGG + Intronic
1061808483 9:133149222-133149244 GGCCCGAGCCCGGGGAGCCGGGG - Intronic
1062217870 9:135398972-135398994 GTCCTGGGCCCGGGGAGCTGTGG + Intergenic
1062289294 9:135787365-135787387 GGCCCGGTGCTGGGGAGCTGGGG - Intronic
1062325423 9:136010394-136010416 GGGCCGGACCTGGGGAGCGGGGG - Exonic
1185479722 X:437445-437467 TGGCGGGCCCCGGGGAGCTGCGG - Intergenic
1185641575 X:1591829-1591851 GGGCCGGGCCCGGGGGGCCGGGG + Intronic
1190726264 X:53192767-53192789 GGGCCGGCCCCCAGGAGCTGAGG + Exonic
1195138151 X:101931690-101931712 GTTCCCGTCCCGGGGTGCGGGGG - Intronic
1197981080 X:132218181-132218203 CGTCCAGTCTCGGGGAACTGGGG - Intronic