ID: 923369347

View in Genome Browser
Species Human (GRCh38)
Location 1:233295299-233295321
Sequence GTGGGGAGGGTCCGGTCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 195}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923369347_923369366 24 Left 923369347 1:233295299-233295321 CCCCGGGACCGGACCCTCCCCAC 0: 1
1: 0
2: 1
3: 11
4: 195
Right 923369366 1:233295346-233295368 GCAGCAGGAGGAACAGCCACAGG 0: 1
1: 1
2: 3
3: 69
4: 595
923369347_923369355 -8 Left 923369347 1:233295299-233295321 CCCCGGGACCGGACCCTCCCCAC 0: 1
1: 0
2: 1
3: 11
4: 195
Right 923369355 1:233295314-233295336 CTCCCCACTCACCAGGTGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 294
923369347_923369354 -9 Left 923369347 1:233295299-233295321 CCCCGGGACCGGACCCTCCCCAC 0: 1
1: 0
2: 1
3: 11
4: 195
Right 923369354 1:233295313-233295335 CCTCCCCACTCACCAGGTGCAGG 0: 1
1: 1
2: 3
3: 28
4: 347
923369347_923369361 -1 Left 923369347 1:233295299-233295321 CCCCGGGACCGGACCCTCCCCAC 0: 1
1: 0
2: 1
3: 11
4: 195
Right 923369361 1:233295321-233295343 CTCACCAGGTGCAGGGCCAGGGG 0: 1
1: 0
2: 2
3: 28
4: 359
923369347_923369364 12 Left 923369347 1:233295299-233295321 CCCCGGGACCGGACCCTCCCCAC 0: 1
1: 0
2: 1
3: 11
4: 195
Right 923369364 1:233295334-233295356 GGGCCAGGGGCAGCAGCAGGAGG 0: 1
1: 2
2: 15
3: 187
4: 1256
923369347_923369363 9 Left 923369347 1:233295299-233295321 CCCCGGGACCGGACCCTCCCCAC 0: 1
1: 0
2: 1
3: 11
4: 195
Right 923369363 1:233295331-233295353 GCAGGGCCAGGGGCAGCAGCAGG 0: 1
1: 7
2: 41
3: 340
4: 1631
923369347_923369360 -2 Left 923369347 1:233295299-233295321 CCCCGGGACCGGACCCTCCCCAC 0: 1
1: 0
2: 1
3: 11
4: 195
Right 923369360 1:233295320-233295342 ACTCACCAGGTGCAGGGCCAGGG 0: 1
1: 0
2: 3
3: 33
4: 278
923369347_923369367 30 Left 923369347 1:233295299-233295321 CCCCGGGACCGGACCCTCCCCAC 0: 1
1: 0
2: 1
3: 11
4: 195
Right 923369367 1:233295352-233295374 GGAGGAACAGCCACAGGTAGAGG 0: 1
1: 0
2: 5
3: 48
4: 301
923369347_923369359 -3 Left 923369347 1:233295299-233295321 CCCCGGGACCGGACCCTCCCCAC 0: 1
1: 0
2: 1
3: 11
4: 195
Right 923369359 1:233295319-233295341 CACTCACCAGGTGCAGGGCCAGG 0: 1
1: 1
2: 1
3: 46
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923369347 Original CRISPR GTGGGGAGGGTCCGGTCCCG GGG (reversed) Intronic
900131485 1:1089144-1089166 GTGGGGAGGGGCCGGGCCTGCGG - Intronic
900137047 1:1122118-1122140 GGGCGGAGGGTGGGGTCCCGGGG - Intergenic
900176673 1:1294228-1294250 GCGGAGAGGGGCCGGTGCCGTGG - Intronic
900661053 1:3783957-3783979 GTGGGGTGGGGCCGGGCCCGGGG - Intronic
900708691 1:4097099-4097121 GTGGGGAGGGGACTGTCCTGTGG - Intergenic
901669847 1:10849804-10849826 GTGGGGAGGGCCCTGTGCCCTGG - Intergenic
902336976 1:15759314-15759336 AAGGGGAGGGACGGGTCCCGGGG + Intronic
904300545 1:29550797-29550819 TGGGGGAGGGGCCGGCCCCGGGG - Intergenic
906112326 1:43332275-43332297 GTGGGGAGGGTCTGTGCCTGGGG + Intergenic
907351790 1:53838104-53838126 GCGGGGGAGGGCCGGTCCCGGGG - Intronic
912442936 1:109712704-109712726 GTGGGCAGGGCCCGGACACGAGG - Intronic
912559420 1:110539280-110539302 GTGGGGTGGGTCAGGGCCCCAGG + Intergenic
915033697 1:152905335-152905357 GTGGGGAAGGTCGGGCACCGTGG + Intergenic
923369347 1:233295299-233295321 GTGGGGAGGGTCCGGTCCCGGGG - Intronic
1062802310 10:389322-389344 GAGGGGAGGGTGCGACCCCGGGG - Intronic
1063418276 10:5890422-5890444 GCGCGGGGGGTCCGGGCCCGGGG + Intronic
1064664477 10:17636884-17636906 GTGGGGAGGGCCGGGTGCGGTGG - Intergenic
1068780315 10:60912744-60912766 TTGTGGAGGGTCCTGTCCCTGGG - Intronic
1072625398 10:97107967-97107989 GGGGTGAGGCTCCGGTCCGGGGG + Intronic
1073290434 10:102410690-102410712 CTGGGGAGGGGGCGGTCCCCAGG + Intronic
1075875408 10:125802203-125802225 GTGTGGAGGGTTCGCTCCAGGGG - Intronic
1076859803 10:133135437-133135459 GTGGGGGGGGTCTGGTCTCTGGG + Intergenic
1076860104 10:133136245-133136267 GTGGGGGGGGTCTGGTCTCTGGG + Intergenic
1076860814 10:133138213-133138235 GTGGGGGGGGTCTGGTCTCTGGG + Intergenic
1076860875 10:133138376-133138398 GTGGGGGGGGTCTGGTCTCTGGG + Intergenic
1076861221 10:133139294-133139316 GTGGGGGGGGTCTGGTCTCTGGG + Intergenic
1076948117 10:133665445-133665467 GTGGGGAGGGGGCGGTCAGGCGG - Intergenic
1076949107 10:133668755-133668777 GTGGGGAGGGGGCGGTCAGGCGG - Intronic
1076950091 10:133672054-133672076 GTGGGGAGGGGGCGGTCAGGCGG - Intergenic
1076951075 10:133675353-133675375 GTGGGGAGGGGGCGGTCAGGCGG - Intergenic
1076952065 10:133678663-133678685 GTGGGGAGGGGGCGGTCAGGCGG - Intergenic
1076953054 10:133681973-133681995 GTGGGGAGGGGGCGGTCAGGCGG - Intergenic
1076954038 10:133685272-133685294 GTGGGGAGGGGGCGGTCAGGCGG - Intergenic
1076955022 10:133741624-133741646 GTGGGGAGGGGGCGGTCAGGCGG - Intergenic
1076956011 10:133744934-133744956 GTGGGGAGGGGGCGGTCAGGCGG - Intergenic
1076957001 10:133748244-133748266 GTGGGGAGGGGGCGGTCAGGCGG - Intergenic
1076957988 10:133751553-133751575 GTGGGGAGGGGGCGGTCAGGCGG - Intergenic
1076958973 10:133754852-133754874 GTGGGGAGGGGGCGGTCAGGCGG - Intergenic
1076959962 10:133758162-133758184 GTGGGGAGGGGGCGGTCAGGCGG - Intergenic
1076960946 10:133761461-133761483 GTGGGGAGGGGGCGGTCAGGCGG - Intergenic
1077039835 11:515151-515173 GTGGGGAGGGTCAGGTCTGTCGG + Intergenic
1077630666 11:3808916-3808938 GTGGGGAGGATGGGGCCCCGGGG + Intronic
1078315465 11:10289876-10289898 CTGGGGAGGCTCCGGGCCTGAGG + Intronic
1079242118 11:18728680-18728702 GTGGTGTGGGTCAGGCCCCGGGG + Exonic
1081570862 11:44289972-44289994 GAAGGGAGGGTCTGGTCCAGTGG - Intronic
1083419668 11:62545890-62545912 GAGGGGAAGGGGCGGTCCCGAGG + Intronic
1083642313 11:64152243-64152265 GTGGGCAGGCTCCAGACCCGTGG - Intronic
1083674422 11:64317468-64317490 GTGCGGGGGGTGGGGTCCCGTGG - Exonic
1083812091 11:65111904-65111926 GCGCGGAGGATCCGGCCCCGCGG - Exonic
1084178545 11:67435556-67435578 GTTGGGGGGGGCCGTTCCCGTGG + Exonic
1087175139 11:95089554-95089576 GTGGGGCGGGCCTAGTCCCGGGG - Intergenic
1089183485 11:116598841-116598863 CTGGGGAGGGTCCCGACCCCAGG - Intergenic
1089686031 11:120147344-120147366 GAGGGGAGGGTCCAGTCAAGAGG - Intronic
1091356943 11:134944457-134944479 TGGGGCAGGGGCCGGTCCCGAGG + Intergenic
1097688389 12:62712097-62712119 ATGGGGAGGGGCCTCTCCCGGGG - Intronic
1103507905 12:121453915-121453937 GTGGGCAGGGTCCGAGCCTGTGG - Intronic
1103636726 12:122313257-122313279 GTGGGGAGGGACCGGATCCCAGG - Intronic
1103855954 12:123972110-123972132 GGGAGGAGAGGCCGGTCCCGGGG - Intronic
1104647720 12:130509042-130509064 GTGGGGAGGGCCGGGGGCCGGGG - Intronic
1104767588 12:131340458-131340480 GAGGGGTGGGGCCGGTCCTGCGG + Intergenic
1104944115 12:132408076-132408098 GTGGGGAGGGGCCGGGGCCGGGG - Intergenic
1107770726 13:43786235-43786257 GTGGGCAGGAACGGGTCCCGGGG + Intronic
1113801355 13:113088090-113088112 GTGGGGAGGGTGCCGTGCCCTGG + Intronic
1113853818 13:113433188-113433210 GTGGGGTGGAGCCGCTCCCGTGG + Intronic
1113956043 13:114100271-114100293 GTGGGGAGGGTCGGGGCCGAGGG - Intronic
1114538704 14:23439031-23439053 GTGGGGAGTGACCGGTCTGGAGG + Intergenic
1117141021 14:52791405-52791427 GTGAGGAGGGACCGGGGCCGGGG - Intronic
1121220017 14:92278051-92278073 GTGGGGAGGGGCAGGGCCAGGGG + Intergenic
1121528949 14:94639209-94639231 TTGGGGAGGCTCGGGTCCTGTGG - Intergenic
1122444705 14:101760797-101760819 GAGGGGAGGGGCCGGTCGAGGGG + Intergenic
1122444713 14:101760814-101760836 GAGGGGAGGGGCCGGTCAAGGGG + Intergenic
1122480595 14:102044734-102044756 GTGGCGAGGGTCCCCTCACGCGG + Intronic
1202857023 14_GL000225v1_random:58112-58134 GCGGGGAGGGTCCCGTCCGAAGG - Intergenic
1123439880 15:20282513-20282535 GTGGGGAGGGGGCGCTCCCAAGG + Intergenic
1123935989 15:25194333-25194355 GCGGGAAGGGTCACGTCCCGAGG + Intergenic
1124146950 15:27136817-27136839 GTGGGGAGGGTGGGCTCCCTGGG - Intronic
1132105412 15:99059342-99059364 GTGGGCACGGGCCGGGCCCGCGG - Intergenic
1132531300 16:451340-451362 GTGGGGAGGGTGAGGTGCAGGGG - Intronic
1132576259 16:665806-665828 GTGGGGAGTGCCCGGGCCGGGGG + Intronic
1132683826 16:1154076-1154098 GTGGGGAGGGTGGGGGCCCGGGG + Intronic
1134134200 16:11668696-11668718 CGGGGGAGGGTCCGTTCCAGGGG + Intronic
1136884278 16:33922011-33922033 GTGGGGAGGGTGAGGCCCCAGGG - Intergenic
1138386403 16:56638450-56638472 GCGGGGAGGGGGTGGTCCCGTGG + Intergenic
1138558192 16:57785178-57785200 GTGGGGAAGGTCCTGGCCCCTGG + Intronic
1139544783 16:67645077-67645099 GCGGGGAGGGGCCGGGCCGGGGG + Exonic
1140091934 16:71846010-71846032 GTGGGGCGGCTCCGGGGCCGGGG + Exonic
1142265908 16:89063885-89063907 GTGAGGAGGGCCCGGCCCCTGGG + Intergenic
1142631618 17:1229559-1229581 GGGCGGAGGCGCCGGTCCCGAGG - Intergenic
1143481366 17:7229329-7229351 GTGGGGAGGGCCTGGTCTCTAGG - Intronic
1147145824 17:38483939-38483961 GTGGGGAGGGTGAGGCCCCAGGG + Intronic
1151167799 17:72219883-72219905 GAGGGGAGGGTCCGGGCTGGTGG - Intergenic
1152183528 17:78840328-78840350 GCGGGGCGGGTGCGGCCCCGGGG - Intronic
1152287508 17:79421505-79421527 GTGGGGAGGGACAGGGCCCAGGG + Intronic
1152544042 17:80991979-80992001 CTGGTGAGGGCCCGGGCCCGGGG + Exonic
1152583818 17:81180401-81180423 GTGGGGCGGGGCCTGTCCTGAGG + Intergenic
1152861186 17:82697910-82697932 GAGACCAGGGTCCGGTCCCGAGG - Intronic
1152880019 17:82809210-82809232 GTGGGGAAGGTCCTGGCCAGGGG - Intronic
1152965726 18:112074-112096 GTGGGGAGGGGGCGGTCAGGCGG + Intergenic
1160412971 18:78687600-78687622 GTGGGGAGGGACAGGTGGCGGGG - Intergenic
1160528238 18:79549457-79549479 GTGTGAAGGGTCCAGTCCTGGGG - Intergenic
1160688394 19:448261-448283 GTGGAGAGGATCCGCTCCCGTGG - Intronic
1160723679 19:608375-608397 GAGGGGCGGGCCCGGCCCCGGGG + Intronic
1160911964 19:1478751-1478773 GTAGGGGGAGCCCGGTCCCGGGG - Intronic
1160923918 19:1533925-1533947 GTGGGGAGGGTCCCCTCCTGTGG - Exonic
1161588485 19:5118133-5118155 GTGGGGTGGGCCCGCTGCCGGGG - Intronic
1161791333 19:6361948-6361970 CTGGGGAGGGTCCCGGCGCGGGG - Intronic
1162372726 19:10288972-10288994 GTGGGGAGGGGAGGGTCCCACGG + Intergenic
1162792641 19:13070995-13071017 GTGGGTAGGGGCCGCTCCCATGG + Intronic
1163427214 19:17246099-17246121 CGGGGGAGGGTCAGGCCCCGCGG - Intronic
1163826278 19:19526575-19526597 GTGAGGAGGGTTGGGACCCGTGG + Intronic
1163934253 19:20427428-20427450 GTGGGGGCTGTCCAGTCCCGTGG + Intergenic
1167071026 19:47221974-47221996 GTGGGGATGGTCAGCTCCAGGGG + Intronic
1167574961 19:50313590-50313612 TTGGGGAGGGTCTGGTTCCCTGG + Intronic
1167792099 19:51689287-51689309 GTGGGGAGGGGCCGGGGCGGGGG + Intergenic
1168255116 19:55160892-55160914 GTGGGGCGGGACCTATCCCGCGG + Intronic
925715546 2:6781498-6781520 GTGGGGAGAGCCCGGCCCTGTGG + Intergenic
925984740 2:9206750-9206772 GAGGGGCGGGTCCGGGCCGGGGG - Exonic
925994609 2:9281906-9281928 GTGGGGAGGGTCGGGACAGGTGG - Intronic
932496682 2:72149026-72149048 GTGGTGAGAGGCCGGGCCCGCGG + Intergenic
943945715 2:194060582-194060604 GTGGTGAGGGTGCTGTCCTGTGG + Intergenic
944206586 2:197164153-197164175 GTGGGGAAGTTCCATTCCCGGGG + Intronic
948047024 2:234952408-234952430 GTGGGCAGGGACCCGGCCCGGGG + Intronic
948870788 2:240796893-240796915 GTGGGGAGGGGGGCGTCCCGAGG - Intronic
949024937 2:241763037-241763059 GTGGGGAGGGTGAGGGCCTGGGG + Intronic
949027537 2:241773600-241773622 GCGAGGAGGGGCCCGTCCCGGGG - Intergenic
1172486017 20:35298241-35298263 GCGGGGAGGGTCGGGGCCAGGGG + Intergenic
1172525318 20:35597480-35597502 GTGGGGAGGGACAGATCCTGTGG - Intergenic
1173793045 20:45840578-45840600 ATGGGGAGGGAACGGGCCCGTGG + Intronic
1175888938 20:62307555-62307577 GTGGGGCGTGTCCGCTCCAGCGG + Intronic
1176034104 20:63028074-63028096 GTGGGGAGGGGCCGGTGGAGAGG + Intergenic
1178840576 21:36135023-36135045 GAGGGGAGGGACCGGAGCCGGGG + Exonic
1180021341 21:45129659-45129681 GTGGGGAGGGAGCGGTCACCAGG + Intronic
1180093105 21:45542590-45542612 GTGGGGAGAGGCCGGCGCCGGGG - Intronic
1182128865 22:27836150-27836172 CTAGTGAGGGTCCTGTCCCGGGG - Intergenic
1182712600 22:32332071-32332093 GTGGGGAGGGGCCGGCACCAGGG - Intergenic
1183437588 22:37804654-37804676 GTGTGGAGGGACCGGTGGCGGGG + Intergenic
1184399842 22:44267453-44267475 GTGGGGAGGGGCCGGCACCAGGG - Intronic
1184938105 22:47739845-47739867 GTGTGGAGGGGCAGGTCCGGGGG + Intergenic
1185097840 22:48821419-48821441 GTGGGAGGAGTCCAGTCCCGGGG + Intronic
950711209 3:14814102-14814124 GTGAGGAGGGTCCGACCCCCAGG + Intergenic
955199698 3:56839849-56839871 GAAGGGAGGGTCTGGTCCCTAGG + Intronic
961871375 3:129990856-129990878 GTGGGGAGGGTCAGATACTGGGG + Intergenic
964384394 3:156131790-156131812 GTGGGAAGGGTCCAGTCAGGTGG + Intronic
966646146 3:182248085-182248107 GTGGGGAGGGTGCAGGCCAGCGG - Intergenic
966886677 3:184380832-184380854 GTGGGGAGCGCCGGGTCGCGCGG + Intronic
968913771 4:3488303-3488325 GTGGGGAGGGCCCTGTTCTGAGG + Intronic
968936421 4:3612702-3612724 CTGGGGAGGGGCTGGTCCAGTGG + Intergenic
968985126 4:3870812-3870834 GTGGGGAGGGACAGGTGCTGTGG + Intergenic
969652673 4:8477288-8477310 GAGGGCAGGGTCTGGGCCCGTGG - Intronic
976729097 4:88244525-88244547 GTGGGAAGGGGCGGGTCCCCTGG + Intergenic
983211881 4:164966809-164966831 GTGGAGAGGGTGCGGTGCTGAGG + Intronic
985453549 4:190072842-190072864 GTGGGGAGGGGGCGGTCAGGCGG - Intergenic
985454539 4:190076135-190076157 GTGGGGAGGGGGCGGTCAGGCGG - Intergenic
985455527 4:190079428-190079450 GTGGGGAGGGGGCGGTCAGGCGG - Intergenic
985456511 4:190082722-190082744 GTGGGGAGGGGGCGGTCAGGCGG - Intergenic
985457499 4:190086022-190086044 GTGGGGAGGGGGCGGTCAGGCGG - Intergenic
985458486 4:190089315-190089337 GTGGGGAGGGGGCGGTCAGGCGG - Intergenic
985459475 4:190092615-190092637 GTGGGGAGGGGGCGGTCAGGCGG - Intergenic
985463726 4:190175384-190175406 GTGGGGAGGGGGCGGTCAGGCGG - Intronic
985616714 5:927160-927182 GTGGGGTGGGGCCAGTTCCGTGG - Intergenic
985899874 5:2780120-2780142 GTGGGCAGGGTCGGTTCCCTGGG + Intergenic
991690203 5:69218052-69218074 GTGAGGTGGGTCCGGCGCCGAGG + Intronic
992690442 5:79236288-79236310 GTGGTGAGGCGCGGGTCCCGCGG - Exonic
996738629 5:126778594-126778616 GCGGGGATGGTGCGGTCCCTCGG + Intronic
998506283 5:142675053-142675075 GTGGGGAGGGTCAGGTCAATGGG + Intronic
999257303 5:150216741-150216763 GTGGGGCAGGTCCAGTCCCGTGG - Intronic
1001296868 5:170504521-170504543 TAGGGGAGGGGCCGGGCCCGGGG + Intronic
1001577092 5:172771452-172771474 GCGGCGCGGGTCCGGTCCCTGGG - Intergenic
1003097365 6:3153318-3153340 GTAGGGAGAGTCCGTGCCCGAGG + Exonic
1004276649 6:14242421-14242443 GAGGGGAGGGTGTGGTCACGTGG + Intergenic
1006163962 6:32053726-32053748 GTGGGGAGAGTGAGGTCCCTGGG + Intronic
1006844439 6:37052434-37052456 GTGGGGAGAGACAGGTCCAGAGG - Intergenic
1007369539 6:41417294-41417316 GAGGGGAGGGTGTGGTCCCAGGG + Intergenic
1012052616 6:94362566-94362588 GTGGGGAGGGGTGGGTCCCCTGG + Intergenic
1013048505 6:106510588-106510610 GTGGCGAGGAACGGGTCCCGGGG + Intergenic
1015227981 6:130880372-130880394 GTGGGGAGGGTCCACTCTCAGGG - Intronic
1017021583 6:150143743-150143765 GTGGGGAGGGTTGGGTCCCGCGG + Intronic
1017565687 6:155683302-155683324 GTGGGGAGCCTCAGGTCCCTGGG - Intergenic
1017793784 6:157823521-157823543 GCGGGGAGGGTCGGGGCCAGGGG + Intronic
1018707102 6:166471024-166471046 CTGGGGAGGGTCTGATCCCTGGG + Intronic
1018923627 6:168192339-168192361 GTGGGGAGGGCGGGGTCCCAGGG - Intergenic
1019163195 6:170082484-170082506 GTGGGGAGGGCCAGGTCTCAGGG + Intergenic
1019411717 7:909508-909530 GTGGGGCGCGTCCGGGACCGTGG - Intronic
1019626405 7:2018081-2018103 GTGGGCAGAGACCGGCCCCGTGG + Intronic
1019711153 7:2518902-2518924 GAGGGGCGGGCCCGGGCCCGTGG + Intronic
1022466654 7:30656665-30656687 GTGGGGAGGCTCTGGTGCTGAGG - Intronic
1025026079 7:55517443-55517465 GTGTGCAGGGTGCTGTCCCGGGG - Intronic
1029461064 7:100694117-100694139 GGCGCGAGGGTCCGGTCCCGGGG + Intergenic
1032383959 7:131508715-131508737 GAGGGGGGGGTCCAGTCCTGTGG + Intronic
1049003865 8:139842667-139842689 GTGGGGAGGGGGCGGGCCTGTGG + Intronic
1049194686 8:141308617-141308639 GTGCGGAGGGGCCGGGGCCGGGG - Intergenic
1049641272 8:143717075-143717097 GTGGTGAGGGTCCGATCGTGTGG + Intronic
1049692714 8:143969669-143969691 GTGGGCAGGGGCCTGTCCTGGGG + Intronic
1049777726 8:144414173-144414195 GTGGGGTGGGTAAGGTCCCTGGG + Intronic
1051038264 9:12775801-12775823 GTGGGGAGGAGCCGGTTCCCAGG + Exonic
1052849586 9:33368873-33368895 GTGGAGAGGGGCTGGTCCTGGGG - Intronic
1055645343 9:78357333-78357355 GTGGGGAGGGGCCAGGCACGGGG - Intergenic
1056953589 9:91065339-91065361 GTGGGAAGGGTCAGGCCCAGAGG - Intergenic
1057799339 9:98180685-98180707 GTGGGGAGGGTGCGGTCAGGAGG - Intronic
1062185578 9:135216463-135216485 GTGTGCAGAGTGCGGTCCCGGGG - Intergenic
1062489843 9:136799809-136799831 GTGGGGAGGGTTGGGTCTCGAGG - Intronic
1186772424 X:12831023-12831045 CTGGGGAGTGTCTGGCCCCGGGG - Intergenic
1189322380 X:40094774-40094796 GTGGGGAGGGGCCGGTAGCGAGG - Intronic
1192126348 X:68504004-68504026 GAGGGGAGGGCCAGGTGCCGTGG - Intronic
1192360204 X:70434453-70434475 GGGGGGCGGGTCTTGTCCCGAGG - Intergenic
1197754502 X:129984309-129984331 GTGGGGAGGGGGCCGTCCTGGGG + Intronic
1200161961 X:154014122-154014144 GTGGGCAGGGCCCGGGCCTGGGG + Exonic
1201177266 Y:11316518-11316540 GTGGGGTGGGTCTGGTCAGGCGG - Intergenic