ID: 923369348

View in Genome Browser
Species Human (GRCh38)
Location 1:233295300-233295322
Sequence AGTGGGGAGGGTCCGGTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 201}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923369348_923369359 -4 Left 923369348 1:233295300-233295322 CCCGGGACCGGACCCTCCCCACT 0: 1
1: 0
2: 0
3: 8
4: 201
Right 923369359 1:233295319-233295341 CACTCACCAGGTGCAGGGCCAGG 0: 1
1: 1
2: 1
3: 46
4: 369
923369348_923369361 -2 Left 923369348 1:233295300-233295322 CCCGGGACCGGACCCTCCCCACT 0: 1
1: 0
2: 0
3: 8
4: 201
Right 923369361 1:233295321-233295343 CTCACCAGGTGCAGGGCCAGGGG 0: 1
1: 0
2: 2
3: 28
4: 359
923369348_923369366 23 Left 923369348 1:233295300-233295322 CCCGGGACCGGACCCTCCCCACT 0: 1
1: 0
2: 0
3: 8
4: 201
Right 923369366 1:233295346-233295368 GCAGCAGGAGGAACAGCCACAGG 0: 1
1: 1
2: 3
3: 69
4: 595
923369348_923369363 8 Left 923369348 1:233295300-233295322 CCCGGGACCGGACCCTCCCCACT 0: 1
1: 0
2: 0
3: 8
4: 201
Right 923369363 1:233295331-233295353 GCAGGGCCAGGGGCAGCAGCAGG 0: 1
1: 7
2: 41
3: 340
4: 1631
923369348_923369355 -9 Left 923369348 1:233295300-233295322 CCCGGGACCGGACCCTCCCCACT 0: 1
1: 0
2: 0
3: 8
4: 201
Right 923369355 1:233295314-233295336 CTCCCCACTCACCAGGTGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 294
923369348_923369364 11 Left 923369348 1:233295300-233295322 CCCGGGACCGGACCCTCCCCACT 0: 1
1: 0
2: 0
3: 8
4: 201
Right 923369364 1:233295334-233295356 GGGCCAGGGGCAGCAGCAGGAGG 0: 1
1: 2
2: 15
3: 187
4: 1256
923369348_923369367 29 Left 923369348 1:233295300-233295322 CCCGGGACCGGACCCTCCCCACT 0: 1
1: 0
2: 0
3: 8
4: 201
Right 923369367 1:233295352-233295374 GGAGGAACAGCCACAGGTAGAGG 0: 1
1: 0
2: 5
3: 48
4: 301
923369348_923369360 -3 Left 923369348 1:233295300-233295322 CCCGGGACCGGACCCTCCCCACT 0: 1
1: 0
2: 0
3: 8
4: 201
Right 923369360 1:233295320-233295342 ACTCACCAGGTGCAGGGCCAGGG 0: 1
1: 0
2: 3
3: 33
4: 278
923369348_923369354 -10 Left 923369348 1:233295300-233295322 CCCGGGACCGGACCCTCCCCACT 0: 1
1: 0
2: 0
3: 8
4: 201
Right 923369354 1:233295313-233295335 CCTCCCCACTCACCAGGTGCAGG 0: 1
1: 1
2: 3
3: 28
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923369348 Original CRISPR AGTGGGGAGGGTCCGGTCCC GGG (reversed) Intronic
900119031 1:1040884-1040906 AGCGGGGCGGGGCCGGTGCCTGG + Intronic
900122421 1:1054488-1054510 AGCGGGGAGGAGCCGGTCACAGG - Exonic
900137048 1:1122119-1122141 AGGGCGGAGGGTGGGGTCCCGGG - Intergenic
900661054 1:3783958-3783980 GGTGGGGTGGGGCCGGGCCCGGG - Intronic
902541750 1:17160538-17160560 AGTGGGGAGGGAGTGGTTCCAGG + Intergenic
902892243 1:19452729-19452751 AGTGGTGAGGGTCCAGTGGCAGG - Intronic
903296056 1:22343709-22343731 AGGGGGTAAGGTCAGGTCCCAGG + Intergenic
904847565 1:33431257-33431279 AGTGGGGAGGTGCCGGAGCCCGG + Intergenic
904881254 1:33698760-33698782 GGTGGGCAGAGGCCGGTCCCAGG + Exonic
906112325 1:43332274-43332296 AGTGGGGAGGGTCTGTGCCTGGG + Intergenic
906253989 1:44333418-44333440 AGTGGGGAGGGATGGGGCCCAGG - Intronic
910232018 1:84997201-84997223 ACTGGGGAAGCTCCGGTCCCCGG - Intergenic
912429261 1:109620551-109620573 AGGAGGGAGGGGCCTGTCCCGGG - Intronic
913095293 1:115510734-115510756 AGTGGGGAGGGTCCTGTGGGTGG + Intergenic
914245992 1:145886115-145886137 GGTGGGGCGGGTCCGGGTCCGGG - Intergenic
922210086 1:223479720-223479742 AGTGTGGAGGGTTCAGCCCCAGG - Intergenic
923369348 1:233295300-233295322 AGTGGGGAGGGTCCGGTCCCGGG - Intronic
1062802311 10:389323-389345 AGAGGGGAGGGTGCGACCCCGGG - Intronic
1065806096 10:29394852-29394874 AGTGGAAAGGGGCAGGTCCCTGG + Intergenic
1065940790 10:30562465-30562487 AGTTGGGAGGGTGTGGTCCCGGG - Intergenic
1066214585 10:33273927-33273949 AGTGGGGAGGGTGAGGTCTGGGG - Intronic
1067258723 10:44667310-44667332 GGTGGGAAGAGTCAGGTCCCTGG - Intergenic
1067290064 10:44933871-44933893 AGTGGGGCAGGTAAGGTCCCTGG - Intronic
1067829911 10:49605648-49605670 AGTGAGCAAGGTCCTGTCCCTGG + Intergenic
1068780316 10:60912745-60912767 TTTGTGGAGGGTCCTGTCCCTGG - Intronic
1069565426 10:69460523-69460545 GGTGGGAAGGGCCCAGTCCCTGG + Intronic
1069846746 10:71377414-71377436 AGCGGGGGCGGTCCAGTCCCTGG - Intergenic
1070383023 10:75898587-75898609 AGTGGGCAGTGCCCGTTCCCAGG - Intronic
1071018748 10:81028117-81028139 AGTGGGGAGGGTCAGGCTGCTGG - Intergenic
1072625397 10:97107966-97107988 AGGGGTGAGGCTCCGGTCCGGGG + Intronic
1075875409 10:125802204-125802226 AGTGTGGAGGGTTCGCTCCAGGG - Intronic
1076834962 10:133016397-133016419 AGTGGGCAGGGTCCAGGCCAGGG + Intergenic
1076859802 10:133135436-133135458 TGTGGGGGGGGTCTGGTCTCTGG + Intergenic
1076860103 10:133136244-133136266 TGTGGGGGGGGTCTGGTCTCTGG + Intergenic
1076860813 10:133138212-133138234 TGTGGGGGGGGTCTGGTCTCTGG + Intergenic
1076860874 10:133138375-133138397 TGTGGGGGGGGTCTGGTCTCTGG + Intergenic
1076861220 10:133139293-133139315 TGTGGGGGGGGTCTGGTCTCTGG + Intergenic
1076873896 10:133206605-133206627 AGTGGGGTGGGGCCTGGCCCTGG + Intronic
1077176974 11:1195460-1195482 AGTGGGGAGGGGCGGGTGCCGGG + Intronic
1077664416 11:4094910-4094932 AGTGGGAAGGGTTAGGTTCCAGG - Exonic
1081342739 11:41947800-41947822 GGTAGAGAGGGTCTGGTCCCGGG - Intergenic
1081566641 11:44264725-44264747 AGTGCTGAGGGTCAGGCCCCTGG + Exonic
1084506099 11:69569489-69569511 AGAGGGGACGGTCCAGTGCCTGG - Intergenic
1085238080 11:75030643-75030665 AGAGGGGAGGGTCTGGTTCAAGG - Intergenic
1085519525 11:77129961-77129983 AGCGGGGCGGGCCCGGGCCCGGG + Intronic
1086337144 11:85811198-85811220 GGTGCGGTGGGGCCGGTCCCGGG + Intergenic
1087175140 11:95089555-95089577 AGTGGGGCGGGCCTAGTCCCGGG - Intergenic
1088608089 11:111550665-111550687 GGTGGGGAGGGCCAGGTCACTGG - Intronic
1091875492 12:3930216-3930238 AGTGTGGAGGGAAGGGTCCCAGG - Intergenic
1092097426 12:5854277-5854299 GGTGGGAAGGGACTGGTCCCTGG - Intronic
1100264075 12:92959117-92959139 ATGGGGGAGGGTCAGGGCCCAGG + Intergenic
1101899614 12:108781695-108781717 AGTGGGCAGGGCCCAGTCACAGG - Intergenic
1103938390 12:124488793-124488815 AGGGCGGACGGTCCAGTCCCTGG + Intronic
1104873716 12:132018396-132018418 AGCGGGGAGGGTTGGCTCCCAGG + Intronic
1104944116 12:132408077-132408099 GGTGGGGAGGGGCCGGGGCCGGG - Intergenic
1107658556 13:42616075-42616097 AGTGAGGAGTGTCTGGTCCATGG + Intergenic
1110706485 13:78605570-78605592 AGAGGGGAGGGGCAGGTTCCAGG - Intergenic
1113803199 13:113096907-113096929 CGTGGGGAGGGCGCGGCCCCCGG + Exonic
1113956044 13:114100272-114100294 AGTGGGGAGGGTCGGGGCCGAGG - Intronic
1118310096 14:64685754-64685776 AGTGGGGAGGGCCCAGGCCTAGG - Intergenic
1121304402 14:92897044-92897066 TGTGGTGAGGGTCAGGGCCCGGG - Intergenic
1121845584 14:97169500-97169522 ACTGGGGAGGGTCAGTACCCTGG - Intergenic
1124146951 15:27136818-27136840 GGTGGGGAGGGTGGGCTCCCTGG - Intronic
1124628957 15:31326554-31326576 AGAGGGGCGTGCCCGGTCCCGGG - Intergenic
1125481392 15:40083474-40083496 AGTGGAGAGGGTTTGGTGCCTGG - Intergenic
1129519400 15:76176448-76176470 GCAGGGAAGGGTCCGGTCCCAGG + Intronic
1129985822 15:79919246-79919268 AGAGGGCAGGGACCGGTGCCGGG - Intronic
1130120382 15:81042503-81042525 CCTGGGGTGGGGCCGGTCCCAGG + Intronic
1132224816 15:100132162-100132184 AGCGGGGAGGGTCGGGGCCCAGG + Intronic
1132404357 15:101533378-101533400 GTTGGTGAGGGTCCAGTCCCAGG - Intergenic
1132669926 16:1098342-1098364 AGTGGGGAGGGCTCCATCCCTGG + Intergenic
1132683825 16:1154075-1154097 CGTGGGGAGGGTGGGGGCCCGGG + Intronic
1132692297 16:1187070-1187092 AGTGCGGAGGGGACGGTCGCGGG - Intronic
1133197381 16:4180718-4180740 AGTGGGTTGGGTCCGGACACAGG + Intergenic
1133908075 16:10039631-10039653 CGCGGGGAGGGTCCGCACCCGGG + Intronic
1136246943 16:28981677-28981699 AGTGGGGATGTTCCTGTTCCTGG + Intronic
1136654859 16:31703623-31703645 GGTGGGTAGTGTCAGGTCCCAGG + Intergenic
1136884279 16:33922012-33922034 GGTGGGGAGGGTGAGGCCCCAGG - Intergenic
1141407604 16:83807873-83807895 AGTGGGGTGGGGCCGCTCCTTGG + Exonic
1141641497 16:85344220-85344242 AGGGGAAAGGGTACGGTCCCTGG + Intergenic
1141694538 16:85613418-85613440 AGGGGGGAGGACCCCGTCCCCGG - Intronic
1142029128 16:87829716-87829738 AGGGGGAAGGTTCCAGTCCCAGG - Intergenic
1142265907 16:89063884-89063906 GGTGAGGAGGGCCCGGCCCCTGG + Intergenic
1142878952 17:2869703-2869725 GCTGGGGAAGGTCAGGTCCCGGG + Intronic
1144851367 17:18245715-18245737 TGAGGGGAGGGTCAGGGCCCTGG + Intronic
1144941913 17:18947980-18948002 GGTGGGGAGGGACTGATCCCTGG - Intergenic
1145265495 17:21377855-21377877 AATGGGGAGGGGGAGGTCCCAGG - Intronic
1146660550 17:34662690-34662712 AGTGAGGTGGGTCAGCTCCCGGG - Intergenic
1146947430 17:36883498-36883520 AGTGAGGAGGCTCTGGTCACCGG + Intergenic
1147145823 17:38483938-38483960 GGTGGGGAGGGTGAGGCCCCAGG + Intronic
1147769497 17:42857615-42857637 AGTGGGGAGGGGCCTGGCCTGGG + Exonic
1148684684 17:49495015-49495037 AGTGGGGACGCCCTGGTCCCCGG + Intergenic
1148747667 17:49927574-49927596 AGTGGGGAGGTGTGGGTCCCAGG - Intergenic
1149337211 17:55648311-55648333 AGTGAGGAGAGACTGGTCCCTGG + Intergenic
1150209379 17:63433848-63433870 AGAGGGGAGGGACTGGCCCCTGG - Exonic
1150271882 17:63872088-63872110 ACTGGGGAGGGGTCGGTCACAGG + Exonic
1151885461 17:76920935-76920957 AGTGGGTCAGGTCCTGTCCCTGG + Intronic
1152183529 17:78840329-78840351 AGCGGGGCGGGTGCGGCCCCGGG - Intronic
1152287507 17:79421504-79421526 TGTGGGGAGGGACAGGGCCCAGG + Intronic
1153519398 18:5937783-5937805 AGTGGAGAGGGGCTGTTCCCAGG + Intergenic
1157599556 18:48885697-48885719 AGTGGGGAGGTGCCGGGGCCAGG - Intergenic
1157985425 18:52432245-52432267 AGTGGAGAGGCTCAGGTCTCAGG + Intronic
1158673805 18:59500635-59500657 AGCAGGGAGGGGCCTGTCCCTGG + Intronic
1159292429 18:66439900-66439922 GGTGGGAAGGGGCCAGTCCCTGG + Intergenic
1159942982 18:74422760-74422782 TGTGGGGAGGTTACAGTCCCAGG + Intergenic
1160932148 19:1575854-1575876 AGTGGGGAGGGCCCTGTGGCAGG + Intronic
1161379839 19:3959074-3959096 AGTGGGGTGGGCCAGGCCCCAGG - Exonic
1161623789 19:5313679-5313701 AGTGGGGAGGGCCTGGCCCAAGG + Intronic
1162615644 19:11798504-11798526 AGTTGGCAGGGCCCCGTCCCAGG - Intronic
1163455468 19:17403654-17403676 AGTGAGGAGGGGGCGGCCCCGGG - Intronic
1163651748 19:18521872-18521894 AGTGGGGAACGTCCGGACGCGGG - Intronic
1166685444 19:44793667-44793689 AGTGGGGAGGGACTGGAGCCTGG + Intronic
1167071025 19:47221973-47221995 AGTGGGGATGGTCAGCTCCAGGG + Intronic
1167155912 19:47738945-47738967 GGTGGGGAGGGGGTGGTCCCAGG + Intronic
1167695922 19:51015672-51015694 AGTGGGGAGGGGCTGGGGCCAGG - Intronic
1168107803 19:54174759-54174781 AGTGGGGAGGGCCTGGGGCCTGG - Intronic
1168390089 19:56000000-56000022 AGTGGGGAGGTGGCAGTCCCTGG - Intronic
925139669 2:1541236-1541258 AGTGGGGAGGTGCTGGTCACAGG + Intronic
925984741 2:9206751-9206773 AGAGGGGCGGGTCCGGGCCGGGG - Exonic
926251315 2:11156775-11156797 GGTGGGGAGGGGGGGGTCCCAGG + Intronic
927199763 2:20571043-20571065 ACTGGGGAGGGTCCGGCTTCTGG + Intronic
937223519 2:120355417-120355439 ACAGGGGAGGCTGCGGTCCCGGG + Intergenic
937496310 2:122423888-122423910 AGAGGGCAGGGTCCCTTCCCTGG - Intergenic
938779512 2:134572640-134572662 AGTGGGGAGGATTCTGGCCCTGG - Intronic
944062943 2:195588767-195588789 ACTGGGGGGTGTCCAGTCCCTGG + Intronic
944114793 2:196174309-196174331 ACTGGGGAAGGTCCCTTCCCTGG - Intronic
945435192 2:209809963-209809985 AGTGGGGAGGGTCCCCTGACTGG - Intronic
946019752 2:216633214-216633236 AGTGCGGAGGGACGGGGCCCGGG + Intronic
947461347 2:230306858-230306880 GGTGGGAAGGGGCAGGTCCCTGG + Intronic
947743631 2:232496645-232496667 AGTGGGGAGAGCCAGGCCCCAGG - Intergenic
949027538 2:241773601-241773623 AGCGAGGAGGGGCCCGTCCCGGG - Intergenic
1170688222 20:18588119-18588141 AGTCGGGCGGGGCCGGGCCCGGG + Intronic
1172486016 20:35298240-35298262 AGCGGGGAGGGTCGGGGCCAGGG + Intergenic
1173827449 20:46056953-46056975 AGTGAGGAGGGTAGGGACCCTGG - Intronic
1176087572 20:63305035-63305057 AGTGGGCAGGGCCCTGGCCCCGG + Intronic
1176108603 20:63401025-63401047 AGCAAGGAGGGGCCGGTCCCCGG - Intergenic
1179501505 21:41812163-41812185 AGTAGGGAGGGTCCCTCCCCAGG + Intronic
1180118261 21:45726170-45726192 CGTGGGGAGGGTCAGGTCCAAGG + Intronic
1180991874 22:19941857-19941879 ACCGGGGCGGGTCCAGTCCCGGG + Exonic
1181922961 22:26334804-26334826 AGTGGGCAGGGTCTGGTCTTGGG + Intronic
1182712601 22:32332072-32332094 GGTGGGGAGGGGCCGGCACCAGG - Intergenic
1184086894 22:42270680-42270702 AATGGGGAGGCTCCGGGCCGCGG + Intronic
1184399843 22:44267454-44267476 GGTGGGGAGGGGCCGGCACCAGG - Intronic
951709292 3:25573012-25573034 AGTGGTGAGGGACCGCTCGCAGG - Intronic
954614168 3:51961072-51961094 AGTGGGGAGGGGCTGGGCCTGGG - Intronic
955753358 3:62204330-62204352 ACTGGGCAGGGTGCTGTCCCAGG + Intronic
956750632 3:72341400-72341422 AGTGATGAGGGCCCGGTCTCTGG + Intergenic
958638605 3:96777124-96777146 AGTGCGGAGGCTGCGGGCCCAGG + Intergenic
959470119 3:106739559-106739581 AGTGGGGAGTGTCAGTTCTCAGG + Intergenic
964518876 3:157542772-157542794 AGTGGCGGGGGGCCGGTCCTAGG + Intergenic
965118638 3:164522227-164522249 AGTGGAAAGGGGCAGGTCCCTGG - Intergenic
966322530 3:178716816-178716838 AGTTGGGAGGAACGGGTCCCTGG + Intronic
968450518 4:674064-674086 AGGGGTGGGGGTCCGGTCGCCGG + Intronic
968458321 4:710233-710255 ACTGGGGAGGGTCCGCAGCCAGG + Intronic
968657951 4:1786748-1786770 AGTGGGGCGTGGCTGGTCCCTGG - Intergenic
969028887 4:4195478-4195500 AGTGGGGAAGGGCTGGTGCCAGG - Intronic
969239150 4:5888082-5888104 GGTGGGGCGGGGCCGGTCTCGGG - Intronic
969706473 4:8794899-8794921 AGTGGGGAGCTTCCCCTCCCAGG - Intergenic
970480198 4:16464881-16464903 AATGGGGAGGGCCTGGTCTCTGG - Intergenic
979813149 4:125064901-125064923 AGTAGGGAGGGTCTGTTCTCAGG - Intergenic
983553543 4:169039896-169039918 AGTGGGGAGGTTGGGGTCCTCGG + Intergenic
983638660 4:169924213-169924235 AGTGGGGAGGGTGCGGTGCGGGG - Intergenic
985824410 5:2181867-2181889 AGGAGGGAGGGTCCCGACCCTGG + Intergenic
985899873 5:2780119-2780141 TGTGGGCAGGGTCGGTTCCCTGG + Intergenic
991441874 5:66659142-66659164 AGTGGGAAGGGGTGGGTCCCTGG + Intronic
997832612 5:137164281-137164303 AGTGGGGAGGCTCCAATTCCAGG + Intronic
998506282 5:142675052-142675074 GGTGGGGAGGGTCAGGTCAATGG + Intronic
999231789 5:150066045-150066067 AGTGAGTAAGGTCCTGTCCCTGG + Intronic
999432102 5:151533199-151533221 AGTAGGGAGCATCCTGTCCCTGG + Intronic
1001577093 5:172771453-172771475 CGCGGCGCGGGTCCGGTCCCTGG - Intergenic
1002321246 5:178377391-178377413 AGTGGGGTGGCCCCGGCCCCTGG - Intronic
1002449851 5:179312462-179312484 TGTGGTGAGGGTCTGCTCCCTGG - Intronic
1002978334 6:2109280-2109302 GGTGGTGAGGGTCCAATCCCAGG + Intronic
1006163961 6:32053725-32053747 TGTGGGGAGAGTGAGGTCCCTGG + Intronic
1006269894 6:32956205-32956227 AGTGGGGAGATTCAGGCCCCTGG + Intronic
1007369538 6:41417293-41417315 GGAGGGGAGGGTGTGGTCCCAGG + Intergenic
1007626214 6:43247692-43247714 AGTGGGGAGGCTCAGTTCACGGG + Intronic
1010161533 6:72862208-72862230 ACTGGGGAGGGTCCTGTCATGGG + Intronic
1014817580 6:125952771-125952793 GGTGGGAAGGGGCAGGTCCCGGG + Intergenic
1015227982 6:130880373-130880395 TGTGGGGAGGGTCCACTCTCAGG - Intronic
1017565688 6:155683303-155683325 TGTGGGGAGCCTCAGGTCCCTGG - Intergenic
1018707101 6:166471023-166471045 GCTGGGGAGGGTCTGATCCCTGG + Intronic
1018786265 6:167110354-167110376 AGAGGTGAGGGGCCGGTCGCAGG - Intergenic
1018923628 6:168192340-168192362 GGTGGGGAGGGCGGGGTCCCAGG - Intergenic
1019019127 6:168902824-168902846 AGTGGGGAGAGAACGGGCCCAGG + Intergenic
1019163194 6:170082483-170082505 AGTGGGGAGGGCCAGGTCTCAGG + Intergenic
1019404366 7:876123-876145 CGTGGGGAGGGTCCCACCCCGGG + Intronic
1019879956 7:3850149-3850171 AGGGGGGTGGGTCCATTCCCAGG - Intronic
1025026080 7:55517444-55517466 AGTGTGCAGGGTGCTGTCCCGGG - Intronic
1029461063 7:100694116-100694138 CGGCGCGAGGGTCCGGTCCCGGG + Intergenic
1032155217 7:129462402-129462424 AGTGGGGAGGCTGGGGTCTCAGG - Intronic
1034983107 7:155490919-155490941 AGAGGGGAGTTTCCGGTTCCTGG - Intronic
1035418462 7:158708035-158708057 GGTGGGAAGGGGCAGGTCCCTGG - Intergenic
1038518446 8:28207065-28207087 AGTTGGGAGCCTCTGGTCCCGGG - Intergenic
1039210159 8:35204603-35204625 GGTGGGAAGGGTTGGGTCCCTGG - Intergenic
1039435289 8:37555858-37555880 TCTGGGGAAGGTCCGGTCACAGG + Intergenic
1049636508 8:143692347-143692369 ACTGTGGAGTGTCAGGTCCCTGG + Intronic
1049777725 8:144414172-144414194 GGTGGGGTGGGTAAGGTCCCTGG + Intronic
1050388600 9:5113855-5113877 GGTGGGGAGGGTGAAGTCCCTGG - Intronic
1051253599 9:15188353-15188375 AGTGGGGAGGTTCCATTCCAAGG + Intronic
1051367606 9:16332243-16332265 AGTGGGGAGGGAGCTCTCCCGGG - Intergenic
1052824892 9:33167365-33167387 AGAGGGGAGGGGCGGGGCCCCGG + Intergenic
1052849587 9:33368874-33368896 AGTGGAGAGGGGCTGGTCCTGGG - Intronic
1055645344 9:78357334-78357356 AGTGGGGAGGGGCCAGGCACGGG - Intergenic
1060223018 9:121774346-121774368 TGTGGGGGGGGTCTGGGCCCAGG - Exonic
1061444207 9:130628592-130628614 AGTGGGGAGGGCCGGGGCCTCGG + Intronic
1061908046 9:133708778-133708800 ACTGGGGAGGGAGCGGCCCCTGG + Intronic
1061985016 9:134125673-134125695 AGTGGGGAGTGTCCCGGCTCAGG - Intergenic
1187505371 X:19874693-19874715 AGTGGGGAGGGTCAGGAGGCTGG + Intronic
1197726532 X:129780649-129780671 AGTGGGCAGGGTCTGGGCCATGG - Intronic