ID: 923369349

View in Genome Browser
Species Human (GRCh38)
Location 1:233295301-233295323
Sequence GAGTGGGGAGGGTCCGGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 269}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923369349_923369361 -3 Left 923369349 1:233295301-233295323 CCGGGACCGGACCCTCCCCACTC 0: 1
1: 0
2: 1
3: 20
4: 269
Right 923369361 1:233295321-233295343 CTCACCAGGTGCAGGGCCAGGGG 0: 1
1: 0
2: 2
3: 28
4: 359
923369349_923369366 22 Left 923369349 1:233295301-233295323 CCGGGACCGGACCCTCCCCACTC 0: 1
1: 0
2: 1
3: 20
4: 269
Right 923369366 1:233295346-233295368 GCAGCAGGAGGAACAGCCACAGG 0: 1
1: 1
2: 3
3: 69
4: 595
923369349_923369359 -5 Left 923369349 1:233295301-233295323 CCGGGACCGGACCCTCCCCACTC 0: 1
1: 0
2: 1
3: 20
4: 269
Right 923369359 1:233295319-233295341 CACTCACCAGGTGCAGGGCCAGG 0: 1
1: 1
2: 1
3: 46
4: 369
923369349_923369363 7 Left 923369349 1:233295301-233295323 CCGGGACCGGACCCTCCCCACTC 0: 1
1: 0
2: 1
3: 20
4: 269
Right 923369363 1:233295331-233295353 GCAGGGCCAGGGGCAGCAGCAGG 0: 1
1: 7
2: 41
3: 340
4: 1631
923369349_923369360 -4 Left 923369349 1:233295301-233295323 CCGGGACCGGACCCTCCCCACTC 0: 1
1: 0
2: 1
3: 20
4: 269
Right 923369360 1:233295320-233295342 ACTCACCAGGTGCAGGGCCAGGG 0: 1
1: 0
2: 3
3: 33
4: 278
923369349_923369367 28 Left 923369349 1:233295301-233295323 CCGGGACCGGACCCTCCCCACTC 0: 1
1: 0
2: 1
3: 20
4: 269
Right 923369367 1:233295352-233295374 GGAGGAACAGCCACAGGTAGAGG 0: 1
1: 0
2: 5
3: 48
4: 301
923369349_923369364 10 Left 923369349 1:233295301-233295323 CCGGGACCGGACCCTCCCCACTC 0: 1
1: 0
2: 1
3: 20
4: 269
Right 923369364 1:233295334-233295356 GGGCCAGGGGCAGCAGCAGGAGG 0: 1
1: 2
2: 15
3: 187
4: 1256
923369349_923369355 -10 Left 923369349 1:233295301-233295323 CCGGGACCGGACCCTCCCCACTC 0: 1
1: 0
2: 1
3: 20
4: 269
Right 923369355 1:233295314-233295336 CTCCCCACTCACCAGGTGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923369349 Original CRISPR GAGTGGGGAGGGTCCGGTCC CGG (reversed) Intronic
900137049 1:1122120-1122142 GAGGGCGGAGGGTGGGGTCCCGG - Intergenic
900138487 1:1128875-1128897 GACTGGGGAGGGGCTGGTCCCGG - Intergenic
900466683 1:2829041-2829063 GAGTGAGGTGGGCACGGTCCTGG + Intergenic
900514450 1:3074662-3074684 GAGTGTGGAGGGTGCAGGCCAGG - Intronic
900619497 1:3580381-3580403 GGGAGGGGAGGCTCCGGCCCAGG + Intronic
901186757 1:7378604-7378626 GAGTGGGGAGGGGCTGCTTCAGG + Intronic
902940957 1:19799919-19799941 GGGAGGGGAGGGGCCGGGCCGGG - Intronic
903741962 1:25563568-25563590 CAGAGGGGAGGGTCAGGGCCAGG + Intronic
903813551 1:26047901-26047923 CAGTGGGGAGAGTACGGTACTGG + Intergenic
904988473 1:34572512-34572534 GAGAGGGTAGGGTGCGGTCTGGG + Intergenic
905035606 1:34916251-34916273 GAGGTGGGAGTGTCCCGTCCAGG + Intronic
905108377 1:35577270-35577292 GTGTGGGGAGGGGCGGCTCCAGG - Intronic
905378319 1:37540587-37540609 GAGTGGGCAGGGTCAGGGACGGG - Exonic
906112324 1:43332273-43332295 AAGTGGGGAGGGTCTGTGCCTGG + Intergenic
907046320 1:51302332-51302354 GAGTGATGGGGGTCCGGGCCGGG - Intronic
907372251 1:54011105-54011127 GAGTGGGGAGGGCCAGGAACTGG + Intronic
908147211 1:61259347-61259369 GAGAGGGGAAGGGCCAGTCCGGG - Intronic
909197691 1:72648498-72648520 GAGTTGGGAGAGTCCAGGCCGGG - Intergenic
914245993 1:145886116-145886138 GGGTGGGGCGGGTCCGGGTCCGG - Intergenic
915359574 1:155277929-155277951 GGGTGGGGCGGGCCGGGTCCCGG - Intronic
915362668 1:155295347-155295369 GCGTGGGCAGGGGCGGGTCCCGG - Intronic
915559932 1:156681268-156681290 GAGTGTGGAGTGGCCAGTCCAGG + Intergenic
918093903 1:181318786-181318808 GAGTAGGGTGGGTCCTTTCCTGG + Intergenic
919923863 1:202182106-202182128 GAGTGGGGAGCGAGAGGTCCAGG - Intergenic
920400056 1:205670764-205670786 GAGTGGGAAGGGGCCGGCGCTGG - Intronic
922494680 1:226047312-226047334 GAGTGGGGAGGGAATGGTCAGGG - Intergenic
923369349 1:233295301-233295323 GAGTGGGGAGGGTCCGGTCCCGG - Intronic
924284870 1:242475897-242475919 GAGAGGGAAGGGTCTGCTCCAGG - Intronic
1062802312 10:389324-389346 GAGAGGGGAGGGTGCGACCCCGG - Intronic
1063266558 10:4457999-4458021 GGGTGGGGAGGGTCAGGGCGGGG - Intergenic
1065940791 10:30562466-30562488 CAGTTGGGAGGGTGTGGTCCCGG - Intergenic
1066214586 10:33273928-33273950 AAGTGGGGAGGGTGAGGTCTGGG - Intronic
1067083966 10:43228489-43228511 GAGTGGGGAGGGCCCTGCACTGG - Intronic
1067321377 10:45224245-45224267 GACTGGGAAGGGTCCAGCCCCGG + Intergenic
1067808974 10:49412454-49412476 CTGTGGGGAGGGTCCCGCCCTGG - Intergenic
1072620380 10:97075414-97075436 GAGGAGGGAGGGTCAGGGCCTGG + Intronic
1072625396 10:97107965-97107987 AAGGGGTGAGGCTCCGGTCCGGG + Intronic
1074564556 10:114565557-114565579 GAGTGCCTAGGGTCAGGTCCTGG - Intronic
1075875410 10:125802205-125802227 CAGTGTGGAGGGTTCGCTCCAGG - Intronic
1076834961 10:133016396-133016418 GAGTGGGCAGGGTCCAGGCCAGG + Intergenic
1077090656 11:776992-777014 GTGTGGGGAGGGGCCATTCCGGG - Intronic
1077144054 11:1036980-1037002 CAGCGGGGAGGGCCCGGGCCAGG - Intergenic
1077176973 11:1195459-1195481 CAGTGGGGAGGGGCGGGTGCCGG + Intronic
1077225232 11:1436637-1436659 CAGTGGGGAGGGGGCGGCCCCGG + Intronic
1077336975 11:2009772-2009794 GAGGGGGGAGGGTCTGGCTCTGG - Intergenic
1077421377 11:2451707-2451729 GAGCGGGCAGGGGCCTGTCCTGG - Intronic
1078103610 11:8344800-8344822 AGGTGGGGAGGCTCCGCTCCTGG + Intergenic
1079083700 11:17430791-17430813 GTGAGGGGAGGGTCCGGGCGAGG - Intronic
1079603858 11:22342314-22342336 GAGAGGGGAGGGTCACGTCAAGG + Intronic
1080668940 11:34358467-34358489 GAATGGGGAGGGCCCCATCCAGG + Intergenic
1081342740 11:41947801-41947823 GGGTAGAGAGGGTCTGGTCCCGG - Intergenic
1081873339 11:46392818-46392840 CAGTGGGGAGCGTCCGACCCCGG - Intergenic
1083408067 11:62472290-62472312 CAGTGGGGAGGGTCTGGGTCAGG - Intronic
1083611897 11:64008331-64008353 GTGTGAGGAGGGACCGGCCCTGG + Intronic
1083843036 11:65315371-65315393 GAGTGGGGAGGGGTCGGCGCAGG + Intronic
1087175141 11:95089556-95089578 GAGTGGGGCGGGCCTAGTCCCGG - Intergenic
1089195038 11:116689334-116689356 GTGAGGGGAGGATCGGGTCCAGG - Intergenic
1090249284 11:125240158-125240180 GAGTGGGGAGGGGGTGGACCGGG + Intronic
1202819959 11_KI270721v1_random:64954-64976 GAGGGGGGAGGGTCTGGCTCTGG - Intergenic
1092465691 12:8729539-8729561 GAGTGGGGAGGGGCAGGCCATGG + Intronic
1096187162 12:49588729-49588751 GAGTGGAGAGGGTAAGGCCCAGG + Intronic
1096500922 12:52063374-52063396 GAGTGCGGGGGGGCCTGTCCTGG + Intergenic
1097179475 12:57163042-57163064 GAGTGGGGAGGGGAGGATCCAGG + Intronic
1100167263 12:91929882-91929904 CAGTGGGGAGGGCCAGGGCCAGG + Intergenic
1103919423 12:124391640-124391662 GAGTGGGGAGGTGCAAGTCCAGG - Intronic
1104670118 12:130674748-130674770 GAATGGGGAGCGGCCGGTCATGG - Intronic
1107430755 13:40338229-40338251 GGGTGGTGAGGGTCAGGGCCTGG + Intergenic
1108495346 13:51019267-51019289 GAGTGGGTAGGGTGGGGTTCAGG - Intergenic
1110356774 13:74575918-74575940 GAGGGGGGAGGGTGCGGCGCAGG + Intergenic
1111167082 13:84473731-84473753 GACTGGGGAGGGTCGGGGGCAGG - Intergenic
1111625096 13:90774781-90774803 CAGTGTGGAGGGTGAGGTCCTGG - Intergenic
1112493241 13:99885417-99885439 GAGGGGGGAGGGTCCCATCATGG + Intronic
1112727105 13:102317687-102317709 GGGAGGGGCGGGTCCTGTCCAGG - Intronic
1113948962 13:114060623-114060645 GAACGGGGCGTGTCCGGTCCTGG - Intronic
1116945300 14:50830755-50830777 GCGGGAGGAGGGGCCGGTCCCGG - Intronic
1118714902 14:68552292-68552314 GATTGGGGTGGGTCCGTTCTTGG + Intronic
1118893874 14:69930169-69930191 GAGTGGGAAGGGTGCTGTCAGGG - Intronic
1121110175 14:91307306-91307328 GAGTGTGGAGGGTGTGGTGCAGG - Intronic
1121220015 14:92278049-92278071 GGGTGGGGAGGGGCAGGGCCAGG + Intergenic
1121654904 14:95588193-95588215 GAGTGGGGAGGGACGGAGCCAGG + Intergenic
1121818256 14:96944509-96944531 CATTGGGGAGGCTCCGTTCCAGG + Intergenic
1122122134 14:99560298-99560320 GAGGTGGGAGGGTCTGGGCCGGG + Intronic
1122201302 14:100124226-100124248 GAGTGAGGAAGGCCCGGGCCAGG - Intronic
1122273349 14:100578189-100578211 GAGAGGGGAAGGTCGTGTCCTGG + Intronic
1122558120 14:102592423-102592445 GAGCGGGGAGGGGCGGCTCCGGG - Intergenic
1122660173 14:103289893-103289915 GAGTGGGGTGGGGCCGGAGCAGG - Intergenic
1124374140 15:29120057-29120079 GAGTGGGGAGGGCCAGGGCCTGG - Intergenic
1128078279 15:64841762-64841784 GGGTGGGGAGGGGCGGGGCCTGG - Intergenic
1128550635 15:68596009-68596031 GAGTGTGGAGGGTCGGGGGCTGG + Intronic
1129251792 15:74313189-74313211 GAGTGGGGTGGGTCATGGCCTGG + Intronic
1129273829 15:74433088-74433110 AAGGGGGGAGCGGCCGGTCCCGG + Intronic
1129918309 15:79294440-79294462 GAGTTGGGAGGGTCAGGCCCTGG - Exonic
1131109933 15:89758735-89758757 GAGTGGGGAGGCTGAGGTCCAGG - Intergenic
1132082849 15:98882286-98882308 GGCTGGGGAGGGTCCAGTACAGG + Intronic
1132120246 15:99169590-99169612 GAGTGGGGAGGGCCCAGCACTGG + Intronic
1132377363 15:101338401-101338423 GAGTGTGGAGGGGCCGGCCTGGG - Intronic
1132463784 16:68338-68360 GCGTGGGGAGGGGCAGGCCCAGG + Intronic
1132473158 16:118087-118109 GAGAAGGGAGGGTGCGGTACAGG + Intronic
1132531302 16:451342-451364 GCGTGGGGAGGGTGAGGTGCAGG - Intronic
1132576257 16:665804-665826 GTGTGGGGAGTGCCCGGGCCGGG + Intronic
1132683824 16:1154074-1154096 GCGTGGGGAGGGTGGGGGCCCGG + Intronic
1132785699 16:1656110-1656132 GAGTGGGCAGGGCACGGCCCGGG + Exonic
1133055646 16:3144303-3144325 GAGGAGGGAGGTCCCGGTCCAGG + Exonic
1133769933 16:8861848-8861870 GGGAGGGGAGGGCCCTGTCCAGG + Intronic
1133908074 16:10039630-10039652 GCGCGGGGAGGGTCCGCACCCGG + Intronic
1135251099 16:20901184-20901206 GAGATGGTAGGGGCCGGTCCGGG + Exonic
1135295743 16:21278057-21278079 GAGTGAGGAGGGTCGGGGTCAGG - Intronic
1135619890 16:23946749-23946771 GTCTGGGGAGGGGCCGGGCCTGG + Intronic
1136247460 16:28984180-28984202 GAGGGGGGAGGGTCAGAGCCAGG - Intronic
1137531404 16:49281067-49281089 GAGTGGGCAGGAATCGGTCCCGG + Intronic
1139544781 16:67645075-67645097 GGGCGGGGAGGGGCCGGGCCGGG + Exonic
1141703433 16:85652608-85652630 GAGAGGGGAGGCGCCGGCCCGGG + Intronic
1142393303 16:89816490-89816512 GAGTGGGCGGCGTCCGGCCCGGG - Intronic
1142801332 17:2347909-2347931 GGGTGGGGAGGCTGAGGTCCTGG - Intronic
1143223791 17:5282793-5282815 GTGTGGGGAGGGAGCGGTTCTGG + Intronic
1145211270 17:21015093-21015115 GAGTGGGGAGGAGCCGATCTTGG + Intronic
1145808867 17:27752978-27753000 GAGTGGGGAGGGCACAGGCCAGG + Intergenic
1145931970 17:28692335-28692357 AAGTGGGGAGGGGCCAGGCCGGG + Intronic
1146052956 17:29567256-29567278 GAGTGGGGAGGGCACGAGCCGGG + Intronic
1147359461 17:39921946-39921968 GAGTGGGGAGGGTCAGGTTGGGG - Intronic
1147769496 17:42857614-42857636 TAGTGGGGAGGGGCCTGGCCTGG + Exonic
1147968188 17:44205527-44205549 GAGTGGGGAGTGTCCCCCCCAGG + Exonic
1148797132 17:50202374-50202396 GAGTGGGGAGGCTGAGGTGCAGG + Intergenic
1152328977 17:79659611-79659633 GAGTGGGGAGGGTCCAGCATGGG - Intergenic
1152362472 17:79839101-79839123 GGGTGGGGAGGCTGCGGGCCGGG - Intronic
1152534148 17:80940816-80940838 GAGTGGGGAGGGGAGGGGCCGGG + Intronic
1152586156 17:81190385-81190407 GAGTGGGTCGGGTCTGGGCCTGG - Intronic
1152613950 17:81329484-81329506 GAGGGAGGAGGGTCCGGGCCAGG + Intronic
1153786048 18:8536617-8536639 GGGTGGGGAGAATGCGGTCCCGG - Intergenic
1155571251 18:27196626-27196648 GGGTGGGGAGGGTACCGTCTGGG - Intergenic
1157172284 18:45418896-45418918 GAGGGGAGAGGGTCCACTCCTGG + Intronic
1157816011 18:50729853-50729875 GAGGGCGGAGGGGCCGCTCCAGG + Exonic
1158656454 18:59339834-59339856 GAGAGGGTAGGGTCCCTTCCAGG - Intronic
1160516047 18:79479842-79479864 GCCTGGGGAAGGCCCGGTCCCGG + Intronic
1160709360 19:544018-544040 GTGTGGGGAGGCTCGGGGCCGGG + Exonic
1160863814 19:1248757-1248779 GATCGGGGAGCCTCCGGTCCTGG + Intronic
1160875657 19:1295260-1295282 GAGCGGGGAGGGACGGGTCAGGG - Intronic
1160951010 19:1667458-1667480 GAGTGGGGAGGAACGGCTCCCGG - Intergenic
1161575497 19:5052376-5052398 GGGTGGGGAGGGTGGGTTCCAGG + Intronic
1162744159 19:12789776-12789798 GGGTGGGGCGGGGCCGGGCCAGG + Intronic
1162971585 19:14184009-14184031 GAGTGGGCAGGGTCAGGACAGGG - Intronic
1163237458 19:16037852-16037874 GCGTGGGAATGGTCCAGTCCTGG - Intergenic
1163279929 19:16309656-16309678 GAGTGGGGAGGCCCAGGGCCAGG - Intergenic
1163647004 19:18495261-18495283 GAGTGGGGAGGGTCAGTGTCTGG + Intronic
1163700254 19:18783225-18783247 GAGAGGGAAGGGTCTGGCCCAGG - Intronic
1163862421 19:19749271-19749293 GTGTGGGAATGGTCCCGTCCAGG + Intergenic
1164061393 19:21678315-21678337 GAGTGAGGAGGGGCTGGGCCGGG + Intergenic
1164222072 19:23203914-23203936 GAGTGAGGAGGGGCTGGGCCGGG - Intergenic
1164402747 19:27912846-27912868 GAATGGGGAGGGTCTTCTCCTGG + Intergenic
1165938953 19:39405710-39405732 GAGTGGGTTGGGTGGGGTCCAGG - Intergenic
1166667429 19:44689488-44689510 GAGTGGGGAGGGAGGTGTCCAGG - Intergenic
1166737308 19:45093573-45093595 GAGTCGGGAGGGATCGGTGCAGG + Intronic
1166864299 19:45826745-45826767 GTGAGGGAAGGGTCTGGTCCTGG + Intronic
1166975174 19:46601523-46601545 GAGTGGGGGGCGTCCGGGCCCGG + Intronic
1167071024 19:47221972-47221994 GAGTGGGGATGGTCAGCTCCAGG + Intronic
1167375265 19:49107791-49107813 AAGCGGGGAGGGGCCGGGCCTGG - Exonic
1167409804 19:49338151-49338173 GAGTGGGGAGCGTCGGGCCTGGG - Intronic
1167644262 19:50697201-50697223 GTGTGGGGAGGGTGCAGTCAGGG - Intronic
1168686917 19:58354333-58354355 GAGTGGGGAGGATGCAGTGCAGG - Intergenic
924979928 2:210283-210305 GTGTGGGGAGGGCCCTGGCCTGG - Intergenic
925984742 2:9206752-9206774 GAGAGGGGCGGGTCCGGGCCGGG - Exonic
930775747 2:55168465-55168487 GAGTGGGGTGAGTCCAGGCCTGG - Intergenic
932322122 2:70830067-70830089 GACTGGGGAAGTTCCAGTCCTGG - Intergenic
932582326 2:72999958-72999980 GAGTGGGGAGGGTCCAGGGCTGG - Intronic
934990011 2:98914332-98914354 GAGGGGGTAGGGTCCAGCCCAGG - Intronic
935315307 2:101827605-101827627 GAATGGGGAGGGTCCTGAGCAGG + Intronic
937223518 2:120355416-120355438 GACAGGGGAGGCTGCGGTCCCGG + Intergenic
937401048 2:121584031-121584053 GAGTGGTGAGGGCCTGGTCTTGG - Intronic
940517352 2:154698280-154698302 GAGGGGGGAGGGTCTGGTCCAGG + Exonic
940850434 2:158683113-158683135 GAGTGGTCAGGGTGGGGTCCAGG - Intergenic
943583271 2:189709438-189709460 AAGTGGGGAGGGTGGGGCCCAGG + Intronic
944671203 2:201995991-201996013 GGGTAGGAAGGGTCTGGTCCAGG - Intergenic
946019751 2:216633213-216633235 GAGTGCGGAGGGACGGGGCCCGG + Intronic
948991750 2:241559107-241559129 GGGCGGGGAGGGCCGGGTCCTGG + Intronic
949024935 2:241763035-241763057 GGGTGGGGAGGGTGAGGGCCTGG + Intronic
1168991758 20:2102101-2102123 GCCTGGGGATGGTCCGCTCCGGG - Exonic
1170067969 20:12335057-12335079 GAGTGAGGAGGGCCAGGTGCAGG + Intergenic
1170601731 20:17846465-17846487 GTGTGGAGAGGGTCCCTTCCAGG - Intergenic
1171184343 20:23114221-23114243 GAGTGGGGAAGGGCTGGTCTGGG - Intergenic
1172244164 20:33434203-33434225 GAGTGGAGAAGGTCTGGGCCTGG - Intronic
1172486015 20:35298239-35298261 GAGCGGGGAGGGTCGGGGCCAGG + Intergenic
1172919985 20:38473091-38473113 GAGAGGGGAGGGTCCGGCCGCGG - Intronic
1173042144 20:39474698-39474720 GAGTGGGGTGGGACCGGGCCTGG + Intergenic
1175125823 20:56750776-56750798 GAGGGGAGAGGGTCCTGTCTGGG + Intergenic
1175975323 20:62707964-62707986 GAGTGGGGAGGGTGCTGCTCTGG + Intergenic
1178583825 21:33856907-33856929 GAGAGGGGAGGGTTCCGTCAAGG + Intronic
1178587996 21:33885914-33885936 GAGTGGGGAGCGGCCGGGCATGG + Intronic
1179581041 21:42344171-42344193 GAGTGTGGAGGTTCTGCTCCCGG - Intergenic
1179987039 21:44927767-44927789 GAGTGGGGAGGGCTCGGGGCAGG + Intronic
1180073597 21:45450693-45450715 GAGTGGGGAGGCTCAGTTCTTGG + Intronic
1180121804 21:45756667-45756689 GAGTGGGGAGTGACTGCTCCTGG - Intronic
1180991873 22:19941856-19941878 GACCGGGGCGGGTCCAGTCCCGG + Exonic
1181164867 22:20977794-20977816 GGGTGGGGAGGACCCGGTGCTGG + Intronic
1181922960 22:26334803-26334825 GAGTGGGCAGGGTCTGGTCTTGG + Intronic
1183740470 22:39666026-39666048 GAGAGGGGAGGGTCTGATCAGGG - Intronic
1184106324 22:42369281-42369303 GTCTGGGGAGGGGCCGGACCGGG + Intergenic
1184158707 22:42685594-42685616 GAGTGGGGAGGGGCCAGGCTGGG - Intergenic
1184818533 22:46891001-46891023 GAGTGGGGAGGGCCTGCACCGGG + Intronic
1184938103 22:47739843-47739865 GGGTGTGGAGGGGCAGGTCCGGG + Intergenic
1185005933 22:48277034-48277056 GAGTGGGTGGGGACCAGTCCTGG - Intergenic
954288900 3:49638556-49638578 CTGTGGGGAGGGTGCGGTCAAGG + Intronic
954614169 3:51961073-51961095 CAGTGGGGAGGGGCTGGGCCTGG - Intronic
954615606 3:51967519-51967541 GGGCGGGGAGGGGCCGGGCCGGG - Intronic
957039649 3:75327460-75327482 GAGTGGGGAGGGTGCTGCCAGGG + Intergenic
958201435 3:90321330-90321352 GAGTGGGGAGGGACAGGACTAGG + Intergenic
961044406 3:123698893-123698915 GAGTGGGGAGGGTGCTGCCAGGG + Intronic
961130300 3:124460016-124460038 GTGAGGGGAGGGTCTGTTCCAGG + Intronic
961477423 3:127157444-127157466 GGGTGGGGAGGGGCAGGTCGGGG + Intergenic
961871373 3:129990854-129990876 GTGTGGGGAGGGTCAGATACTGG + Intergenic
966901553 3:184490460-184490482 GAGTAGGGAGGGACTGCTCCAGG + Intronic
967272288 3:187741558-187741580 GGGTTGGGAGGGGCCGTTCCTGG + Intronic
967924193 3:194633420-194633442 GGGTGGGGAGCGCGCGGTCCCGG - Exonic
968425889 4:523079-523101 GAGCGTGGAGGGCCGGGTCCAGG + Intronic
968512888 4:1003172-1003194 GAGGGGCGAGGGGCCGGGCCGGG + Intronic
968920228 4:3518678-3518700 GAGTGGGGAGGTTGCTGTGCAGG - Intronic
969239151 4:5888083-5888105 GGGTGGGGCGGGGCCGGTCTCGG - Intronic
969568212 4:7992650-7992672 GAGTGGGGAGGGTGTTGCCCAGG + Intronic
969711568 4:8847204-8847226 GAGTGGGGAGGGTTGAGCCCAGG + Intronic
974000495 4:56506504-56506526 GTGTGGGGAGGGTTCGGGGCTGG - Intronic
980701762 4:136441887-136441909 GAGTGAGGAGGCTCTGGGCCTGG - Intergenic
983638661 4:169924214-169924236 CAGTGGGGAGGGTGCGGTGCGGG - Intergenic
984886511 4:184454733-184454755 GAGTGGTGAGGTTCCAGTTCAGG - Intronic
985283281 4:188307938-188307960 GAGGTGGGAGGGTGCGGTCAGGG + Intergenic
985493896 5:193762-193784 GGGTGGGGAGGGACATGTCCTGG + Intronic
985758665 5:1733665-1733687 GAGTGGGGAGGGGTCACTCCAGG - Intergenic
991088484 5:62670819-62670841 GAGTGGGGAGAGTCAAGTTCTGG - Intergenic
991489081 5:67165800-67165822 GAGAGGAGAGGGACCGGTCGGGG - Exonic
992077152 5:73202181-73202203 GAGTGGGGAGGGTCTGTGCCGGG - Intergenic
992372872 5:76163090-76163112 GACTGGGCAGGGTCAGGCCCAGG - Intronic
992527720 5:77628634-77628656 GGGAGGGGAGGGGCCGGTCTTGG - Intergenic
994687347 5:102971574-102971596 TAGTGGGGAGGGAGTGGTCCAGG + Intronic
997303388 5:132822683-132822705 GATTGGGGAGGACCCAGTCCAGG - Exonic
998107480 5:139477565-139477587 GAGAATGGAGGGTCCAGTCCAGG + Intronic
998108908 5:139486310-139486332 GAGTGGGAATGGTGGGGTCCAGG + Intergenic
998157730 5:139795996-139796018 CAGCGGGGAGGGGCGGGTCCCGG - Intronic
999770841 5:154774384-154774406 GGCTGGGGAGGGTCTGCTCCAGG + Intronic
1003309844 6:4960638-4960660 GAGTGGGGAGCGGCAGGTACAGG + Intergenic
1004223909 6:13769551-13769573 GAGCGTGGAGGTTCTGGTCCGGG - Intergenic
1005927144 6:30453246-30453268 GGCTGGGAAGGGTCCGCTCCAGG + Intergenic
1006253850 6:32813671-32813693 GAGTGGGGAAGGTCTGGGACAGG + Intronic
1007386716 6:41524966-41524988 GAGGGGGGAGGGTCCAGGCAAGG + Intergenic
1007476622 6:42123776-42123798 GGGAGGGGAGGGCCCTGTCCAGG - Intronic
1007635635 6:43298189-43298211 GGCTGGGGAGGGCCCAGTCCTGG + Intronic
1007764504 6:44152742-44152764 GAGTGGAGAGGGTGAAGTCCTGG - Intronic
1010161532 6:72862207-72862229 AACTGGGGAGGGTCCTGTCATGG + Intronic
1012568084 6:100685280-100685302 GGGTAGGGAGGGTCATGTCCTGG + Intronic
1013346246 6:109263427-109263449 GTGAGGGGAGGATCTGGTCCTGG - Intergenic
1017544767 6:155438786-155438808 GAGCATGGAGGGTCCTGTCCCGG - Intronic
1018339053 6:162830328-162830350 GAGTGGGTAGGGGCAGGTCAGGG - Intronic
1019404365 7:876122-876144 GCGTGGGGAGGGTCCCACCCCGG + Intronic
1019414007 7:919185-919207 AGGTGGGGAGGGTGCGGCCCCGG - Intronic
1019453068 7:1109708-1109730 GAGTGGGGAGGGCCCGGCGGGGG - Intronic
1019477168 7:1249593-1249615 GAGAGGGAAGGGACAGGTCCAGG - Intergenic
1019537729 7:1537808-1537830 GTGTGGGGAGGGTCCTGGGCTGG + Intronic
1019602645 7:1893033-1893055 GAGCGGGGAGGCTCAGCTCCTGG - Intronic
1020198294 7:6059269-6059291 GAGTTGGGCGTGTCCGGCCCCGG + Intergenic
1021717288 7:23471218-23471240 GAGTGGGGGCGGCCCGGCCCCGG + Intergenic
1023150999 7:37201468-37201490 GAGTTGGGAGACTCAGGTCCTGG + Intronic
1024208810 7:47186441-47186463 GGGTGGGGAGGGTCAGGCCATGG - Intergenic
1025208994 7:57009896-57009918 GGGTGGGGAGGGGCCGGGCGTGG - Intergenic
1025662955 7:63566960-63566982 GGGTGGGGAGGGGCCGGGCGTGG + Intergenic
1029461062 7:100694115-100694137 GCGGCGCGAGGGTCCGGTCCCGG + Intergenic
1032328240 7:130952049-130952071 GAGTGGGGAGAGGCCTGTCCTGG + Intergenic
1034386342 7:150744198-150744220 GTGTGGGGATGGTCCATTCCTGG - Intronic
1035291220 7:157840546-157840568 GAGTGGAGAGGGTACGGGACGGG + Intronic
1036613329 8:10368540-10368562 GAGTGGGGTGGTCCCAGTCCTGG + Intronic
1038289334 8:26234925-26234947 CAGTGGGGAGGGGCAGGTGCAGG - Intergenic
1038518447 8:28207066-28207088 GAGTTGGGAGCCTCTGGTCCCGG - Intergenic
1038618694 8:29119449-29119471 GAGTGGGGAGGGCCAGGCTCGGG - Intronic
1039917693 8:41871949-41871971 GGGAAGGGAGGGTCCGGGCCAGG + Intronic
1048720770 8:137321806-137321828 GGGTGGAGAGTGTCCGGGCCAGG + Intergenic
1049198239 8:141327029-141327051 CAGAGGGAAGGGTCCGTTCCAGG - Intergenic
1049419438 8:142510493-142510515 GAGCGGGGAGGGTGCGAGCCGGG - Intronic
1049441753 8:142612819-142612841 GAGTGTGGAGGGTGGGGTCCAGG + Exonic
1049510991 8:143026621-143026643 GAGCGGGAAGGGCCTGGTCCTGG - Intergenic
1050802988 9:9638820-9638842 GTCTGGTGAGGGTCTGGTCCTGG + Intronic
1052820653 9:33135677-33135699 GAGCGGGGAGGGTCCTGGGCAGG - Intronic
1052849588 9:33368875-33368897 GAGTGGAGAGGGGCTGGTCCTGG - Intronic
1055645345 9:78357335-78357357 GAGTGGGGAGGGGCCAGGCACGG - Intergenic
1061681284 9:132243579-132243601 CAGTGCCGGGGGTCCGGTCCTGG + Exonic
1061988288 9:134143136-134143158 GGGTGGGGATGGCCCAGTCCTGG + Intronic
1062533101 9:137010371-137010393 GAGTGGGCAGGCTCCTGGCCAGG - Exonic
1062582069 9:137233173-137233195 GAGTGGGCAGGGTCAGGTGGGGG - Intronic
1062725367 9:138070272-138070294 GAGTGGGCAGGGTCAGGCCTGGG + Intronic
1203747010 Un_GL000218v1:45410-45432 GACCGGGGAAGGTCAGGTCCAGG - Intergenic
1195157862 X:102141644-102141666 GAGTGTGGAGGGCCCGGCCAAGG - Intronic
1195275454 X:103276360-103276382 GAGTGGAGAGAATCCAGTCCTGG + Intronic
1195306266 X:103586339-103586361 GAGTGTGGAGGGCCCGGCCAGGG + Intronic
1195308580 X:103608728-103608750 GAGTGTGGAGGGCCCGGCCAGGG + Intronic
1195899648 X:109783981-109784003 GAGTTGGGAGGGTTCGGTTGGGG - Intergenic
1200062784 X:153491043-153491065 GGGTGGGGAGGTTCGTGTCCAGG + Intronic