ID: 923369351

View in Genome Browser
Species Human (GRCh38)
Location 1:233295307-233295329
Sequence CCGGACCCTCCCCACTCACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 252}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923369340_923369351 2 Left 923369340 1:233295282-233295304 CCTCCATACCCACAGCTCCCCGG 0: 1
1: 0
2: 0
3: 27
4: 269
Right 923369351 1:233295307-233295329 CCGGACCCTCCCCACTCACCAGG 0: 1
1: 0
2: 2
3: 31
4: 252
923369339_923369351 3 Left 923369339 1:233295281-233295303 CCCTCCATACCCACAGCTCCCCG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 923369351 1:233295307-233295329 CCGGACCCTCCCCACTCACCAGG 0: 1
1: 0
2: 2
3: 31
4: 252
923369343_923369351 -1 Left 923369343 1:233295285-233295307 CCATACCCACAGCTCCCCGGGAC 0: 1
1: 0
2: 1
3: 17
4: 189
Right 923369351 1:233295307-233295329 CCGGACCCTCCCCACTCACCAGG 0: 1
1: 0
2: 2
3: 31
4: 252
923369337_923369351 17 Left 923369337 1:233295267-233295289 CCTTTCTCCTTCTTCCCTCCATA 0: 1
1: 1
2: 13
3: 128
4: 1189
Right 923369351 1:233295307-233295329 CCGGACCCTCCCCACTCACCAGG 0: 1
1: 0
2: 2
3: 31
4: 252
923369345_923369351 -6 Left 923369345 1:233295290-233295312 CCCACAGCTCCCCGGGACCGGAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 923369351 1:233295307-233295329 CCGGACCCTCCCCACTCACCAGG 0: 1
1: 0
2: 2
3: 31
4: 252
923369338_923369351 10 Left 923369338 1:233295274-233295296 CCTTCTTCCCTCCATACCCACAG 0: 1
1: 0
2: 4
3: 86
4: 576
Right 923369351 1:233295307-233295329 CCGGACCCTCCCCACTCACCAGG 0: 1
1: 0
2: 2
3: 31
4: 252
923369346_923369351 -7 Left 923369346 1:233295291-233295313 CCACAGCTCCCCGGGACCGGACC 0: 1
1: 0
2: 1
3: 9
4: 175
Right 923369351 1:233295307-233295329 CCGGACCCTCCCCACTCACCAGG 0: 1
1: 0
2: 2
3: 31
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923369351 Original CRISPR CCGGACCCTCCCCACTCACC AGG Exonic
900111211 1:1006342-1006364 CCGGAGCCTCCCCACCCACTCGG - Intergenic
900138489 1:1128881-1128903 CCAGCCCCTCCCCAGTCGCCTGG + Intergenic
900214739 1:1475404-1475426 CCGGCCCCTCCCGACGCTCCTGG + Intronic
900221949 1:1513754-1513776 CCGGCCCCTCCCGACGCTCCTGG + Intronic
900307783 1:2019488-2019510 GCGGACCCCGCCCGCTCACCTGG - Exonic
900350033 1:2229989-2230011 GCGGGCCTTCCCCACACACCAGG - Intronic
901448572 1:9322861-9322883 CCGCACCCACCCCACCCGCCCGG + Intronic
903945621 1:26960390-26960412 CCGCCCCCTCGCCGCTCACCTGG + Exonic
904497118 1:30893279-30893301 CCATACCCACCCCACCCACCAGG + Intronic
908319015 1:62963196-62963218 CAGGCCCCTCACCTCTCACCCGG - Intergenic
909051722 1:70775045-70775067 GAGGACCCTCCCCACTCCCAGGG - Intergenic
912928049 1:113930136-113930158 CCGGAGCCTCCCCACCTTCCTGG - Intronic
913048068 1:115090001-115090023 CCGGCCCCTCCCCCCTCCTCGGG + Intergenic
914461155 1:147886649-147886671 CTGGGCCTTTCCCACTCACCAGG + Intergenic
915304373 1:154969359-154969381 CCACTCCCTCCCCACTAACCTGG + Exonic
915341691 1:155179931-155179953 CCTGTGCCTGCCCACTCACCAGG - Exonic
919803406 1:201366819-201366841 CAGGTGCCTCCCCACTCACCTGG + Exonic
920050983 1:203165123-203165145 CATGCACCTCCCCACTCACCGGG + Intronic
922335684 1:224616703-224616725 CCGGACCCTCCCGCGCCACCGGG - Exonic
922345258 1:224691122-224691144 CCTTACCCTCCCCTCTCTCCAGG + Intronic
922749800 1:228065035-228065057 ACGGCCCCTCCCCTCTCAACCGG + Intergenic
922768052 1:228166195-228166217 CCGGTCCCTGGCCACTCCCCTGG - Intronic
923200183 1:231703865-231703887 CAGGACACACCCCAGTCACCAGG - Intronic
923369351 1:233295307-233295329 CCGGACCCTCCCCACTCACCAGG + Exonic
923474877 1:234322933-234322955 CCAGGCCCTGCCCACTCTCCAGG + Intronic
924660219 1:246008893-246008915 CCGGACTCTCCTGTCTCACCTGG - Intronic
1062796244 10:347062-347084 CCGGAAACCCCACACTCACCCGG + Intronic
1062796253 10:347105-347127 CCGGAAACCCCACACTCACCCGG + Intronic
1062796262 10:347148-347170 CCGGAAACCCCACACTCACCCGG + Intronic
1062796320 10:347469-347491 CCGGAAACCCCACACTCACCCGG + Intronic
1062968997 10:1631400-1631422 CCCGAGCCTGCCCAGTCACCAGG - Intronic
1064430845 10:15268594-15268616 CCAGACCCTCCCCACTGAAATGG - Intronic
1067172935 10:43922600-43922622 GTGGACCCTCCCCACCCAGCTGG + Intergenic
1068883472 10:62075051-62075073 GCGGACCTTCTCCACTGACCTGG - Intronic
1069798430 10:71067909-71067931 CGGGGCCCTCCCCACCTACCAGG - Intergenic
1069948757 10:72005196-72005218 CAGGACAGTCCCCACTTACCTGG + Intronic
1070145897 10:73773038-73773060 CCGGCCCGCCCTCACTCACCGGG - Exonic
1074870808 10:117574519-117574541 CCGGCCCCTTCACAGTCACCCGG - Intergenic
1075106166 10:119541776-119541798 CCGCTCCCTCCTCACTCACCGGG + Intronic
1075401314 10:122163435-122163457 CCGGCCCCTCCCGCCTCGCCGGG - Intronic
1077308000 11:1876474-1876496 CCAGAGCCTCCTCACTCCCCAGG + Intronic
1080919726 11:36696845-36696867 CCTGAGCCTCCCCAGTCATCTGG - Intergenic
1081621255 11:44620241-44620263 CCTCACCCACCCCACTCCCCAGG - Exonic
1082171813 11:49013924-49013946 ATGGACCCTCCCTCCTCACCTGG + Intergenic
1082175760 11:49057129-49057151 ATGGACCCTCCCTCCTCACCTGG + Exonic
1083173708 11:60936903-60936925 CCTGACCCTCCACAGCCACCTGG + Exonic
1083625607 11:64070572-64070594 CCTCACCCTCCCCTCTCCCCCGG + Intronic
1084448529 11:69218409-69218431 CCTGAGCCTCCCCATTCTCCTGG - Intergenic
1084686269 11:70697774-70697796 CCGGACCCTCCCACCTCTGCAGG + Intronic
1084958062 11:72702040-72702062 CCTGCCCCACCCCACTCTCCAGG + Intronic
1086321400 11:85651485-85651507 CCCTACCATCTCCACTCACCAGG - Intronic
1086689983 11:89778940-89778962 ATGGACCCTCCCTCCTCACCTGG - Intergenic
1086698678 11:89874030-89874052 ATGGACCCTCCCTCCTCACCTGG + Exonic
1086707492 11:89970471-89970493 ATGGACCCTCCCTCCTCACCTGG - Exonic
1086715871 11:90061015-90061037 ATGGACCCTCCCTCCTCACCTGG + Intergenic
1089627535 11:119761247-119761269 CCAGCCCGACCCCACTCACCTGG - Intergenic
1089693317 11:120200001-120200023 CCGCTCCCTCCCCCCTCACAGGG + Intergenic
1091498384 12:991523-991545 CCCGCCCCTCCCCACCCCCCGGG - Intronic
1091834980 12:3579364-3579386 CCTGGCCCTCTCCACTCCCCAGG + Intronic
1091879848 12:3968186-3968208 CTGGAAGCTGCCCACTCACCTGG - Intergenic
1092173049 12:6385144-6385166 CAGGCACATCCCCACTCACCTGG - Exonic
1094407586 12:30134539-30134561 CTGTCCCCTCCCCACTCAGCTGG + Intergenic
1096974891 12:55694330-55694352 CTTGCCCCTGCCCACTCACCAGG - Exonic
1097182064 12:57177405-57177427 CTGACCCCTCCCCACTCCCCAGG + Exonic
1097223513 12:57463748-57463770 CCGGCCCCTCCCCAGTCAGGGGG + Exonic
1097313109 12:58142703-58142725 CAGGAGCCTGCCCACTAACCTGG + Intergenic
1097683943 12:62674862-62674884 CCTCACCCTCCCCACTCCCCAGG - Intronic
1101324534 12:103703528-103703550 CCCCACCATCCCCACACACCTGG - Intronic
1101363490 12:104049894-104049916 CCCTACCCTCACCATTCACCAGG - Exonic
1101407378 12:104440707-104440729 CTCTACCCTCCCCACTCAGCAGG - Intergenic
1102453113 12:113056116-113056138 CTGGTCCCACCCCTCTCACCTGG + Intergenic
1103308890 12:119989206-119989228 CCGGCTCCTCCCGGCTCACCGGG - Intergenic
1103402472 12:120652683-120652705 CAGTCCCCTCCCCGCTCACCAGG + Intronic
1103994009 12:124817515-124817537 CCGGCCCCTCCACCCTCACCTGG + Intronic
1104042446 12:125139314-125139336 CCAGAGCCTCCCCAGTCCCCCGG - Intronic
1104766314 12:131332699-131332721 CCGGCTCCTCCCCTCTCCCCAGG - Intergenic
1106182461 13:27381046-27381068 GAGGACCCTCCCCAGGCACCTGG - Intergenic
1113838360 13:113344354-113344376 CCGGACCCTGGCCACTCACATGG + Intronic
1113933775 13:113982425-113982447 CCGGACCCCACCTACGCACCGGG + Intronic
1118749618 14:68796135-68796157 CCGGGCCCTCCCCATTCGCCTGG + Intronic
1122032104 14:98919698-98919720 CCTGCCCCTCCCCACTCCGCAGG - Intergenic
1122275003 14:100586867-100586889 CCGCACCCTCGCCACCCGCCCGG + Intronic
1122660176 14:103289899-103289921 CCGGCCCCACCCCACTCTGCGGG + Intergenic
1123115216 14:105891407-105891429 CTGGGCCCACCCCACACACCGGG - Intergenic
1123117392 14:105900848-105900870 CTGGGCCCACCCCACACACCGGG - Intergenic
1123119480 14:105910116-105910138 CTGGGCCCACCCCACACACCGGG - Intergenic
1123121693 14:105919712-105919734 CTGGGCCCACCCCACACACCGGG - Intronic
1123418238 15:20108035-20108057 CAGGACCCTCCCCATTCTCCTGG - Intergenic
1123527456 15:21114557-21114579 CAGGACCCTCCCCATTCTCCTGG - Intergenic
1124210369 15:27758384-27758406 CCAGAACTTCCACACTCACCAGG + Intronic
1125486700 15:40116164-40116186 CCGGACCCCCCTCACCCACCCGG - Intergenic
1125766982 15:42142534-42142556 CCGTACCTTCCGCACACACCTGG - Exonic
1127784465 15:62343487-62343509 CCGGCCCTTCCACACACACCCGG + Intergenic
1128514852 15:68335714-68335736 CCGGAGCCTCACCATCCACCAGG - Exonic
1128649476 15:69400152-69400174 CAGGACCCTCCCCAGTCAGGAGG - Intronic
1132567857 16:631421-631443 CCGGCCCGACCACACTCACCTGG - Exonic
1132576253 16:665798-665820 CCGGGCACTCCCCACACACCTGG - Exonic
1132671905 16:1105538-1105560 CTGGAGCTTCCCCACTGACCTGG - Intergenic
1132711845 16:1272341-1272363 CAGGTCCCTCCCACCTCACCCGG - Intergenic
1132844124 16:1992248-1992270 CCGCCCCCTCCCCGCCCACCCGG - Intronic
1132844165 16:1992360-1992382 CCGCCCCCTCCCCGCCCACCCGG - Intronic
1133006270 16:2883379-2883401 CAGGACCCTCCCCGCCCGCCAGG - Intronic
1133015425 16:2937381-2937403 CAGCACCCTCCACACGCACCTGG - Exonic
1133239893 16:4408057-4408079 CCAGCCCCACCCCACTCCCCAGG - Intronic
1133840942 16:9408700-9408722 ACTGACCTGCCCCACTCACCTGG + Intergenic
1134096872 16:11424090-11424112 CAGCCCCCTCCTCACTCACCTGG + Exonic
1136037253 16:27549725-27549747 GCGGGCCCTCGCCACGCACCCGG - Exonic
1137346475 16:47666496-47666518 CCAGCTCCTCCCCATTCACCAGG + Intronic
1137359775 16:47803365-47803387 CCATGCCCTGCCCACTCACCTGG - Intergenic
1137435785 16:48453426-48453448 CAGCACCCTCCCTACTCCCCAGG + Intergenic
1137677216 16:50309643-50309665 CCGGGCCCGGCGCACTCACCGGG - Exonic
1139599219 16:67976557-67976579 CCTGACACTCCCCACTCTCAGGG - Intronic
1141912233 16:87067908-87067930 CCGGACCCTCCTCCCTGGCCCGG - Intergenic
1142073271 16:88103136-88103158 CTGGCCCCTCCCCCCTCCCCTGG + Intronic
1142169172 16:88611558-88611580 CCGGACCTCCCCCACACCCCTGG - Intronic
1142350502 16:89577188-89577210 ACGCCCCCTCCCCACTCAGCTGG + Intronic
1142371700 16:89686360-89686382 GAGGACCCTCCCCCCCCACCTGG + Intronic
1142590599 17:1003939-1003961 CCTGACCCTCCCCACTCTGGGGG + Exonic
1142643082 17:1295795-1295817 CCAGCCCATCCCCACTCATCTGG - Intronic
1143368530 17:6424000-6424022 CCTGCCCCACCCCACACACCTGG + Exonic
1143411737 17:6713412-6713434 CCGCCCCCTCCCCAATCCCCGGG - Exonic
1143554837 17:7653499-7653521 GGGGAGCCTCCACACTCACCCGG - Exonic
1143658854 17:8312637-8312659 CCCCACCCGCCACACTCACCTGG - Exonic
1144636309 17:16911329-16911351 CTGGACCCCAGCCACTCACCTGG + Intergenic
1144834971 17:18151948-18151970 CCCCACCTTCCCCCCTCACCTGG - Exonic
1144849682 17:18237770-18237792 CCGGCCCCACCCCACACACCTGG - Exonic
1147258212 17:39194660-39194682 CCGGCCCCTCCCCCAGCACCAGG - Intronic
1147376735 17:40027057-40027079 CCGCGCCCTCCCCACTCGGCTGG - Intronic
1147471511 17:40666440-40666462 CTGGAACCTCTCCTCTCACCAGG - Intergenic
1147529793 17:41265021-41265043 CCTGAGCCTCCCCAGTCACCAGG + Intergenic
1147550536 17:41438678-41438700 CTATACCCCCCCCACTCACCTGG + Exonic
1147946775 17:44084828-44084850 CCGGATCCCCCCCACTCAGCTGG + Intronic
1148673675 17:49432300-49432322 CCGTGCCTTCCCCACACACCAGG + Intronic
1149638272 17:58187010-58187032 CCTGCCCCACCCCACCCACCTGG + Intergenic
1150790279 17:68197025-68197047 CCGGGCCCGCCTCCCTCACCAGG - Intergenic
1150830278 17:68512545-68512567 CCCGGCCGACCCCACTCACCTGG - Exonic
1151788393 17:76287905-76287927 CCTGACCCTCCTCATTCACTGGG - Intronic
1152530981 17:80918972-80918994 CCCGAGCCTTCCCACACACCCGG + Intronic
1152563494 17:81090061-81090083 GCTGCTCCTCCCCACTCACCAGG + Intronic
1152596203 17:81238967-81238989 GCGGACCGCCCTCACTCACCCGG + Exonic
1152900358 17:82937602-82937624 CCGGAGCCTCCCCTCCCGCCAGG - Intronic
1153219425 18:2848125-2848147 GCGCATCCTCCCCACTCACTCGG - Intronic
1157248333 18:46072388-46072410 CGGGACCCTCGGCGCTCACCCGG + Intergenic
1157403565 18:47405627-47405649 CCTGACCCTCCCCACGCACCTGG - Intergenic
1160630950 18:80246558-80246580 CCAGACCCAGCCCACTCCCCCGG - Intronic
1160677529 19:399401-399423 CCCCACCCTCCCCTCCCACCTGG - Intergenic
1160824572 19:1073743-1073765 CCTGGCCCACCCCACTCACCTGG - Exonic
1160863789 19:1248657-1248679 CCCCCCCCTCCACACTCACCGGG - Exonic
1161583548 19:5093290-5093312 TCGGAGCCTCCCCAGGCACCTGG + Intronic
1161593905 19:5141688-5141710 CCGGAGCCCCCTGACTCACCAGG - Intronic
1162386163 19:10361751-10361773 CCTGGCCCTGCCCACTCACCAGG + Exonic
1162575196 19:11495207-11495229 CAGCCCCCTCACCACTCACCGGG + Intronic
1162755403 19:12855507-12855529 CAGGACCACCCCCACTCAGCTGG - Intronic
1163717070 19:18878911-18878933 CGGGCCCCTCCACACTCACTCGG + Exonic
1164061389 19:21678309-21678331 CCAGCCCCTCCTCACTCCCCTGG - Intergenic
1166827355 19:45617678-45617700 CAGGACCCTGCCCGCTCAGCCGG - Exonic
1166895253 19:46018534-46018556 CCTGACCCTGCCCTCTCCCCAGG + Exonic
1166926401 19:46271771-46271793 CAGGTCCCTCCCTCCTCACCTGG + Intergenic
1167290804 19:48624423-48624445 CCGCACCCTCCTCACACGCCGGG - Intronic
1167848881 19:52187059-52187081 CAGGAGCCACCCCACTCATCGGG - Intergenic
1167959572 19:53095164-53095186 CCGCCCCCTCCCCACTGCCCAGG + Intronic
1168658840 19:58150547-58150569 ACGGAGCGTCCCCACCCACCAGG + Intronic
925427766 2:3764779-3764801 CCTGAGTCTCCCCTCTCACCTGG - Intronic
925984747 2:9206758-9206780 CCGGACCCGCCCCTCTCCGCGGG + Exonic
927706258 2:25298277-25298299 CCGGCCCCTCTCCCCTCACTCGG + Intronic
928314970 2:30237918-30237940 GGAGACCCTCCCCACTCAGCTGG - Intronic
929235911 2:39605446-39605468 TCACACACTCCCCACTCACCAGG + Intergenic
931705985 2:64946524-64946546 CTGGACCCTCCCCATTTGCCAGG - Intergenic
934585148 2:95485787-95485809 ATGGACCCTCCCTCCTCACCTGG - Intergenic
934587584 2:95516739-95516761 ATGGACCCTCCCTCCTCACCTGG - Intergenic
934594314 2:95590946-95590968 ATGGACCCTCCCTCCTCACCTGG + Intergenic
934788462 2:97034688-97034710 ATGGACCCTCCCTCCTCACCTGG - Intergenic
935095756 2:99942817-99942839 CCCCACCCTCTCCACCCACCTGG + Intronic
938201555 2:129376809-129376831 CCGGAAGCTCCCCTCACACCTGG + Intergenic
938343516 2:130550327-130550349 CAGGTCCCTCCACACTCAACAGG + Intergenic
938346317 2:130570395-130570417 CAGGTCCCTCCACACTCAACAGG - Intergenic
942403640 2:175629934-175629956 CTGGCCCCTCCGCACTCATCAGG - Intergenic
943829788 2:192446057-192446079 CAGGACCCTCCCTATACACCTGG - Intergenic
944142562 2:196472900-196472922 CCGGAGCCACCGCACTCAGCTGG + Intronic
944734064 2:202545210-202545232 CCCTCCCCTCCCCACACACCTGG + Intronic
947145406 2:227059536-227059558 CCAGGCCCTCCCGGCTCACCAGG - Exonic
947743633 2:232496652-232496674 CCTGGCTCTCCCCACTCATCTGG + Intergenic
948137386 2:235646789-235646811 CCGGCCCCTCCACACTGGCCAGG - Intronic
948622719 2:239246495-239246517 CCGGCCCCCGCCCACACACCTGG - Intronic
948946444 2:241222922-241222944 CTGGACCCTCCCCACCCCCCAGG - Intronic
1168805870 20:672015-672037 CCAGGCCCTCCCCACAGACCGGG - Intronic
1169119217 20:3085145-3085167 GCTAACCCTCCCCACACACCTGG - Intergenic
1171365118 20:24617927-24617949 CCAGGCTCTCCCCACTCCCCGGG - Intronic
1171365153 20:24618026-24618048 CCGGGCTCTCCCCACTCCCCGGG - Intronic
1171365180 20:24618096-24618118 CCGGGCTTTCCCCACTCCCCGGG - Intronic
1175945795 20:62558115-62558137 ACCGCCCCTCCCCACTCAGCAGG - Intronic
1176180558 20:63747527-63747549 CCGCACCCCCCCCACCCACCAGG - Intronic
1176380874 21:6111530-6111552 GCGGACCCGCCCCCCACACCCGG - Intronic
1176410646 21:6447866-6447888 CTGGAGCCTGCCCACCCACCAGG - Intergenic
1179686140 21:43056188-43056210 CTGGAGCCTGCCCACCCACCAGG - Intronic
1179742598 21:43426710-43426732 GCGGACCCGCCCCCCACACCCGG + Intronic
1179999022 21:44986814-44986836 CCCAACCCTCCCCATGCACCAGG - Intergenic
1180187596 21:46147135-46147157 CCAGACCTCCCCCACTCATCAGG - Intronic
1180816491 22:18792758-18792780 CCGTGCCCTCCCCACACACAGGG + Intergenic
1181202678 22:21227090-21227112 CCGTGCCCTCCCCACACACAGGG + Intronic
1181350352 22:22250754-22250776 CTGGACCCTCCCCATGCTCCTGG - Intergenic
1181397242 22:22631067-22631089 CAAGCCCCTCCCCACTCACTTGG - Intergenic
1181499988 22:23310430-23310452 CAAGCCCCTCCCCACTCACTTGG - Exonic
1181705211 22:24645742-24645764 CAAGCCCCTCCCCACTCACTTGG - Intergenic
1182107329 22:27698690-27698712 CCTGACCCTCTCCACACAGCAGG - Intergenic
1182414207 22:30210553-30210575 CCAGAGCCTCCTTACTCACCGGG + Intergenic
1184818531 22:46890995-46891017 GCAGGCCCTCCCCACTCACCTGG - Intronic
1203224235 22_KI270731v1_random:68323-68345 CCGTGCCCTCCCCACACACAGGG - Intergenic
1203266591 22_KI270734v1_random:18469-18491 CCGTGCCCTCCCCACACACAGGG + Intergenic
950621961 3:14212951-14212973 CCTGACCCTCCACTCTCTCCCGG - Intergenic
953631896 3:44625140-44625162 CCGAGCCCACCCCGCTCACCGGG - Intronic
960184668 3:114624097-114624119 CTGGAACCTCACCACTCACCAGG + Intronic
961444399 3:126972439-126972461 GTGGCCCCTCCCCACCCACCCGG + Intergenic
961453502 3:127013254-127013276 CCCCACCCTCCCTTCTCACCAGG + Intronic
961476712 3:127151191-127151213 CAGGCCCCTCCCCACTCCCTGGG + Intergenic
961866598 3:129957750-129957772 CTGGTCCATCCTCACTCACCTGG - Intergenic
966592073 3:181695165-181695187 CCGAACCCTCCCCGCTCTCCAGG + Intergenic
968750180 4:2384789-2384811 CAGGAGCCACCTCACTCACCTGG + Intronic
969263594 4:6049588-6049610 CCGTCCCCTCCTCACTCAACAGG + Intronic
969714169 4:8860543-8860565 CCCTTCCCTCCCCACTCCCCAGG - Intronic
971143065 4:23946003-23946025 CCGGACCCTCCCTCCTCCCCAGG + Intergenic
973955039 4:56055198-56055220 CTGGCCTCACCCCACTCACCTGG + Intergenic
975613007 4:76219783-76219805 CCCGCCCCTCACCACTAACCTGG + Intronic
978166641 4:105616580-105616602 CAGGCCCCTCCCCCATCACCTGG + Intronic
982344091 4:154337242-154337264 CCCAAACATCCCCACTCACCAGG + Intronic
985191907 4:187383224-187383246 ACAGACCCTCCTCACTCTCCTGG - Intergenic
985212212 4:187607235-187607257 CCACTCCCTCCCCACTCCCCTGG + Intergenic
985530897 5:433368-433390 CAGGCCCCTCCCCACTCTCCAGG + Intronic
985973060 5:3392598-3392620 CCCCAGCCTCCCCAGTCACCTGG - Intergenic
986077470 5:4352846-4352868 CAGGTCCCTCCCCACACACATGG + Intergenic
986204069 5:5606862-5606884 CCTCAGCCTCCCCACTCACTAGG - Intergenic
986291228 5:6400668-6400690 CCTGACACTCCCCACTTTCCTGG - Intergenic
997521499 5:134526755-134526777 CCGCACCCTCCACACTCACCTGG - Intronic
999176153 5:149633007-149633029 CCCTAACCTCCCCACCCACCAGG - Exonic
999610560 5:153364746-153364768 CCTGACCCTCCCTAAGCACCAGG + Intergenic
1002050716 5:176569007-176569029 CCTGCACCTCCCAACTCACCTGG - Exonic
1003183060 6:3808264-3808286 CCTCCCCCTCCCCACCCACCTGG - Intergenic
1005425822 6:25701605-25701627 CCTGTCCTTCCCCAGTCACCAGG + Exonic
1005923214 6:30418526-30418548 CCAGACCCTCAGCACCCACCCGG - Intergenic
1007090337 6:39180426-39180448 CCCTCCCCTCCCCTCTCACCGGG + Intergenic
1007236133 6:40392413-40392435 CCGCAGCCTCCCCACTGCCCAGG + Exonic
1016390567 6:143570609-143570631 CAGGCCCCTCCCCACTCTCCTGG + Intronic
1018950591 6:168376288-168376310 CTGGGCCTCCCCCACTCACCTGG + Intergenic
1019190656 6:170248971-170248993 CCGGACCCCCCCCACTCCGCGGG - Intergenic
1019537725 7:1537802-1537824 CAGGACCCTCCCCACACCCTGGG - Intronic
1019635239 7:2071896-2071918 CCGTGCCCTCCCCACCCTCCAGG - Intronic
1020261292 7:6531961-6531983 TCGCTCCCTCCCCACTCACCTGG - Intronic
1021852076 7:24818028-24818050 CCAGACCCACCTCTCTCACCTGG - Intronic
1023818616 7:43968293-43968315 CCTGGCCCTCCCCTCTCTCCAGG - Intergenic
1024034384 7:45495180-45495202 TAGGCCCATCCCCACTCACCGGG - Intergenic
1024233974 7:47384208-47384230 CAGGCCCCTCCCCACCCACATGG + Intronic
1024838646 7:53556501-53556523 CCTGCACCTCCCCACTCTCCAGG - Intergenic
1025208998 7:57009902-57009924 CCGGCCCCTCCCCACCCAGGAGG + Intergenic
1025662951 7:63566954-63566976 CCGGCCCCTCCCCACCCAGGAGG - Intergenic
1029152278 7:98489463-98489485 CAGGACCCTACCCTCTCCCCTGG - Intergenic
1029496079 7:100895969-100895991 CCCGCCCCTCCCCGCTCTCCCGG + Intronic
1029743665 7:102505258-102505280 CCTGGCCCTCCCCTCTCTCCAGG - Intronic
1029761651 7:102604421-102604443 CCTGGCCCTCCCCTCTCTCCAGG - Intronic
1031639583 7:124145255-124145277 CCTGCTCCTCCCCACACACCAGG - Intergenic
1033477066 7:141701845-141701867 CCCGACCCTCCCCACGCGCCTGG + Intronic
1035073619 7:156162602-156162624 CCGGCCCATGGCCACTCACCTGG + Intergenic
1035575126 8:699510-699532 CCAGACCCTCCCCACCCCTCAGG + Intronic
1035988780 8:4464761-4464783 CCAGCCCCACCCCACTCAGCAGG - Intronic
1039223244 8:35358479-35358501 CCTGACCCTCACCACTAAACAGG - Intronic
1046731334 8:117729650-117729672 CCGGAGACTTGCCACTCACCTGG - Intergenic
1049003696 8:139841737-139841759 CTGGGCCCTGCCCACTCACGAGG + Intronic
1049239170 8:141528202-141528224 CCAGATCCTCCCCACACTCCAGG + Intergenic
1049731645 8:144181294-144181316 CCGGCCCCTCCCCCATCACCGGG - Intronic
1051929024 9:22363567-22363589 CCCGAGCCTCCCCGCTCCCCGGG - Intergenic
1055414964 9:76071849-76071871 ACGGACCAGCCCCCCTCACCCGG + Exonic
1055636251 9:78282069-78282091 CCTGAGCCTTCCCCCTCACCTGG - Intergenic
1059349905 9:113657064-113657086 GCTGCCCCTCCCCTCTCACCTGG - Intergenic
1059398933 9:114056673-114056695 CTGGCCCATCTCCACTCACCTGG - Intergenic
1061295120 9:129672673-129672695 CCGGGCAGTCCCCACTCTCCAGG - Intronic
1062418153 9:136464077-136464099 CCCCACCCGCCCCCCTCACCTGG + Intronic
1062424972 9:136501982-136502004 CGGGAGCCTCGCGACTCACCCGG + Exonic
1062485805 9:136774963-136774985 CCTGACCCGCTCCCCTCACCTGG + Intergenic
1062501505 9:136853904-136853926 CCAGACCCTCCCAGCTCACTCGG - Exonic
1062533104 9:137010377-137010399 CAGGAGCCTGCCCACTCAGCGGG + Intronic
1189233445 X:39469991-39470013 CCTGACCTCCACCACTCACCTGG + Intergenic
1190492011 X:50991852-50991874 TGGCACCCTCTCCACTCACCAGG - Intergenic
1190501151 X:51079828-51079850 TGGCACCCTCTCCACTCACCAGG + Intergenic
1192261151 X:69506401-69506423 GCGGCCCCTCCCCACTCATGAGG - Intronic
1198404091 X:136295483-136295505 GCTGACCCTCCCCACCCATCTGG + Intergenic
1199948074 X:152683098-152683120 CAGGACCCTGCCCACCCACCAGG - Intergenic
1199961605 X:152785356-152785378 CAGGACCCTGCCCACCCACCAGG + Intergenic