ID: 923369354

View in Genome Browser
Species Human (GRCh38)
Location 1:233295313-233295335
Sequence CCTCCCCACTCACCAGGTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 1, 2: 3, 3: 28, 4: 347}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923369348_923369354 -10 Left 923369348 1:233295300-233295322 CCCGGGACCGGACCCTCCCCACT 0: 1
1: 0
2: 0
3: 8
4: 201
Right 923369354 1:233295313-233295335 CCTCCCCACTCACCAGGTGCAGG 0: 1
1: 1
2: 3
3: 28
4: 347
923369346_923369354 -1 Left 923369346 1:233295291-233295313 CCACAGCTCCCCGGGACCGGACC 0: 1
1: 0
2: 1
3: 9
4: 175
Right 923369354 1:233295313-233295335 CCTCCCCACTCACCAGGTGCAGG 0: 1
1: 1
2: 3
3: 28
4: 347
923369347_923369354 -9 Left 923369347 1:233295299-233295321 CCCCGGGACCGGACCCTCCCCAC 0: 1
1: 0
2: 1
3: 11
4: 195
Right 923369354 1:233295313-233295335 CCTCCCCACTCACCAGGTGCAGG 0: 1
1: 1
2: 3
3: 28
4: 347
923369345_923369354 0 Left 923369345 1:233295290-233295312 CCCACAGCTCCCCGGGACCGGAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 923369354 1:233295313-233295335 CCTCCCCACTCACCAGGTGCAGG 0: 1
1: 1
2: 3
3: 28
4: 347
923369343_923369354 5 Left 923369343 1:233295285-233295307 CCATACCCACAGCTCCCCGGGAC 0: 1
1: 0
2: 1
3: 17
4: 189
Right 923369354 1:233295313-233295335 CCTCCCCACTCACCAGGTGCAGG 0: 1
1: 1
2: 3
3: 28
4: 347
923369339_923369354 9 Left 923369339 1:233295281-233295303 CCCTCCATACCCACAGCTCCCCG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 923369354 1:233295313-233295335 CCTCCCCACTCACCAGGTGCAGG 0: 1
1: 1
2: 3
3: 28
4: 347
923369338_923369354 16 Left 923369338 1:233295274-233295296 CCTTCTTCCCTCCATACCCACAG 0: 1
1: 0
2: 4
3: 86
4: 576
Right 923369354 1:233295313-233295335 CCTCCCCACTCACCAGGTGCAGG 0: 1
1: 1
2: 3
3: 28
4: 347
923369340_923369354 8 Left 923369340 1:233295282-233295304 CCTCCATACCCACAGCTCCCCGG 0: 1
1: 0
2: 0
3: 27
4: 269
Right 923369354 1:233295313-233295335 CCTCCCCACTCACCAGGTGCAGG 0: 1
1: 1
2: 3
3: 28
4: 347
923369337_923369354 23 Left 923369337 1:233295267-233295289 CCTTTCTCCTTCTTCCCTCCATA 0: 1
1: 1
2: 13
3: 128
4: 1189
Right 923369354 1:233295313-233295335 CCTCCCCACTCACCAGGTGCAGG 0: 1
1: 1
2: 3
3: 28
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923369354 Original CRISPR CCTCCCCACTCACCAGGTGC AGG Exonic
900378484 1:2372075-2372097 CTTCCCCACTCATCCGCTGCTGG - Intronic
900396116 1:2453895-2453917 CCACCCCACTCGGCAGGCGCAGG - Intronic
900611702 1:3547019-3547041 CCCCCCCAGCCACCAGCTGCAGG - Intronic
900654127 1:3746846-3746868 GCTCCCCGCTCCCCAGGTGTGGG - Intergenic
901536049 1:9883576-9883598 CCATGCCACACACCAGGTGCTGG - Intronic
901832760 1:11903372-11903394 CCTCCCAACTCCCAAAGTGCTGG - Intergenic
902520344 1:17012028-17012050 CCTCCGCACACACCGGGGGCGGG + Intergenic
903681942 1:25103170-25103192 CATCCCCACTCCCCAAGGGCAGG + Intergenic
904003096 1:27349666-27349688 CCTCCCCATTCTCCAGGATCTGG - Exonic
904851087 1:33460363-33460385 CATCCCCATCCACCAGGAGCAGG + Intergenic
905478394 1:38244896-38244918 GCTCCCCCCTGCCCAGGTGCAGG - Intergenic
906254772 1:44339854-44339876 CCTCCCCTCTCCCAAGGTGAAGG + Intronic
907433687 1:54430292-54430314 TCTCCACACTCAGGAGGTGCTGG - Intergenic
909079193 1:71088803-71088825 CTTACCCACTCAACAGGTACAGG + Intergenic
910963677 1:92786583-92786605 CACCCCCACTCCCCAGGTGAAGG - Intronic
913994987 1:143644237-143644259 CACCCCCACTCCCCAGGTGAAGG - Intergenic
914361174 1:146937784-146937806 CACCCCCACTCCCCAGGTGAAGG + Intergenic
914491413 1:148152839-148152861 CACCCCCACTCCCCAGGTGAAGG - Intergenic
915123940 1:153650167-153650189 CCTCCCCACTCACCCATGGCAGG - Intergenic
915341689 1:155179925-155179947 CCTGCCCACTCACCAGGTGCCGG - Exonic
915456158 1:156042140-156042162 GCTCCTCACTCACCTGCTGCAGG + Exonic
915572104 1:156750449-156750471 CCTCCCACCTGGCCAGGTGCTGG + Intronic
920003763 1:202817641-202817663 CCTCCCCACTCTCCAGCCTCAGG - Intergenic
920006425 1:202836693-202836715 CCTCCCCACCTACCTGGGGCAGG - Intergenic
920050985 1:203165129-203165151 CCTCCCCACTCACCGGGCCCTGG + Intronic
920533665 1:206723291-206723313 GCTCCCCACTCCCCATGTGTTGG - Intronic
920660475 1:207910646-207910668 CCTCCCCAGTCTCCCGGTTCTGG + Intronic
922886202 1:229022834-229022856 CCTCCCCATGCACCAGGCTCTGG - Intergenic
923369354 1:233295313-233295335 CCTCCCCACTCACCAGGTGCAGG + Exonic
923469833 1:234280678-234280700 TCTCAGCACTCACCACGTGCTGG + Intronic
1062793740 10:326438-326460 GCTTCCCTCTCAGCAGGTGCTGG - Intronic
1062856767 10:783774-783796 TCACCCCCGTCACCAGGTGCTGG - Intergenic
1062856790 10:783835-783857 TCACCCCCGTCACCAGGTGCTGG - Intergenic
1062968993 10:1631394-1631416 CCTGCCCAGTCACCAGGAACGGG - Intronic
1063373868 10:5540158-5540180 CCTCCCCCGTCACCAGTAGCTGG + Intergenic
1063604732 10:7512732-7512754 ACTCCCCACTCACCTCCTGCTGG + Intergenic
1063916710 10:10890362-10890384 CCCCGCCCCTCACCAGCTGCTGG + Intergenic
1064445124 10:15386229-15386251 CTTCCCCTCCCACCAGGTGGGGG - Intergenic
1065464939 10:26009541-26009563 TCTCCCTACTCCTCAGGTGCGGG + Intronic
1067346300 10:45441328-45441350 CCTCTCCCCTCCCCAGCTGCTGG + Exonic
1067568842 10:47357199-47357221 CCTCCCCAATGACCAGGGCCCGG - Exonic
1068335753 10:55630807-55630829 CCTCTCCACCCACCATGTGAAGG - Intergenic
1070551859 10:77496214-77496236 TCACCCTCCTCACCAGGTGCGGG + Intronic
1070755296 10:78988242-78988264 CCTCACCACTTACCAGCTGTGGG + Intergenic
1072031811 10:91528825-91528847 CCTTCCAGCTCACCTGGTGCTGG - Intergenic
1074695914 10:116050094-116050116 CCTCCCCAGTCACCAGCTTCAGG - Intergenic
1075076823 10:119357519-119357541 CCACTCCACTCCCCAGGAGCAGG - Intronic
1075534243 10:123256763-123256785 TCCCCCTACTCCCCAGGTGCCGG + Intergenic
1076691188 10:132224618-132224640 CCTCCCCCCACCCCAAGTGCAGG + Intronic
1076696567 10:132250059-132250081 CCACCACAGTCACCAGGAGCCGG + Intronic
1076874886 10:133211109-133211131 CCTCTCCTGACACCAGGTGCTGG - Intronic
1077328496 11:1973837-1973859 CCTCCCACCCCACCAGCTGCAGG - Intronic
1077384599 11:2263038-2263060 CCTACCCCCTCCCCAGCTGCTGG - Intergenic
1077507120 11:2934923-2934945 CATCCCCACAAGCCAGGTGCAGG - Intergenic
1077542079 11:3151515-3151537 CTTCCCCACTCCCCATGTGCTGG + Intronic
1078404222 11:11055243-11055265 GCTCCCCACTCAACATTTGCTGG + Intergenic
1079242379 11:18729713-18729735 CCACCTCCCGCACCAGGTGCAGG + Exonic
1080776816 11:35394155-35394177 CCTACCCACCCACCAGCTACAGG + Intronic
1083587897 11:63873614-63873636 CCTCCCCATTCAGCAGGGTCGGG - Intronic
1083691147 11:64409654-64409676 CTTCCCCACTCACAAAGTCCTGG - Intergenic
1083877436 11:65531724-65531746 CCTCCCCAGCCACCAGGTTGGGG - Intronic
1083881561 11:65551459-65551481 TCTCCTCACTCACCGGCTGCGGG + Exonic
1084150479 11:67285800-67285822 CATCCCCCCTCACCAGGGGCAGG + Exonic
1084594686 11:70109861-70109883 TCTGCCCCGTCACCAGGTGCAGG - Intronic
1085040913 11:73325823-73325845 TCTCCCCACTCACCAGGCTCTGG - Intronic
1085787169 11:79463573-79463595 CCTCCCCACCCACTTGCTGCAGG + Intergenic
1088487611 11:110355876-110355898 CCTCCCTACTCCCCAGTAGCTGG + Intergenic
1089373801 11:117979972-117979994 CTTCCCTACTCACCAGTTGAGGG + Intergenic
1089437417 11:118482083-118482105 CCTCCTCACTCACCTGATTCTGG - Exonic
1089641527 11:119850879-119850901 CCTTCCCAATCACCTGGTGATGG - Intergenic
1089864484 11:121619908-121619930 CCAACCCACTCACCAAGTCCTGG - Exonic
1090004155 11:122984997-122985019 CCACCCCACCCACCAGCCGCGGG + Intergenic
1202811474 11_KI270721v1_random:29016-29038 CCTCCCACCCCACCAGCTGCAGG - Intergenic
1091463428 12:663378-663400 CCTTCACACGCACCGGGTGCCGG + Exonic
1092172445 12:6382624-6382646 TCTCTCCCCTCACCTGGTGCAGG - Intronic
1092284122 12:7119105-7119127 ACTCCCCAGCCACCAGCTGCAGG - Intergenic
1094844786 12:34356654-34356676 CCTCCCCACTGCGCATGTGCGGG - Intergenic
1094845729 12:34360612-34360634 CCTCCCCACTGCTCAGGCGCTGG - Intergenic
1094855519 12:34401164-34401186 CCTCCCCACTGGGCAGGCGCGGG + Intergenic
1096791833 12:54050155-54050177 CCTCCCCAGTAACAAGCTGCCGG - Intronic
1096865676 12:54561364-54561386 CCTCCCCTCTCACCCAGTTCCGG + Intronic
1097441938 12:59619611-59619633 CCTACCCACAGACCAGGTGAAGG + Intronic
1101549646 12:105750171-105750193 CTTCCCGAGTCACCAGGTGATGG + Intergenic
1101771602 12:107756819-107756841 CCTTACCACTCACCTGGGGCAGG + Exonic
1101844073 12:108347396-108347418 CTTCCCCACACCCCAGGTGGTGG - Intergenic
1102013167 12:109631439-109631461 CCTCCCCCATCCCCAGGCGCTGG + Intergenic
1102076720 12:110065847-110065869 CCTCCTCTCTTACCAGGTTCTGG + Exonic
1102390487 12:112545377-112545399 CCTCCCAAGTCACCACATGCTGG - Intergenic
1102453116 12:113056122-113056144 CCACCCCTCTCACCTGGAGCAGG + Intergenic
1102482484 12:113233283-113233305 CCTCCCCACTCGCCTGGGGGAGG + Intronic
1103465690 12:121140257-121140279 CCTCCTCTCTCCCCAGGTTCTGG - Intronic
1103601473 12:122057299-122057321 CTTCCTCACCCACCAGGTTCTGG - Intronic
1103623113 12:122200799-122200821 CCCCCCCATCCTCCAGGTGCTGG + Exonic
1103748042 12:123139759-123139781 CCTCCCTTCTCTCCAGGTGGTGG - Intronic
1104098490 12:125583610-125583632 TCTTCCCAGTCCCCAGGTGCAGG - Intronic
1104753491 12:131254594-131254616 CTCCCCCACTCACCAGGTGCAGG + Intergenic
1104810638 12:131618129-131618151 CCTCTCCACTCCCCAGGGGCTGG - Intergenic
1107542888 13:41409706-41409728 TCTCCCCACTCACACGATGCTGG + Intergenic
1108349996 13:49583060-49583082 CCTCCCCACTCCCAAGTAGCTGG - Intronic
1108592903 13:51926455-51926477 CCTCCCCACTGCCGAGGTGAGGG + Intergenic
1110174219 13:72536838-72536860 CCTCCCCGCTCACAAGCTGCAGG - Intergenic
1112227102 13:97550583-97550605 GCTCCCCACTCACCTGATGGAGG + Intergenic
1112496366 13:99908283-99908305 CCTCCCTTCACACCAGGTCCAGG - Intergenic
1112503787 13:99961280-99961302 CCTGCCCCCTCCCCAGGAGCTGG + Intergenic
1112646411 13:101337926-101337948 TCTCCCCACTCATCAGCTGAGGG + Intronic
1113404222 13:110023027-110023049 TCTCCCCACTCAACAGCTGGAGG - Intergenic
1113463261 13:110496356-110496378 CCTCTCCCCTCACCAGCAGCTGG + Intronic
1113885912 13:113658311-113658333 CCTCACCAAACACCAGGGGCTGG + Intergenic
1114258437 14:21021435-21021457 GCTCCCCATCCACCAGGTGTGGG + Intronic
1117838496 14:59832402-59832424 CCTACCCATTCACAGGGTGCAGG + Intronic
1119398637 14:74347670-74347692 CCTCCCCCATCAGCAGGGGCTGG + Intronic
1119598101 14:75955275-75955297 CATGCCCGCTCCCCAGGTGCAGG - Intronic
1121407016 14:93725261-93725283 CCTCCCCCATCACCACGCGCGGG - Intronic
1121675101 14:95746054-95746076 CCTCCCTGGTCACCAGGTGTTGG + Intergenic
1121782649 14:96631846-96631868 CCTCACCTCTCACCTGCTGCGGG - Intergenic
1123108792 14:105855633-105855655 CGTCACCACGGACCAGGTGCAGG - Intergenic
1123760137 15:23425452-23425474 CCTGGCCACTGAACAGGTGCAGG - Intergenic
1124195278 15:27620059-27620081 CCTTCTGACCCACCAGGTGCTGG + Intergenic
1124483909 15:30099844-30099866 CCTCCCCACCCCACACGTGCTGG + Intergenic
1124519670 15:30397380-30397402 CCTCCCCACCCCACACGTGCTGG - Intergenic
1124538983 15:30568841-30568863 CCTCCCCACCCCACACGTGCTGG + Intergenic
1124617152 15:31250012-31250034 CTCCACCACTCACCAGCTGCAGG - Intergenic
1124759667 15:32438731-32438753 CCTCCCCACCCCACACGTGCTGG - Intergenic
1126740019 15:51768172-51768194 CACCCCCACTCACTATGTGCTGG - Intronic
1127648024 15:60976755-60976777 CCTGCTCACTCACCAGGGTCAGG - Intronic
1127961292 15:63892839-63892861 CATCCCCACTTACCATGTGCCGG - Intergenic
1128155907 15:65391867-65391889 CCACCGCCCTCACCTGGTGCCGG + Exonic
1128752869 15:70161482-70161504 CCTCCCCAGTCACCTGGGACAGG + Intergenic
1128868863 15:71136985-71137007 CATCCCCACACACCAGGAGGAGG - Intronic
1129149573 15:73679592-73679614 CCTTCCGACTCACCAGCAGCAGG + Intergenic
1129334807 15:74845460-74845482 CCACACCACTCACCCGCTGCAGG + Exonic
1131393048 15:92064852-92064874 CCTCCCTACCCTCCAGCTGCTGG - Intronic
1131468316 15:92673435-92673457 CCTACCTACCCACCAGGTGTTGG - Intronic
1132336370 15:101050929-101050951 GTTCCCCACACAGCAGGTGCTGG + Intronic
1132554051 16:564932-564954 GCTCACCATTCACCAGGCGCTGG + Exonic
1132684911 16:1158283-1158305 CCTTCCCACTCACCAAGAGCTGG + Intronic
1132771660 16:1566985-1567007 CCTCCCTTCTGACCAGGTGTGGG + Intronic
1132982130 16:2743544-2743566 CCTCATACCTCACCAGGTGCCGG + Intergenic
1133136198 16:3713864-3713886 GCTCCCCACACACCAGGCCCAGG + Intronic
1133188977 16:4119463-4119485 CCTCCCCAGTCTCCAGGTCAGGG + Intergenic
1133494154 16:6300176-6300198 CCTCCCCTCTCACCAGCCTCTGG - Intronic
1134023635 16:10938750-10938772 CCTCCCCACTTCCCAGGGTCAGG + Intronic
1134456202 16:14397424-14397446 CCTGGCCACTGAACAGGTGCAGG + Intergenic
1135424437 16:22325348-22325370 CCTCCACCCTCTCCAGGTCCGGG - Intronic
1137010254 16:35314208-35314230 GTTCCCCACCCACCAGCTGCCGG - Intergenic
1140915340 16:79488343-79488365 CCCCCTTACTCTCCAGGTGCAGG + Intergenic
1141203820 16:81917501-81917523 CAGTCCCACCCACCAGGTGCAGG + Intronic
1141274941 16:82578826-82578848 CCTCCCCACTCTCCATATCCAGG - Intergenic
1142210736 16:88807246-88807268 GCTGCCCACTAACCAGGTCCCGG + Intronic
1142350507 16:89577194-89577216 CCTCCCCACTCAGCTGGTGCTGG + Intronic
1143042223 17:4047100-4047122 CCTTCCCACCCACCAGCAGCCGG - Intronic
1143045893 17:4079216-4079238 CCTACCCACTCCTCACGTGCGGG + Intronic
1143108864 17:4542603-4542625 CCCCAACACTCACCGGGTGCCGG + Exonic
1143110358 17:4549354-4549376 CCTCCTCCATCTCCAGGTGCAGG + Exonic
1144052384 17:11508300-11508322 CCTCACCAGACACCAGATGCTGG - Intronic
1144640438 17:16933814-16933836 CCTCAGCACTCGCCAGGTGCAGG - Intronic
1144662754 17:17081837-17081859 CCTCCACACCCACCAGTTACAGG - Intronic
1144713285 17:17417177-17417199 CATGCCTACTCCCCAGGTGCAGG + Intergenic
1144947435 17:18977099-18977121 TCTCCCCACTCCCCAGGTTGGGG - Intronic
1145271278 17:21406144-21406166 CCTGCCCAGTCACCTGGAGCTGG - Intronic
1146499006 17:33348443-33348465 CATCTCCACTCACGAGTTGCAGG + Intronic
1147250018 17:39147594-39147616 CCTTCCCTCTCCCCAGGTGAGGG - Intronic
1147256256 17:39184191-39184213 CCTGCCCACTCCCCAGTTCCAGG + Intronic
1147928711 17:43962637-43962659 CTTCCCCATTCCCCAGGGGCGGG + Intronic
1147975954 17:44248205-44248227 CCTACCCACTCTCTGGGTGCTGG + Intergenic
1148240601 17:45997324-45997346 CCTCCTCACTAGCCAGGTGTGGG + Intronic
1148906877 17:50917785-50917807 CTTCCCTACTCACCAGGTACTGG - Intergenic
1149595128 17:57860848-57860870 CCTCCCCACCCATCAGGGTCTGG - Intergenic
1149600294 17:57889084-57889106 CCTCCGCACTCCCCAGCTGTGGG + Intronic
1152435000 17:80271089-80271111 CCTACCCTCCCACCAGGGGCGGG - Intronic
1152691628 17:81720756-81720778 CCTCTCCACTCACCAGCAGGCGG + Exonic
1152722166 17:81928436-81928458 CCTCCCCGCTCACCTGCTGGCGG - Intergenic
1153044104 18:839950-839972 CATCGCCACTCAACAAGTGCTGG - Intergenic
1155156560 18:23162716-23162738 CCTACCCACTTCTCAGGTGCTGG - Intronic
1156072665 18:33231718-33231740 CCTCCCCACACACCAGCTGGTGG - Intronic
1156449399 18:37258573-37258595 CCTCCCCACTCACCTGCCTCAGG - Intronic
1160337642 18:78056976-78056998 CCTCCCCAGACACCAGGTGAGGG + Intergenic
1160738770 19:676517-676539 CCGCCCCACTCACCGGGCGCGGG - Exonic
1160947767 19:1651694-1651716 CCTCCCCCCGCAGCCGGTGCAGG + Intronic
1160975794 19:1791855-1791877 CCTCCTCCCCCACCAGCTGCTGG - Exonic
1161576879 19:5059279-5059301 CCTCCACACTCGCCAGCAGCAGG + Intronic
1161589030 19:5120471-5120493 CCTCCCCACTCTCCCGGGGCTGG + Intronic
1162025004 19:7888729-7888751 CGTCCCGACACACCAGGAGCTGG + Intronic
1162334209 19:10050212-10050234 ACTCCCAACTCACTAGCTGCTGG + Intergenic
1162549797 19:11351988-11352010 CCTCCCCACACACCGGCTGTGGG - Intronic
1163490576 19:17615054-17615076 ACTCCCCACTCCCCAAGTCCCGG + Intronic
1163647568 19:18498590-18498612 CCTCCCCAATGACCAGCAGCTGG + Intronic
1163821541 19:19499132-19499154 CCACCCCACTGCCCAGGGGCAGG + Intronic
1164051334 19:21587339-21587361 CCTGCCCACCAACCAGGAGCGGG - Intergenic
1164615306 19:29664019-29664041 GCTCCCCTCTCACCTGGTCCTGG + Intergenic
1166696838 19:44856691-44856713 CCTCCAGATTCCCCAGGTGCTGG - Intronic
1167072066 19:47227356-47227378 CCTCCCGTCCCACCAGGTCCTGG + Intronic
1167848879 19:52187053-52187075 CCACCCCACTCATCGGGTGCTGG - Intergenic
925149069 2:1602220-1602242 CCTCCCCACCCACCCGACGCAGG + Intergenic
925399215 2:3559558-3559580 CCTCCTGACTCTCCAGGTGCGGG - Intergenic
926309157 2:11662084-11662106 CCTCCTCACTCAGCAGCTCCAGG + Exonic
926394341 2:12425930-12425952 CCACCCCTCACACCAGCTGCAGG + Intergenic
927946383 2:27137523-27137545 CCTGCCCCCTCCCCAGGTACAGG - Exonic
928598863 2:32884228-32884250 CCTCCAGACTCTCCAAGTGCTGG + Intergenic
928637944 2:33266906-33266928 CCCCCCCACTCACCATGTTGAGG + Intronic
929574646 2:43044041-43044063 CCCCAACACACACCAGGTGCTGG - Intergenic
930032768 2:47068632-47068654 GATCCCCACTGAGCAGGTGCTGG - Intronic
934074134 2:88413146-88413168 CATCCAGACTCCCCAGGTGCCGG + Intergenic
934275529 2:91570850-91570872 CCCCCCCACCCGCCCGGTGCAGG + Intergenic
934503528 2:94875840-94875862 CCTCCCCTCTCAGCACCTGCGGG - Intronic
934897898 2:98134357-98134379 CCTCCGCCCTCACAAGGGGCAGG - Intronic
937361583 2:121233539-121233561 CCTCCCACCTCCCCAGGTGCTGG + Intronic
937382039 2:121387175-121387197 CCTCCCGACACACCAGCAGCAGG - Exonic
937869841 2:126778987-126779009 CCTCCCTCCTCCCCAGGTCCTGG + Intergenic
938855709 2:135308262-135308284 CCTGCCCACTCCCCAGGGGTAGG + Intronic
940793956 2:158057277-158057299 TCTCCCCACTCCTTAGGTGCGGG - Intronic
946021560 2:216643896-216643918 CCTCCACACTCACAAAGAGCAGG + Intronic
946411054 2:219515344-219515366 CCTCCCCACTCCCCAGCCTCCGG - Intronic
947389416 2:229623729-229623751 GGTCCCCACTCACCTGATGCTGG - Intronic
948364657 2:237446893-237446915 CCTCACCACACCCCAGGTGCTGG - Intergenic
948607895 2:239147470-239147492 CCCTCACAGTCACCAGGTGCCGG - Intronic
948793649 2:240391556-240391578 CCACCCCACTCAGCTGGTGGTGG + Intergenic
948863156 2:240762680-240762702 CCTCCTGACGCAGCAGGTGCTGG + Intronic
948888637 2:240896433-240896455 CCTCCCCACAGCCCAGGGGCCGG + Intronic
948917006 2:241039520-241039542 CCTCCCTCCTCACCGGATGCTGG - Intronic
1168845330 20:940601-940623 ACTTACCACTCACCAGCTGCGGG + Intergenic
1168895232 20:1319577-1319599 CCAGCCCACTCACCTGGTGGTGG + Exonic
1170441117 20:16379652-16379674 CCTCCCCACGCCGCAGGAGCTGG + Exonic
1170669304 20:18416049-18416071 CCTGACCACCCACCATGTGCAGG + Intronic
1170780600 20:19422261-19422283 CCTCCGCACTAAACAGGTGTTGG + Intronic
1170974662 20:21150813-21150835 TATCATCACTCACCAGGTGCAGG - Intronic
1171257058 20:23697419-23697441 CCTCCGCACTGCCCAGGTCCTGG - Intergenic
1171351711 20:24507599-24507621 CCTTCCTACTAAGCAGGTGCAGG - Intronic
1172103547 20:32501022-32501044 ACTCCCCACTCTTCAGGTGTGGG + Intronic
1172505797 20:35461495-35461517 CCCCCTCACCCACCAGGAGCTGG - Intronic
1173295429 20:41751172-41751194 CCTCACCAGACACCAGATGCTGG + Intergenic
1174116467 20:48229838-48229860 CCTCCCCACCCACCTTGTTCTGG + Intergenic
1175159115 20:56994953-56994975 CCTCCCCACTAACCAGAAGAGGG - Intergenic
1175197005 20:57251150-57251172 CATCCCCAGGCACCAGCTGCAGG + Intronic
1175333005 20:58177615-58177637 CCTTCCCCCTCACCAAGTGGGGG + Intergenic
1175713918 20:61242787-61242809 CATACCCATTCACCAGGTTCAGG - Intergenic
1175856054 20:62121849-62121871 CCGCCCCAGTGCCCAGGTGCCGG - Intergenic
1175949882 20:62577736-62577758 CCTCCACACACAGCAGGTGGGGG - Intergenic
1175958191 20:62622035-62622057 CCTCCCCACTCTCAGGGTCCTGG - Intergenic
1175968447 20:62671734-62671756 GCTCCTCTCTCCCCAGGTGCTGG + Exonic
1176105403 20:63383636-63383658 CCTCCCCTCGCACCACCTGCTGG + Intergenic
1178975939 21:37221167-37221189 CCTCCCCTATCACCAGCTCCAGG + Intergenic
1180007915 21:45031769-45031791 CATCCCCACCCAGCAGGAGCCGG + Intergenic
1180559910 22:16607941-16607963 CCTCCGCACTCCCAAAGTGCTGG + Intergenic
1180859447 22:19068971-19068993 CCTCCCATCTCACAAGGTGAAGG + Intronic
1181163645 22:20972055-20972077 CTTCATCACTAACCAGGTGCTGG - Intronic
1181372488 22:22429379-22429401 CATCCCCACCCACCATGTGTGGG - Intergenic
1181546490 22:23605447-23605469 CCTCCCCGAGCACCAGGTGGTGG - Intergenic
1182270494 22:29150210-29150232 CCCCCCCCCCCACCAGTTGCTGG - Intronic
1183262934 22:36807659-36807681 TCTCCCCACTTTCCAGGTGTGGG + Intronic
1184346374 22:43916004-43916026 CCTCACCAGACACCAGATGCTGG + Intergenic
1184346384 22:43916061-43916083 CCTCACCAGACACCAGATGCTGG + Intergenic
1184346406 22:43916175-43916197 CCTCACCAGACACCAGATGCTGG + Intergenic
1184498812 22:44859825-44859847 CTTCCCCACTCACCGCATGCAGG - Exonic
1184500012 22:44865781-44865803 CTTGCCCACTCACCGTGTGCAGG + Intergenic
1184583195 22:45430682-45430704 CCTCCCCCGTCAGGAGGTGCTGG - Intronic
1184589705 22:45473743-45473765 CCTCCCCACTCCCCAGCTTCCGG + Intergenic
1184806108 22:46795970-46795992 CCTCCCCTCTGCTCAGGTGCTGG + Intronic
1185320895 22:50199910-50199932 CCTCCCCATTCCCCAGGCCCTGG - Intergenic
950406670 3:12809217-12809239 CCTCCCCACACACCTGCTGCTGG - Intronic
950429740 3:12943954-12943976 CCACCCCACTCCCCAGGAGCTGG + Intronic
950483403 3:13258821-13258843 CCTCCCCACCCCACAGGGGCTGG + Intergenic
950768545 3:15292407-15292429 CCTCCCAACTAACAAGGTGATGG + Intronic
952954904 3:38550833-38550855 GGTCCCCACTCACCATGGGCAGG + Exonic
954155382 3:48682335-48682357 CCTCCCCACACACCTGGTAGAGG + Exonic
954366205 3:50147531-50147553 GCTCCCCACCCACCTGGTACTGG + Intergenic
955497135 3:59545443-59545465 CTTACCAACTAACCAGGTGCTGG + Intergenic
957193480 3:77039671-77039693 CCTCCCCACTCCCCAGCGGGCGG + Intronic
961569048 3:127785197-127785219 CTTCCCCACACACCTGCTGCAGG + Intronic
961601289 3:128064110-128064132 CCTCCCCACTCACCAGCCAAGGG + Intronic
961673408 3:128550577-128550599 CCTTCTCACTCACCCGGTCCTGG - Intergenic
961830875 3:129622447-129622469 CCTCCTAGCTCAGCAGGTGCTGG + Intergenic
962924240 3:139976997-139977019 CCTCCCCAGGCCCCAGGTCCAGG - Intronic
965882850 3:173408526-173408548 CCTCCCTAATCTCCAGGTGCTGG - Intronic
966400988 3:179546731-179546753 CCTCCCCTTTCCCCAGGTGGAGG - Intergenic
966914065 3:184575331-184575353 TCGCCCCACCCACCAGGCGCAGG - Intronic
968019608 3:195373180-195373202 CCTCCCACATCACCAAGTGCTGG - Intronic
968445865 4:651742-651764 CGTCTCCATTCAGCAGGTGCCGG + Intronic
968508991 4:987168-987190 CGTCCACATGCACCAGGTGCGGG - Exonic
970333234 4:15004512-15004534 CCTCCCAACCCACCGGGGGCTGG - Intronic
971757960 4:30724444-30724466 CATCCCCAGTCACCAACTGCAGG + Exonic
972278465 4:37581438-37581460 GCTCTCCACTCAGCAGGTGATGG + Intronic
974553759 4:63415950-63415972 TCCCCCCTCTCCCCAGGTGCTGG + Intergenic
980191786 4:129533735-129533757 CCTCCACACTCACCGGTTGCCGG - Intergenic
985532738 5:443404-443426 CCTCCCCGCCCTCCAGGTCCCGG - Intronic
987284051 5:16438486-16438508 CCTCTCCAGTCAACAGGTTCTGG + Intergenic
989705529 5:44325721-44325743 CCTCCCCCCTCCCCAGGCCCTGG - Intronic
990829421 5:59940122-59940144 CCTCCTCACCCTCCAAGTGCGGG - Intronic
991096666 5:62747046-62747068 CCTGCCTGCTTACCAGGTGCAGG + Intergenic
991389546 5:66127463-66127485 CCTCCCCACTCCCCAGTTCTTGG - Intergenic
991514855 5:67424032-67424054 CCTCACCACACACCAAATGCTGG + Intergenic
992083412 5:73256474-73256496 CCTTCCCACTCCCCAGTAGCTGG - Intergenic
994515922 5:100772855-100772877 TATCCCCACTCCCCAGGTGGGGG - Intergenic
995014476 5:107294495-107294517 TCTCCCCACCCACCAGGCACTGG + Intergenic
995077135 5:107999063-107999085 CCTCCCAAGTCACCTGGAGCTGG - Intronic
998696322 5:144643935-144643957 CCCCACCCCTCACCAGGTCCTGG + Intergenic
999134308 5:149307604-149307626 GCTGACCACTCACCAGGAGCTGG - Exonic
999253637 5:150197026-150197048 CCTCTCCCCACACCAGGCGCCGG + Exonic
1001085678 5:168698701-168698723 CCCCTTCACCCACCAGGTGCTGG + Intronic
1001119689 5:168969756-168969778 CCTTCCCGCTCTCCAGGAGCTGG - Intronic
1002164101 5:177333929-177333951 CATCCTCCCTCACTAGGTGCTGG - Intronic
1002188204 5:177465414-177465436 CTTCCCCACTCGCCAGCTCCTGG - Intronic
1006203650 6:32320058-32320080 ACTCACCACTCACATGGTGCTGG + Intronic
1006397536 6:33796962-33796984 GCTCCCTGCTCACCAGCTGCTGG + Intronic
1007387849 6:41531548-41531570 CCTCCCCCAACAACAGGTGCAGG + Intergenic
1008117275 6:47566621-47566643 CCTCACCCCTCAACAGGTCCTGG + Intronic
1008588475 6:52970231-52970253 CCTCCTTACTCACCAGGCTCTGG - Intergenic
1008927032 6:56897840-56897862 CCTCCTGACTCACTAGGTTCTGG + Intronic
1010192677 6:73209826-73209848 CCTCCCCACTCCCCAAGGGCTGG - Exonic
1012469429 6:99554392-99554414 ACTCCCCACTCCTAAGGTGCTGG - Intronic
1015322563 6:131892763-131892785 ACTCCCCACTCAGCATTTGCTGG + Exonic
1015435185 6:133178077-133178099 CCCCACCCCTCACCAGGTCCCGG + Intergenic
1015593002 6:134840230-134840252 CCACCCCTCTCACCAACTGCTGG - Intergenic
1015647597 6:135411094-135411116 CCTCCCTTATCACTAGGTGCTGG + Intronic
1016020183 6:139228973-139228995 CCTACCCACTCACCCAGTCCTGG - Intergenic
1017323301 6:153117585-153117607 TCTGTCCACTCACAAGGTGCAGG - Intronic
1017690929 6:156963029-156963051 CCTCGGCCCTCACAAGGTGCTGG + Intronic
1018186024 6:161265684-161265706 CCTCCCCACCCACCAGCTAAGGG - Intronic
1018530325 6:164756219-164756241 CCTCATCACTCAGCTGGTGCAGG - Intergenic
1018583666 6:165332911-165332933 GCACCCCAGTTACCAGGTGCAGG + Exonic
1019575087 7:1733844-1733866 GCTCCCCTCTCCCCAGGCGCAGG - Intronic
1021561560 7:21972688-21972710 CCTCCCAACTCAGAAGGGGCAGG + Intergenic
1023405853 7:39833409-39833431 CCTCCCTCCCCACCAGGCGCTGG - Intergenic
1023744906 7:43314148-43314170 CATCAGCACTCACCAGCTGCGGG - Intronic
1023793017 7:43768876-43768898 CCACCCCACCCACCACCTGCGGG + Intronic
1023829542 7:44030791-44030813 CCTCCACGCCCAGCAGGTGCCGG + Intergenic
1023871138 7:44263597-44263619 CCTCCCACCCCACAAGGTGCGGG + Intronic
1024324786 7:48101152-48101174 CCTGCCCACTCCCAAAGTGCTGG + Intronic
1024577216 7:50774448-50774470 CCTCACCAGACACCAAGTGCTGG - Intronic
1026912127 7:74097070-74097092 GCTCCCCAGCCACCTGGTGCGGG - Exonic
1027123244 7:75537373-75537395 CCTCCACACTGACCAAGTGCTGG - Exonic
1029487424 7:100852258-100852280 CCTCGCCCCTCACCCGCTGCGGG - Intronic
1029702801 7:102258720-102258742 CCACGCCACTGACCAGCTGCAGG - Intronic
1029739851 7:102485049-102485071 CCTCCACGCCCAGCAGGTGCCGG + Exonic
1029757850 7:102584228-102584250 CCTCCACGCCCAGCAGGTGCCGG + Exonic
1029775786 7:102683289-102683311 CCTCCACGCCCAGCAGGTGCCGG + Intergenic
1031347759 7:120690563-120690585 CCTTCCCATTCACCTGGTGAAGG + Intronic
1032083699 7:128872827-128872849 CCTCCCCCATCACCAGATCCTGG + Intronic
1032093134 7:128922006-128922028 CCTGCCCAGTCCCCAGGGGCAGG - Intergenic
1032703603 7:134403559-134403581 CCTCCCCACCCCCCAGTAGCTGG - Intergenic
1033085607 7:138338971-138338993 CCTCCCAAGTAGCCAGGTGCAGG + Intergenic
1033240740 7:139677468-139677490 CCTCCCCAGACACCAAATGCCGG - Intronic
1034426393 7:151016418-151016440 CCCCTCTACTCACCTGGTGCAGG + Exonic
1034884022 7:154783844-154783866 CCTCCTCCCTCACAAGGTCCAGG - Intronic
1037885076 8:22591659-22591681 CCTCCACACTCACGCGATGCTGG - Exonic
1042028839 8:64452067-64452089 CCTCCCCACCCACCAGCTGCAGG + Intergenic
1044870338 8:96613900-96613922 TCTCCCCACTCACCACCTACTGG - Intergenic
1046439287 8:114237022-114237044 CCTCCCCTTTCACTATGTGCTGG + Intergenic
1048162225 8:132032011-132032033 TGTCCCCACTTCCCAGGTGCAGG + Exonic
1049179307 8:141212898-141212920 CCTCCCCACTCAGCCCCTGCTGG - Intronic
1049393168 8:142382413-142382435 TCTGCCCACTGACCAGCTGCCGG + Intronic
1049515148 8:143050514-143050536 CCTCACTCCCCACCAGGTGCAGG + Intronic
1049777691 8:144414089-144414111 CGCCCCTACTCCCCAGGTGCTGG - Exonic
1051674703 9:19547309-19547331 CCTGCCCATTCTGCAGGTGCTGG + Intronic
1052978431 9:34429408-34429430 CCTCCTCACTCACCAGCTCAGGG + Intronic
1053145206 9:35707247-35707269 CCTCCCCTCTCCCCAGGGTCGGG - Exonic
1055072067 9:72176515-72176537 CCTCCCCTCTCACCCTGTGTAGG + Intronic
1056133113 9:83604812-83604834 CTCTCCCACTCACCAGGTGGTGG + Intergenic
1056508439 9:87280019-87280041 CCTGCCCTCTCTCCAGGTTCTGG - Intergenic
1056725131 9:89107589-89107611 CCTCACCCCTCTGCAGGTGCAGG + Intronic
1056812552 9:89775786-89775808 CCTCCCCTCCCACCCGGTACCGG + Intergenic
1056954617 9:91072275-91072297 CCCCCCCACTCTCCTGGTGCTGG + Intergenic
1057273736 9:93665360-93665382 CCTCCCCACACACCACATTCAGG - Intronic
1058929500 9:109704966-109704988 ACTCAGCACTCACCAGCTGCAGG + Intronic
1059669449 9:116478645-116478667 CCTCCCCAGTTGCCAGGGGCTGG + Intronic
1061225505 9:129278791-129278813 CAGCCCCACCCACCAGGTGGGGG - Intergenic
1062130151 9:134888252-134888274 CCTCTCCTCTCACCACGTCCGGG + Intergenic
1203564415 Un_KI270744v1:79725-79747 CCTCCCCTCTCAGCACCTGCGGG - Intergenic
1187450054 X:19388031-19388053 TCTCCCTAATCACCAGCTGCAGG - Intronic
1187467174 X:19537992-19538014 CTTCCGCACCCACCAGTTGCTGG - Intronic
1188470270 X:30530250-30530272 CCTTCCCACCCACCAGTTGGAGG - Intergenic
1188821281 X:34778429-34778451 CCTCCAAACTCACCAGCTGGAGG - Intergenic
1191177548 X:57521247-57521269 CCTCACCACACAACAGGTCCCGG + Intergenic
1195216198 X:102705692-102705714 CCTCCCACCTCACAAAGTGCTGG + Intergenic
1195329159 X:103782792-103782814 CCTCCCCACCCCCCGGCTGCAGG + Intronic
1195520062 X:105820428-105820450 CCGCCCCCCTCCCCAGGTGCGGG - Intergenic
1195710339 X:107768210-107768232 CCAACCCACCCACCAGGTGGGGG + Intronic
1197951958 X:131907855-131907877 CGTCCCAACTCACAAGGGGCGGG - Intergenic
1198232599 X:134706219-134706241 CCTCCCCACTCAGCCTTTGCTGG - Intronic
1200076485 X:153553833-153553855 CCTCCACACTCTCCAGGGTCTGG - Intronic