ID: 923369355

View in Genome Browser
Species Human (GRCh38)
Location 1:233295314-233295336
Sequence CTCCCCACTCACCAGGTGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 294}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923369345_923369355 1 Left 923369345 1:233295290-233295312 CCCACAGCTCCCCGGGACCGGAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 923369355 1:233295314-233295336 CTCCCCACTCACCAGGTGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 294
923369346_923369355 0 Left 923369346 1:233295291-233295313 CCACAGCTCCCCGGGACCGGACC 0: 1
1: 0
2: 1
3: 9
4: 175
Right 923369355 1:233295314-233295336 CTCCCCACTCACCAGGTGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 294
923369337_923369355 24 Left 923369337 1:233295267-233295289 CCTTTCTCCTTCTTCCCTCCATA 0: 1
1: 1
2: 13
3: 128
4: 1189
Right 923369355 1:233295314-233295336 CTCCCCACTCACCAGGTGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 294
923369340_923369355 9 Left 923369340 1:233295282-233295304 CCTCCATACCCACAGCTCCCCGG 0: 1
1: 0
2: 0
3: 27
4: 269
Right 923369355 1:233295314-233295336 CTCCCCACTCACCAGGTGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 294
923369347_923369355 -8 Left 923369347 1:233295299-233295321 CCCCGGGACCGGACCCTCCCCAC 0: 1
1: 0
2: 1
3: 11
4: 195
Right 923369355 1:233295314-233295336 CTCCCCACTCACCAGGTGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 294
923369348_923369355 -9 Left 923369348 1:233295300-233295322 CCCGGGACCGGACCCTCCCCACT 0: 1
1: 0
2: 0
3: 8
4: 201
Right 923369355 1:233295314-233295336 CTCCCCACTCACCAGGTGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 294
923369349_923369355 -10 Left 923369349 1:233295301-233295323 CCGGGACCGGACCCTCCCCACTC 0: 1
1: 0
2: 1
3: 20
4: 269
Right 923369355 1:233295314-233295336 CTCCCCACTCACCAGGTGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 294
923369338_923369355 17 Left 923369338 1:233295274-233295296 CCTTCTTCCCTCCATACCCACAG 0: 1
1: 0
2: 4
3: 86
4: 576
Right 923369355 1:233295314-233295336 CTCCCCACTCACCAGGTGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 294
923369339_923369355 10 Left 923369339 1:233295281-233295303 CCCTCCATACCCACAGCTCCCCG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 923369355 1:233295314-233295336 CTCCCCACTCACCAGGTGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 294
923369343_923369355 6 Left 923369343 1:233295285-233295307 CCATACCCACAGCTCCCCGGGAC 0: 1
1: 0
2: 1
3: 17
4: 189
Right 923369355 1:233295314-233295336 CTCCCCACTCACCAGGTGCAGGG 0: 1
1: 0
2: 4
3: 21
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923369355 Original CRISPR CTCCCCACTCACCAGGTGCA GGG Exonic
900286085 1:1901349-1901371 CTCCCCACTCTCCAGCCTCAGGG - Intergenic
900590215 1:3456102-3456124 CTCCCCAGTGTCCAGGTGGAGGG - Intronic
900611700 1:3547018-3547040 CCCCCCAGCCACCAGCTGCAGGG - Intronic
900654126 1:3746845-3746867 CTCCCCGCTCCCCAGGTGTGGGG - Intergenic
901771799 1:11534371-11534393 CTCCCCACAGACCACGTACAAGG + Exonic
902172912 1:14627423-14627445 CTCCCAGCTCGCCAGCTGCAAGG - Intronic
902660245 1:17895932-17895954 CTTCCCACTCACCAGCAGCCAGG - Intergenic
902661754 1:17909121-17909143 CTCCCCACTCTCCAGTCACATGG - Intergenic
905329390 1:37181678-37181700 CTCCCCACGCCCCAGGAGAATGG + Intergenic
905478393 1:38244895-38244917 CTCCCCCCTGCCCAGGTGCAGGG - Intergenic
907289832 1:53406750-53406772 CTGACCACTCACCAAGTGCCAGG + Intergenic
907433686 1:54430291-54430313 CTCCACACTCAGGAGGTGCTGGG - Intergenic
907526140 1:55055218-55055240 CTGCCCACTCACCAGCTGTGTGG - Intronic
908224857 1:62045836-62045858 TACCCCACTCACCAGGAGCTTGG - Intronic
908266421 1:62383827-62383849 CTGAGCACTCACCAGGTGCCAGG - Intergenic
912162318 1:107000568-107000590 TTCCCCATTCACCCGGTGCCAGG - Intergenic
915087776 1:153399736-153399758 CCCCCAACTCCCCAGGTGGAAGG - Intergenic
915123939 1:153650166-153650188 CTCCCCACTCACCCATGGCAGGG - Intergenic
915341688 1:155179924-155179946 CTGCCCACTCACCAGGTGCCGGG - Exonic
920003762 1:202817640-202817662 CTCCCCACTCTCCAGCCTCAGGG - Intergenic
920006424 1:202836692-202836714 CTCCCCACCTACCTGGGGCAGGG - Intergenic
920167628 1:204046746-204046768 CTCCCCAGTCCCCAGGTCCTCGG - Intergenic
920955774 1:210619136-210619158 ATACCCACTCTTCAGGTGCAAGG - Intronic
922348539 1:224717061-224717083 CTCCCCACTGTCGTGGTGCAAGG - Intronic
922979070 1:229809643-229809665 ACCCCCACCCACCAAGTGCAGGG - Intergenic
923369355 1:233295314-233295336 CTCCCCACTCACCAGGTGCAGGG + Exonic
924628928 1:245718891-245718913 CTTCCCACTAGCCACGTGCAAGG - Intergenic
1063604733 10:7512733-7512755 CTCCCCACTCACCTCCTGCTGGG + Intergenic
1068335752 10:55630806-55630828 CTCTCCACCCACCATGTGAAGGG - Intergenic
1072792356 10:98327424-98327446 CTCCCCACTGCACAGGTCCACGG - Intergenic
1074555061 10:114481286-114481308 CCCCCCATTCAGCAGGAGCAGGG + Intronic
1075068698 10:119306693-119306715 CACCCCACCCACCAGGCTCAGGG - Intronic
1077485184 11:2835206-2835228 CTGCCCACCCTCCAGGTGCCTGG - Intronic
1077507119 11:2934922-2934944 ATCCCCACAAGCCAGGTGCAGGG - Intergenic
1077542080 11:3151516-3151538 TTCCCCACTCCCCATGTGCTGGG + Intronic
1077554884 11:3221137-3221159 CTCCCACCTCACCTGGTGCATGG + Intergenic
1078009559 11:7561959-7561981 CCCCCGACTCCCCAGGTCCATGG - Intronic
1083174925 11:60943631-60943653 CTCCCCACTCACCATCTGAATGG - Intronic
1084594685 11:70109860-70109882 CTGCCCCGTCACCAGGTGCAGGG - Intronic
1084679082 11:70655384-70655406 TTCTCCACTCACCAGCTACATGG + Intronic
1085526092 11:77165177-77165199 CTCGCCCCTCCCCAGGTGCCAGG + Intronic
1089531691 11:119134069-119134091 CTCCTACCTCACCAGGTACAAGG + Exonic
1091068686 11:132542567-132542589 CTCCCAAGTCGCCAGGTGCCAGG - Intronic
1091568225 12:1662860-1662882 CCCCTCACCCACCAGCTGCAAGG + Intergenic
1092067976 12:5607975-5607997 CACCCCACTCCCCCGGTCCACGG + Intronic
1095648293 12:44576212-44576234 CTCCCCACGCACAACGTGGATGG + Intronic
1096411310 12:51378979-51379001 CTCCCCAGTCACCCCGTGCCAGG + Intronic
1096523493 12:52197276-52197298 GACACCACTCAGCAGGTGCAGGG - Intergenic
1096748273 12:53742800-53742822 CTCCCCATTCTCCCGCTGCAGGG + Intergenic
1099973450 12:89524315-89524337 TCCCCCACTCCCCAAGTGCACGG + Exonic
1101044884 12:100794704-100794726 CCTCCCCCTCCCCAGGTGCAGGG - Intronic
1101407375 12:104440700-104440722 CTCCCCACTCAGCAGGTGACAGG - Intergenic
1101434694 12:104654672-104654694 CTGTCCACTCACCAGGAGCAAGG + Intronic
1101771603 12:107756820-107756842 CTTACCACTCACCTGGGGCAGGG + Exonic
1102415146 12:112755205-112755227 CTCCCCAGTCACCTAGTCCAGGG + Intronic
1102482485 12:113233284-113233306 CTCCCCACTCGCCTGGGGGAGGG + Intronic
1102678193 12:114672687-114672709 ATCCCCATTTAACAGGTGCAAGG - Intronic
1103341595 12:120223998-120224020 CTTCCCACTCACCACGTGAGTGG - Intronic
1104098489 12:125583609-125583631 CTTCCCAGTCCCCAGGTGCAGGG - Intronic
1104314683 12:127686072-127686094 TTCCCCACTGGCGAGGTGCAGGG - Intergenic
1104415580 12:128594539-128594561 CTCCGGGTTCACCAGGTGCAGGG - Intronic
1104475511 12:129067603-129067625 CTCCTCATTCTCCAGGTGCCAGG + Intergenic
1105418633 13:20233389-20233411 CTCTCCACTCTCCAAGTTCAAGG - Intergenic
1105822495 13:24091947-24091969 CTCCCCTCTCTCCAGCTCCATGG - Intronic
1111951724 13:94713331-94713353 CTCCCCACTCCCGCGGCGCAGGG + Intergenic
1112402045 13:99086211-99086233 TCCCGCACTCACCAGGAGCACGG + Intronic
1113189337 13:107726009-107726031 CACCCCACTTAGTAGGTGCATGG - Intronic
1113404221 13:110023026-110023048 CTCCCCACTCAACAGCTGGAGGG - Intergenic
1114664704 14:24370541-24370563 CTCCCCACTCGCTTGGTCCAAGG + Exonic
1117613331 14:57506412-57506434 CTCCTCACTCAGAAGGTGAAAGG + Intergenic
1117766548 14:59089262-59089284 CTACCTGCTCACCAGGTGCAAGG + Intergenic
1117838497 14:59832403-59832425 CTACCCATTCACAGGGTGCAGGG + Intronic
1119149392 14:72344361-72344383 CTCCCCACTCAACTGGTACTTGG + Intronic
1119552496 14:75525178-75525200 CTGAACACTTACCAGGTGCAGGG - Exonic
1121404935 14:93713992-93714014 CTGCACACTCACCTGGTTCAGGG - Intergenic
1123033039 14:105460161-105460183 CACACCACTCCCCAGGTGCCAGG - Intronic
1123033060 14:105460220-105460242 CACACCACTCCCCAGGTGCCAGG - Intronic
1124617151 15:31250011-31250033 TCCACCACTCACCAGCTGCAGGG - Intergenic
1124844330 15:33275730-33275752 CTCTCCTCTCCCCAGGTGGATGG + Intergenic
1125530642 15:40411252-40411274 CTCACCACTGATCAGCTGCAAGG - Exonic
1126113757 15:45190346-45190368 CTCCACAGTCACCAGGTGTGAGG + Intronic
1127270386 15:57395816-57395838 CTAACCACTTACCAGCTGCATGG - Intronic
1127633938 15:60851440-60851462 CTCCCCACTCTCCAGGCACCTGG - Intronic
1127648023 15:60976754-60976776 CTGCTCACTCACCAGGGTCAGGG - Intronic
1127961291 15:63892838-63892860 ATCCCCACTTACCATGTGCCGGG - Intergenic
1128345246 15:66849122-66849144 CTCCACCTCCACCAGGTGCAAGG + Intergenic
1128752870 15:70161483-70161505 CTCCCCAGTCACCTGGGACAGGG + Intergenic
1130546424 15:84859939-84859961 CTGCCCACCCACCAGGAGCCAGG - Intronic
1131822092 15:96283862-96283884 CACCTCACTCACCTGGTGAATGG + Intergenic
1132336371 15:101050930-101050952 TTCCCCACACAGCAGGTGCTGGG + Intronic
1132684912 16:1158284-1158306 CTTCCCACTCACCAAGAGCTGGG + Intronic
1133136199 16:3713865-3713887 CTCCCCACACACCAGGCCCAGGG + Intronic
1133301893 16:4787667-4787689 CTCCCCACCCACCTGGTGACAGG - Exonic
1133779155 16:8923716-8923738 CTCTCCACTCACTTGGTGCCTGG - Intronic
1137923208 16:52512556-52512578 GTCCCCAGTCACCAAGGGCATGG - Intronic
1138227981 16:55315099-55315121 ATCCCCACTCCCCAGAGGCATGG - Intergenic
1138347998 16:56331634-56331656 CTCCCCCATCACCAGTTGCCTGG - Intronic
1138774951 16:59709824-59709846 CTCCCTACTTTCCAGGTTCATGG + Intergenic
1138884468 16:61059333-61059355 CTCTCCACTTACCAGGTATATGG + Intergenic
1141025215 16:80540689-80540711 TTCACCACCCACCAGGTGCCAGG - Intergenic
1141203821 16:81917502-81917524 AGTCCCACCCACCAGGTGCAGGG + Intronic
1141844597 16:86598806-86598828 CTCCCCTCTGACCAGGGGCGAGG - Intergenic
1141947857 16:87322802-87322824 CTCCTCACCCACCAGGTGCCAGG + Intronic
1142121735 16:88389898-88389920 CTCTCCACTCTCCACATGCAGGG + Intergenic
1142216178 16:88831222-88831244 CTCCCCACGCACCCCGTGCTCGG - Intronic
1142216188 16:88831258-88831280 CTCCCCACGCACCCCGTGCTCGG - Intronic
1142216198 16:88831294-88831316 CTCCCCACGCACCCCGTGCTCGG - Intronic
1142216218 16:88831366-88831388 CTCCCCACGCACCCCGTGCTCGG - Intronic
1142216228 16:88831402-88831424 CTCCCCACGCACCCCGTGCTCGG - Intronic
1142216238 16:88831438-88831460 CTCCCCACGCACCCCGTGCTCGG - Intronic
1142216248 16:88831474-88831496 CTCCCCACGCACCCCGTGCTCGG - Intronic
1142216258 16:88831510-88831532 CTCCCCACGCACCCCGTGCTCGG - Intronic
1142216268 16:88831546-88831568 CTCCCCACGCACCCCGTGCTCGG - Intronic
1142216278 16:88831582-88831604 CTCCCCACGCACCCCGTGCTCGG - Intronic
1142216298 16:88831654-88831676 CTCCCCACGCACCCCGTGCTCGG - Intronic
1142216308 16:88831690-88831712 CTCCCCACGCACCCCGTGCTCGG - Intronic
1142216318 16:88831726-88831748 CTCCCCACGCACCCCGTGCTCGG - Intronic
1142216328 16:88831762-88831784 CTCCCCACGCACCCCGTGCTCGG - Intronic
1142253877 16:89004623-89004645 TTCCCCACTCACCAGGTGCTTGG - Intergenic
1142350508 16:89577195-89577217 CTCCCCACTCAGCTGGTGCTGGG + Intronic
1142696085 17:1634732-1634754 CTCCCCACTCCCCAAATTCAAGG + Exonic
1143294693 17:5862063-5862085 CTCACCAGTCACCAGGTGCCAGG + Intronic
1143918549 17:10312876-10312898 CTCCCCACTCACCAAATCCTAGG - Intronic
1144662753 17:17081836-17081858 CTCCACACCCACCAGTTACAGGG - Intronic
1144720407 17:17465452-17465474 TTCCCCACCCACCAGCAGCATGG + Intergenic
1145292837 17:21563504-21563526 TTCCCAACTCCACAGGTGCAGGG + Intronic
1145387124 17:22422431-22422453 TTCCCAACTCCACAGGTGCAGGG - Intergenic
1146619144 17:34383119-34383141 CTCCCCAGTCCTAAGGTGCAGGG - Intergenic
1146651784 17:34611627-34611649 GTCCCCACTCTCCAGCTGCCTGG - Intronic
1147598797 17:41733571-41733593 CTGCACACGCAACAGGTGCAGGG - Intronic
1147966114 17:44195038-44195060 CTGCACACTCACCATGGGCATGG - Intronic
1148050398 17:44767442-44767464 CTCCCCACTCCCCAGGTGCCAGG + Intronic
1148458500 17:47823948-47823970 CTCTCCATTCTCCAGGTCCAAGG - Exonic
1148906876 17:50917784-50917806 TTCCCTACTCACCAGGTACTGGG - Intergenic
1151490100 17:74427697-74427719 CTCTCCACTCCCCAGGTAGAGGG + Intronic
1151584923 17:75003168-75003190 CTCACTACCCGCCAGGTGCAAGG + Exonic
1151603291 17:75119851-75119873 CTGCCCAGCCACCAGGTGCCAGG + Intronic
1152214109 17:79022569-79022591 TTTCCCAGTCACCAGGAGCAAGG - Intergenic
1152890033 17:82875008-82875030 CTCCTCACTCTTCAGGTGCCTGG + Intronic
1153568526 18:6445035-6445057 CTCCCCTCTCCCCAGGAACAGGG + Intergenic
1158285280 18:55873919-55873941 ATCCCCACCCAGCAGGTCCATGG - Intergenic
1159384685 18:67707986-67708008 CTCCACACTCTGCTGGTGCATGG + Intergenic
1160738769 19:676516-676538 CGCCCCACTCACCGGGCGCGGGG - Exonic
1161086844 19:2339397-2339419 CTACACACCCACCAGGTGCCCGG - Intronic
1161271984 19:3394895-3394917 CTCCCCACTCACCCCGTCCCTGG + Intronic
1161576880 19:5059280-5059302 CTCCACACTCGCCAGCAGCAGGG + Intronic
1163490577 19:17615055-17615077 CTCCCCACTCCCCAAGTCCCGGG + Intronic
1164670415 19:30069191-30069213 CTCTCCCCTCACCAGCTGCCAGG + Intergenic
1165948232 19:39458104-39458126 CTCCCCAACCACCTGGTGCCTGG + Intronic
1166042966 19:40214211-40214233 CGCCTCACTCACCAGGGCCATGG - Exonic
1166572523 19:43806825-43806847 TCCCCCACTCCCCAGGTCCATGG + Intronic
1167439807 19:49501384-49501406 ATCCCCACTCTTCAGGTGGAAGG - Intergenic
1167619987 19:50555382-50555404 CTCCTCCCTCACCTGGTGCAAGG + Intronic
1167800761 19:51739867-51739889 CTCCCCTAACCCCAGGTGCAGGG + Intergenic
925140857 2:1549151-1549173 CTCCCGGCTCACCAGCTCCAGGG + Intergenic
925967216 2:9077241-9077263 CTCCCTCCTCACCAGATGCAAGG - Intergenic
928637946 2:33266907-33266929 CCCCCCACTCACCATGTTGAGGG + Intronic
929956322 2:46461151-46461173 CTCCCCATTCCCCAGGTTTATGG - Intronic
930032767 2:47068631-47068653 ATCCCCACTGAGCAGGTGCTGGG - Intronic
932860872 2:75289979-75290001 CTTCCCACTCTCCAGGAACATGG - Intergenic
934122763 2:88855957-88855979 CCCCCCACTTACCAGCTGCGTGG + Intergenic
935227437 2:101065409-101065431 CTCAACACTCACCCTGTGCAGGG + Intronic
937257190 2:120563994-120564016 CTCCACGCTGACCAGCTGCATGG - Intergenic
939702564 2:145411773-145411795 CTCCCCAATGCCCAGGAGCACGG - Intergenic
939787843 2:146538767-146538789 CTCCCCCATCACAAGGTTCATGG + Intergenic
944271166 2:197786173-197786195 CTCCCCACCCGCCAGGTGGCAGG - Exonic
946631038 2:221669672-221669694 CTCCCCACTTTCTAGCTGCATGG + Intergenic
947737723 2:232465303-232465325 CTCCCCACCACCCTGGTGCAAGG - Intergenic
947769018 2:232656142-232656164 CTTCCCACTGACCAGGCCCATGG + Intronic
948609509 2:239157873-239157895 CACCCCACTGCCCAGGTGCCTGG - Intronic
1168801850 20:648560-648582 CACCCCTCTCACCAGCTACAAGG - Exonic
1168962050 20:1876674-1876696 ACCTCCACTGACCAGGTGCATGG + Intergenic
1170345680 20:15384341-15384363 TCCCCCACTCCCCAGGTTCAAGG + Intronic
1170663320 20:18363538-18363560 TTTTCCACTGACCAGGTGCAGGG + Intergenic
1170974661 20:21150812-21150834 ATCATCACTCACCAGGTGCAGGG - Intronic
1170999175 20:21396519-21396541 TTCCCCAGTCTCCAGGTTCATGG - Exonic
1171299680 20:24049623-24049645 CTCACCACTAACCAGGCACAGGG - Intergenic
1171368684 20:24646014-24646036 CTCTCCTCTCTCCAGGTGGATGG - Intronic
1172081923 20:32348678-32348700 CTGACCACTCACCATGTGCCAGG - Intergenic
1174176101 20:48645964-48645986 CTCTTCACTGACCAGGGGCAGGG + Exonic
1174895018 20:54439350-54439372 CTCCCCACTCACCTGTGGCATGG - Intergenic
1175968448 20:62671735-62671757 CTCCTCTCTCCCCAGGTGCTGGG + Exonic
1176052865 20:63129801-63129823 CACCCCACACCCCAGGAGCAGGG - Intergenic
1176937056 21:14879661-14879683 CTCCCCTCTCAACAGCTGTAAGG + Intergenic
1178390287 21:32192436-32192458 CTCCCCACACTCCAGGAGCTTGG + Intergenic
1178507236 21:33171867-33171889 CTTCTCACTCAGCAGGTGCCAGG + Intergenic
1178975940 21:37221168-37221190 CTCCCCTATCACCAGCTCCAGGG + Intergenic
1179502159 21:41816636-41816658 TTCCACCCTCACCAGATGCAGGG + Intronic
1179821979 21:43942364-43942386 CTGGCCACTCACCAGGAGCCTGG + Intronic
1179901133 21:44395399-44395421 TTCACTGCTCACCAGGTGCAGGG + Exonic
1180859448 22:19068972-19068994 CTCCCATCTCACAAGGTGAAGGG + Intronic
1180960440 22:19759946-19759968 CTCCCCCCTCTCCAGGCTCACGG - Intronic
1182018015 22:27056886-27056908 CTCACCACGCGCCAGGTGCTAGG - Intergenic
1182275954 22:29188808-29188830 CTCCCCAGTCCTCAGCTGCAGGG + Intergenic
1182423155 22:30258121-30258143 CTCCCCACTCCAAAGGAGCATGG + Intergenic
1183580884 22:38726081-38726103 CTCCCCCCGCACCAGCTACAGGG + Exonic
1184596760 22:45518627-45518649 CTCACCACTCAGCGGGTGGAGGG - Intronic
1184768923 22:46586812-46586834 CTCCCTCCTCATCAGCTGCAGGG - Intronic
1185181836 22:49368195-49368217 CTTCCCACACACCGGGTGTACGG + Intergenic
1185314737 22:50174187-50174209 GTCCCCACTCCCCAGGTGGGAGG + Intronic
1185347816 22:50318075-50318097 CTCCCCGGTCACCAGCTCCAGGG - Intronic
949396982 3:3625249-3625271 CTCCCCTCTTTACAGGTGCAAGG + Intergenic
949861280 3:8507086-8507108 CTACTGTCTCACCAGGTGCAGGG + Intronic
950133430 3:10563536-10563558 TTCCCCACCCTCCAGGTGCAAGG - Intronic
950429741 3:12943955-12943977 CACCCCACTCCCCAGGAGCTGGG + Intronic
950571133 3:13800774-13800796 CTCCCCACTTCCCAAGTTCAGGG + Intergenic
951333657 3:21395036-21395058 CTACCTAATTACCAGGTGCAAGG - Intergenic
952952814 3:38538500-38538522 CTCACCACCCACCTGCTGCAAGG - Intronic
953414308 3:42706906-42706928 CTCCCCACTTACCAGCTGTGTGG - Intronic
953550670 3:43900122-43900144 ATCCCCAGTCACCATGTGGAGGG - Intergenic
953550869 3:43901514-43901536 ATCCCCAGTCACCATGTGGAGGG + Intergenic
953702385 3:45206808-45206830 CTGTCCACTTACCAGGTGCAAGG + Intergenic
954153874 3:48674152-48674174 CTCCCCTCACCCCAGGGGCATGG + Exonic
954760548 3:52870714-52870736 CTCCCGCCTCACCAGCAGCAGGG + Intronic
957398421 3:79676095-79676117 CTCCCCAGTCACAAGGTTCGTGG - Intronic
958406504 3:93762106-93762128 CTCCCCACTTCCCAGATGAAGGG + Intergenic
960053863 3:113262602-113262624 CCAACCACTCACCAGGTGCCAGG + Intronic
960184670 3:114624104-114624126 CTCACCACTCACCAGGACTATGG + Intronic
961173350 3:124814950-124814972 CTCCCCACTCCCCATCAGCAGGG + Intronic
962463122 3:135632702-135632724 ATCCACACTCACCAGGGGAATGG + Intergenic
963491324 3:146004998-146005020 CACCCCACTCTCCAGATCCATGG + Intergenic
965676503 3:171202694-171202716 CTCAACACACACCAGTTGCAAGG + Intronic
965845102 3:172952467-172952489 CTCCCCACTCAGCCAGTGGATGG + Intronic
966089091 3:176108621-176108643 CTAACCACTCATCATGTGCAAGG + Intergenic
967007465 3:185398011-185398033 CTCCCCACTCCACAGGGCCAGGG - Intronic
968952973 4:3704073-3704095 CTCCCCACCCACCTGCTGCCTGG - Intergenic
969123141 4:4924366-4924388 CCCCCCACACACCAGGTGTGTGG + Intergenic
969253631 4:5988215-5988237 CTCCCCACTTACCAGATGAGAGG - Intronic
969507603 4:7597833-7597855 CTCCTCCCTCACCAGTTCCACGG - Intronic
970434879 4:16023617-16023639 CTACAGACTCACCAGGAGCATGG + Intronic
972278466 4:37581439-37581461 CTCTCCACTCAGCAGGTGATGGG + Intronic
978559259 4:110014501-110014523 CTCCCCACTTCCCAAGTGGAAGG - Intergenic
978905180 4:113996924-113996946 CTTCCCACTCAGCAGGAGGACGG - Intergenic
985469838 5:33381-33403 CACCCCCCACACCAGGTCCATGG + Intergenic
986280344 5:6317006-6317028 CTCCCCAATCCCCAGGCACATGG + Intergenic
987061971 5:14251626-14251648 CTCCTCACTGACTGGGTGCAGGG + Intronic
987640091 5:20601576-20601598 AGCCCCACTCACCAGCTGCCTGG + Intergenic
989129970 5:38097769-38097791 CTCCCCATTCAACAGGTGACAGG - Intergenic
989130075 5:38098673-38098695 CTCCCCACTCAAATGGTTCAAGG - Intergenic
989705724 5:44328005-44328027 CTTCCCACTCACAAAGTTCAAGG + Intronic
990368310 5:55092179-55092201 CTCCCCTTTCAGCAGGTGAATGG + Intergenic
991129327 5:63104107-63104129 CTCACCACTGGCCAGGGGCAGGG + Intergenic
992411632 5:76510901-76510923 CACCCCTCTCACCAGCTGCAAGG + Intronic
993032554 5:82721939-82721961 CAGCCAACTCACTAGGTGCAAGG + Intergenic
993134662 5:83943973-83943995 CTCCACATTCACAAGGGGCAAGG + Intronic
993426451 5:87770881-87770903 CTCCCCACTCCCCAGCTCCCCGG + Intergenic
995014477 5:107294496-107294518 CTCCCCACCCACCAGGCACTGGG + Intergenic
997294878 5:132762996-132763018 CTCCCCACTAAGCAGGTAAAAGG + Intronic
997788899 5:136738890-136738912 CTACCCTCTCCCCAGATGCACGG + Intergenic
998475926 5:142421821-142421843 TTCCCCACTCACCAGCTGTGTGG + Intergenic
999283562 5:150380550-150380572 CTCCCCACTCTCCAGGGTCCAGG - Intronic
999361381 5:150989231-150989253 TTCCCCACACACCAGGCCCAAGG - Intergenic
1000031101 5:157402118-157402140 CCCCACACTCCCCAGGAGCAAGG + Intronic
1000489548 5:161893702-161893724 CTCGCCACCTACCAGCTGCATGG + Intronic
1001266496 5:170278298-170278320 CCCCCCACTCTGCATGTGCATGG - Intronic
1001379474 5:171294210-171294232 GCCCCCACTCACCAGGTGGGTGG + Intronic
1001831487 5:174793204-174793226 CCACCCAGTCAGCAGGTGCAAGG - Intergenic
1002313935 5:178331365-178331387 CTCTCCAGTCACCTGCTGCATGG + Intronic
1005463314 6:26089182-26089204 CTCCCTACTCACTAGGTGCTAGG + Intronic
1006139574 6:31920351-31920373 CTCCCCACTCCCCAGGATAAAGG + Intronic
1006314324 6:33280980-33281002 CTCTTCTCTCACCAGGTACATGG - Exonic
1006554320 6:34852570-34852592 CTCTCCTCTCCTCAGGTGCAAGG + Intronic
1006907031 6:37539506-37539528 CTCCCCACTTCCCGGCTGCATGG + Intergenic
1007828908 6:44623158-44623180 CTCCCTTGTCACCAGTTGCATGG + Intergenic
1009528168 6:64774463-64774485 CTCCACACTAAGCAGATGCATGG - Intronic
1009698865 6:67148224-67148246 TTCTCCACTCAACATGTGCAGGG + Intergenic
1017717859 6:157224641-157224663 CTCCCCACTCACCCCCTCCAAGG - Intergenic
1017870094 6:158479815-158479837 CTCCACACGCACCACGTACAGGG - Exonic
1017947530 6:159107846-159107868 AGCCCCACTGAGCAGGTGCACGG - Intergenic
1018196574 6:161360695-161360717 TTCCCCATTTGCCAGGTGCAAGG - Intronic
1018530324 6:164756218-164756240 CTCATCACTCAGCTGGTGCAGGG - Intergenic
1019657241 7:2202397-2202419 CTCGCCACTCTCCAGCTCCAGGG + Intronic
1021561561 7:21972689-21972711 CTCCCAACTCAGAAGGGGCAGGG + Intergenic
1021612825 7:22474814-22474836 CTCACCACTCACCACTGGCATGG - Intronic
1021972654 7:25980931-25980953 CTACACAGTCACCAGGTGCCAGG + Intergenic
1023058653 7:36309582-36309604 CTCCTCACCCACCAGGCCCAAGG - Intergenic
1023388255 7:39682221-39682243 CTGACCACTCACTAAGTGCAAGG - Intronic
1024838644 7:53556494-53556516 CTCCCCACTCTCCAGGTGCGTGG - Intergenic
1026730110 7:72904214-72904236 CTCTGCACTCAGCATGTGCATGG + Intronic
1026912126 7:74097069-74097091 CTCCCCAGCCACCTGGTGCGGGG - Exonic
1027113866 7:75462908-75462930 CTCTGCACTCAGCATGTGCATGG - Intronic
1027286118 7:76647513-76647535 CTCTGCACTCAGCATGTGCATGG - Intergenic
1027524019 7:79244853-79244875 CTCCCCACTCCTCAAGTGAAAGG - Intronic
1028531055 7:91839230-91839252 CTCCTCAGTCACCAATTGCATGG + Intronic
1031347760 7:120690564-120690586 CTTCCCATTCACCTGGTGAAGGG + Intronic
1032364248 7:131284676-131284698 CTTCCCTCTCACCAGGTGTGTGG + Intronic
1033324474 7:140366162-140366184 CTCCCCACTCCCAAAGTGCTAGG + Intronic
1035387386 7:158483241-158483263 CTCACCCCTCTCCAGGTTCATGG - Intronic
1036752323 8:11451109-11451131 CTCCCCACGCCCCAGGAGAAAGG - Intronic
1037525106 8:19716963-19716985 CTCCCCACTCAGTTGTTGCATGG + Intronic
1038357744 8:26845904-26845926 TTCCCCACTCCCCAAGTGCCTGG - Intronic
1038444261 8:27592706-27592728 CCCCACACTCCTCAGGTGCAGGG + Intergenic
1038498974 8:28027436-28027458 CTCCCCAGTGAGCAGATGCATGG - Intronic
1046271151 8:111899160-111899182 CTCCCCGCCCAGCAGGTGCCTGG + Intergenic
1048979312 8:139694631-139694653 CCCCCCACTCTCCAGATGCCTGG + Intronic
1049515149 8:143050515-143050537 CTCACTCCCCACCAGGTGCAGGG + Intronic
1049668570 8:143859559-143859581 CTCCTCGCTCAGCTGGTGCACGG + Exonic
1049668986 8:143861161-143861183 CTCCTCGCTCAGCTGGTGCACGG + Exonic
1049669401 8:143862763-143862785 CTCCTCGCTCAGCTGGTGCACGG + Exonic
1049669812 8:143864356-143864378 CTCCTCGCTCAGCTGGTGCACGG + Exonic
1049670228 8:143865964-143865986 CTCCTCGCTCAGCTGGTGCACGG + Exonic
1052384534 9:27807968-27807990 TTCCCCACACACCAGGCCCAAGG - Intergenic
1052436570 9:28437324-28437346 CTCCCCACTCACCACATTCTTGG + Intronic
1053866082 9:42438017-42438039 CACCTCACTCACGAAGTGCAAGG - Intergenic
1056655367 9:88504289-88504311 CACACCACACACCAGGAGCAGGG - Intergenic
1057171176 9:92964110-92964132 CTCTCCACTGATCAGGTGCTAGG - Intronic
1061923880 9:133796674-133796696 CTCTGCACACACCTGGTGCATGG - Intronic
1061939641 9:133877048-133877070 CTCCCCACCCACCTGGGGAAAGG + Intronic
1061953250 9:133948274-133948296 CTCCGCACGCACCAGGACCAAGG + Intronic
1062026827 9:134344411-134344433 CTCCTGACTCAGCAGCTGCAGGG + Intronic
1062207713 9:135346598-135346620 CTCCCCTCCCACCAGCTCCACGG + Intergenic
1062267748 9:135695148-135695170 CTCCCCGCTCATCACGGGCAAGG + Exonic
1062571227 9:137186284-137186306 CTCCCGGGTCACCTGGTGCAGGG + Exonic
1186799547 X:13079185-13079207 CTCCCCACTCTGCATGTGCCTGG - Intergenic
1189657447 X:43260398-43260420 CTTCCCACTAACAGGGTGCAAGG + Intergenic
1190455743 X:50626321-50626343 CTGCCCCCTTACCAGGTGCCAGG + Intronic
1195520061 X:105820427-105820449 CGCCCCCCTCCCCAGGTGCGGGG - Intergenic
1196336790 X:114546099-114546121 CTATCAACTCACTAGGTGCACGG - Intergenic
1198030287 X:132747836-132747858 CTCCACACTCTCCAGGTGGGAGG + Intronic
1198767347 X:140092464-140092486 CCCCCCACTGTCCAGGTGGAGGG - Intergenic