ID: 923369359

View in Genome Browser
Species Human (GRCh38)
Location 1:233295319-233295341
Sequence CACTCACCAGGTGCAGGGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 1, 2: 1, 3: 46, 4: 369}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923369340_923369359 14 Left 923369340 1:233295282-233295304 CCTCCATACCCACAGCTCCCCGG 0: 1
1: 0
2: 0
3: 27
4: 269
Right 923369359 1:233295319-233295341 CACTCACCAGGTGCAGGGCCAGG 0: 1
1: 1
2: 1
3: 46
4: 369
923369339_923369359 15 Left 923369339 1:233295281-233295303 CCCTCCATACCCACAGCTCCCCG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 923369359 1:233295319-233295341 CACTCACCAGGTGCAGGGCCAGG 0: 1
1: 1
2: 1
3: 46
4: 369
923369337_923369359 29 Left 923369337 1:233295267-233295289 CCTTTCTCCTTCTTCCCTCCATA 0: 1
1: 1
2: 13
3: 128
4: 1189
Right 923369359 1:233295319-233295341 CACTCACCAGGTGCAGGGCCAGG 0: 1
1: 1
2: 1
3: 46
4: 369
923369346_923369359 5 Left 923369346 1:233295291-233295313 CCACAGCTCCCCGGGACCGGACC 0: 1
1: 0
2: 1
3: 9
4: 175
Right 923369359 1:233295319-233295341 CACTCACCAGGTGCAGGGCCAGG 0: 1
1: 1
2: 1
3: 46
4: 369
923369343_923369359 11 Left 923369343 1:233295285-233295307 CCATACCCACAGCTCCCCGGGAC 0: 1
1: 0
2: 1
3: 17
4: 189
Right 923369359 1:233295319-233295341 CACTCACCAGGTGCAGGGCCAGG 0: 1
1: 1
2: 1
3: 46
4: 369
923369338_923369359 22 Left 923369338 1:233295274-233295296 CCTTCTTCCCTCCATACCCACAG 0: 1
1: 0
2: 4
3: 86
4: 576
Right 923369359 1:233295319-233295341 CACTCACCAGGTGCAGGGCCAGG 0: 1
1: 1
2: 1
3: 46
4: 369
923369349_923369359 -5 Left 923369349 1:233295301-233295323 CCGGGACCGGACCCTCCCCACTC 0: 1
1: 0
2: 1
3: 20
4: 269
Right 923369359 1:233295319-233295341 CACTCACCAGGTGCAGGGCCAGG 0: 1
1: 1
2: 1
3: 46
4: 369
923369347_923369359 -3 Left 923369347 1:233295299-233295321 CCCCGGGACCGGACCCTCCCCAC 0: 1
1: 0
2: 1
3: 11
4: 195
Right 923369359 1:233295319-233295341 CACTCACCAGGTGCAGGGCCAGG 0: 1
1: 1
2: 1
3: 46
4: 369
923369348_923369359 -4 Left 923369348 1:233295300-233295322 CCCGGGACCGGACCCTCCCCACT 0: 1
1: 0
2: 0
3: 8
4: 201
Right 923369359 1:233295319-233295341 CACTCACCAGGTGCAGGGCCAGG 0: 1
1: 1
2: 1
3: 46
4: 369
923369345_923369359 6 Left 923369345 1:233295290-233295312 CCCACAGCTCCCCGGGACCGGAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 923369359 1:233295319-233295341 CACTCACCAGGTGCAGGGCCAGG 0: 1
1: 1
2: 1
3: 46
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923369359 Original CRISPR CACTCACCAGGTGCAGGGCC AGG Exonic
900502679 1:3014200-3014222 CAGACACCAGGAGCCGGGCCTGG + Intergenic
900506584 1:3032434-3032456 CCACCACCTGGTGCAGGGCCTGG + Intergenic
900594817 1:3475957-3475979 GCCTCACCAGCTGCAGGGCATGG - Exonic
900728163 1:4232369-4232391 AATTCACCATGTTCAGGGCCGGG + Intergenic
900780684 1:4615556-4615578 CTCTCCCCATGTGCAGGGGCAGG + Intergenic
901074581 1:6545475-6545497 CACTCACCTGGTCTAGAGCCAGG - Intronic
901536047 1:9883570-9883592 CACACACCAGGTGCTGGATCAGG - Intronic
901649967 1:10737728-10737750 CACTCACCAAGGCCAGGGCCTGG + Intronic
902917490 1:19647522-19647544 CACTCACTAAGGGCAGGGTCTGG - Intronic
902939164 1:19787326-19787348 CACTCACCATGTGCTGGGCACGG + Intronic
903066989 1:20705153-20705175 CTGTCTCCAGGAGCAGGGCCTGG + Intronic
903154931 1:21436788-21436810 CAAGCACCAGCTGCAGGTCCAGG + Intergenic
903559808 1:24218765-24218787 CAGCCAGCAGGAGCAGGGCCAGG - Intergenic
904456999 1:30653834-30653856 CACCCATCAGATGCAGGGCTCGG - Intergenic
905305291 1:37013713-37013735 CACTCACCAAGAGCAGCTCCAGG + Intronic
905312850 1:37062482-37062504 CACTCACCAGGAGCTAGGACAGG + Intergenic
905654831 1:39679635-39679657 CTCTCAGCTGGTGCAGGGACGGG + Exonic
906193703 1:43915453-43915475 CACTCACCATGTGCAGATCCTGG - Intronic
907841781 1:58165277-58165299 TACTCACCAAGTGCCTGGCCCGG + Intronic
909194071 1:72593917-72593939 CTCTCAACAGTTGCAGGGCATGG + Intergenic
909985305 1:82154423-82154445 CACTCTGCTGGTGCAGGGGCTGG + Intergenic
912496858 1:110097484-110097506 CAGGCACCAGGAGAAGGGCCTGG - Intergenic
913173513 1:116253621-116253643 AACTCACCAAGTACAGGGACTGG + Intergenic
915243684 1:154541629-154541651 CGGTCACCTGGTGCAGGGCTGGG - Intronic
915296722 1:154926474-154926496 CACTCACCAGCTGCAGGAGAGGG + Exonic
916070540 1:161167219-161167241 CTCTCACCAGGAGCAAGGTCCGG - Exonic
916710478 1:167401568-167401590 TGCTCAGCAGGTGCATGGCCTGG - Intronic
916809049 1:168289692-168289714 CACTCACTAGGTGCCAGGCATGG - Intronic
917243385 1:172973733-172973755 CACTCAACATGTGCTGGCCCTGG - Intergenic
918176355 1:182049144-182049166 CATTCATGAGGGGCAGGGCCTGG - Intergenic
919788484 1:201275297-201275319 CACTCAGCAGGTTCCTGGCCTGG + Intergenic
920328238 1:205184128-205184150 CACACACCAGGAGCAGGCCCTGG + Intronic
920831823 1:209472385-209472407 CACTGACCAGGGCCAGAGCCTGG + Intergenic
920955770 1:210619131-210619153 CACTCTTCAGGTGCAAGGGCAGG - Intronic
921340784 1:214132273-214132295 CACTCTGCAGGTCCAAGGCCTGG + Intergenic
922883870 1:229003405-229003427 CACTGGCCTGGTGCGGGGCCTGG - Intergenic
923218908 1:231875335-231875357 CACTCACCAGGGCCGGGGGCTGG - Intronic
923369359 1:233295319-233295341 CACTCACCAGGTGCAGGGCCAGG + Exonic
923857913 1:237864613-237864635 CACTCCACACGCGCAGGGCCCGG - Intergenic
924527545 1:244865141-244865163 CACACCCCGGGTGCGGGGCCTGG + Intergenic
1062907943 10:1191337-1191359 CACTCAGCAGGTGCACGTGCCGG - Intronic
1063118277 10:3086382-3086404 CACTCAGCATGTTCAGGGCCAGG + Intronic
1063129988 10:3169963-3169985 CACACAGCAGGAGCTGGGCCAGG + Intronic
1063382635 10:5595856-5595878 CTCTCACCAGGAGAAGAGCCAGG + Intergenic
1064097263 10:12433104-12433126 CACACACCAGGTGCTCGGTCAGG + Intronic
1064119312 10:12605490-12605512 GAATCACCAGGTGCTGGGCAGGG - Intronic
1064143109 10:12806672-12806694 AACTGAGCAGGTGGAGGGCCAGG + Intronic
1064303290 10:14141718-14141740 CAACCACCAGGTGCAGTGCAAGG - Intronic
1064342606 10:14500330-14500352 CACACCCAACGTGCAGGGCCAGG - Intergenic
1065835101 10:29650016-29650038 CCCTCACCAGATGCAGCCCCTGG + Intronic
1067148656 10:43711818-43711840 GAGACACCAGGTCCAGGGCCAGG + Intergenic
1067571929 10:47378067-47378089 CTCTCTCTAGGGGCAGGGCCAGG - Intronic
1068212986 10:53946194-53946216 CTCTCACCAGGTTCAGGCACTGG + Intronic
1069857902 10:71451790-71451812 CGCACACCAGGCGCAGGGCTAGG - Intronic
1070632204 10:78094659-78094681 CCAACACGAGGTGCAGGGCCAGG - Intergenic
1071559377 10:86633082-86633104 CACTAACCAGAGGCAGGGGCAGG + Intergenic
1071835799 10:89415606-89415628 CACTAACCACGTGCAGGGCGGGG - Intronic
1071977979 10:90974674-90974696 CACTTGCCAGGAGCAGGTCCAGG - Intergenic
1072749063 10:97963521-97963543 ACCTCACCAGCTTCAGGGCCTGG + Intronic
1072801555 10:98395614-98395636 CTCTCACTAGCTGCAGTGCCTGG + Intronic
1072971303 10:100020135-100020157 CACCCACCTGCAGCAGGGCCTGG + Intergenic
1073331201 10:102670923-102670945 CAGCCACCAGGAGCAGGGGCAGG - Intergenic
1075777060 10:124995958-124995980 CACTCTGCAGATCCAGGGCCTGG + Intronic
1077010120 11:375941-375963 CACTCACAAATTGCAGGCCCTGG - Exonic
1077021172 11:417738-417760 AACACCCCAGGTGCAGGGACGGG + Intergenic
1077047015 11:551172-551194 CATTCCCCAGCTGCAGGTCCTGG + Exonic
1077164741 11:1129969-1129991 CCCTCAGCCGGCGCAGGGCCAGG + Intergenic
1077407732 11:2390174-2390196 CACTCCACAGGTGCAGGGCAGGG + Intronic
1077447679 11:2606572-2606594 CCCTCACCAGGAGCAGGTGCTGG + Intronic
1077610346 11:3639993-3640015 CTCGCAGCAGCTGCAGGGCCCGG + Exonic
1078087977 11:8245867-8245889 GACTCACCAGGAGCAGAGGCTGG - Intronic
1078668766 11:13346837-13346859 CACACACCATGTGGATGGCCAGG + Intronic
1081910390 11:46696396-46696418 CCCTCCCCAGCTGCAGGGCCTGG - Intronic
1081976207 11:47236663-47236685 TACTTACCAGGTGCTGGGCATGG - Intronic
1083164073 11:60872911-60872933 CTCCCACCAGGTGCAGGGCCTGG + Intronic
1083436892 11:62648891-62648913 GGCTCACCAGGTGCACAGCCAGG + Exonic
1083934617 11:65863741-65863763 CTGGCACCAGGGGCAGGGCCTGG + Intronic
1084065995 11:66704797-66704819 CACGCCCGAGGTGCAGAGCCGGG - Exonic
1084589905 11:70084565-70084587 CCCTCTCCAGCTGCAAGGCCTGG - Intronic
1085527411 11:77172444-77172466 AGCGCACCAGGTGCAGGGGCAGG + Intronic
1086462330 11:87018224-87018246 CACTGAGCTGCTGCAGGGCCTGG + Intergenic
1087084033 11:94198508-94198530 CACTTACTAGCTGCAGGGCCTGG + Intergenic
1087191803 11:95262494-95262516 CACTCACCATGTGCCGGGCATGG - Intergenic
1087220582 11:95542536-95542558 CACTCACCATGAGTAGGGTCAGG + Intergenic
1089821449 11:121230920-121230942 CCCTCACCAGGAGCAGACCCTGG - Intergenic
1089976072 11:122732470-122732492 GACTTACAACGTGCAGGGCCTGG - Intronic
1091568229 12:1662865-1662887 CACCCACCAGCTGCAAGGACGGG + Intergenic
1091590823 12:1842170-1842192 TTCCCACCAGGTGCTGGGCCAGG - Intronic
1091845638 12:3654306-3654328 CACTAACCAGGAGCTGGCCCGGG - Exonic
1095977182 12:47947685-47947707 CACTGTCCTGGCGCAGGGCCTGG - Intergenic
1096292189 12:50352178-50352200 CCCTCAGCAGGTCCAGGCCCTGG - Exonic
1096292377 12:50352862-50352884 CCCTCAGCAGGCGCAGGCCCTGG - Exonic
1096292540 12:50353438-50353460 CCCTCAGCAGGCGCAGGCCCTGG - Exonic
1096523491 12:52197271-52197293 CACTCAGCAGGTGCAGGGAAAGG - Intergenic
1097107664 12:56634938-56634960 GCCTCACCTGGAGCAGGGCCGGG + Intronic
1097192111 12:57224518-57224540 AACCAACCAGGTGCCGGGCCAGG + Intronic
1097198613 12:57259286-57259308 CCCTCACCAGGTGAAGGCCAGGG - Intronic
1103014669 12:117484661-117484683 CACTCAACAGAGGCAGGGCCTGG + Intronic
1103072139 12:117953630-117953652 CAGTTACCATGTGCTGGGCCAGG + Intronic
1103623121 12:122200805-122200827 CATCCTCCAGGTGCTGGGCCGGG + Exonic
1104324138 12:127779915-127779937 CAATCACCGGTTGCAGGTCCTGG + Intergenic
1104752714 12:131250303-131250325 CATTCCCCAGGAGCTGGGCCAGG + Intergenic
1105605650 13:21924516-21924538 CACATTCCTGGTGCAGGGCCAGG - Intergenic
1107149091 13:37091195-37091217 CTCTGAGCAGGGGCAGGGCCAGG + Intergenic
1107978699 13:45714084-45714106 CTCTCAGCAGCTGCAGGGGCTGG - Exonic
1113503791 13:110799074-110799096 CACGCACTAGCTGCACGGCCTGG + Intergenic
1115456645 14:33611998-33612020 CACTCAGCATCTGCAGGGCCAGG - Intronic
1117830407 14:59744288-59744310 CAGTCACCAGGGGCAGGGGAAGG + Intronic
1118721823 14:68599904-68599926 CACTCTGCAGGACCAGGGCCTGG - Intronic
1119428297 14:74550158-74550180 CACACACAAGGTTCAGGGCTGGG - Intronic
1119519217 14:75273391-75273413 TAATCACCATGTGCAGGGCCAGG - Intergenic
1119523132 14:75301148-75301170 AGCTCACCATGTGCTGGGCCCGG - Intergenic
1121406302 14:93721215-93721237 CACTGCCCAGGTGCTGCGCCGGG + Exonic
1122016881 14:98803825-98803847 CACTTGCCAGGTGCTGGGCTGGG - Intergenic
1122157632 14:99759756-99759778 CCCTCAGCAGCAGCAGGGCCTGG + Intronic
1122238950 14:100349170-100349192 CACTCCCCAGGTGCCAGGCGTGG + Intronic
1122410223 14:101521923-101521945 CACTTACTGTGTGCAGGGCCTGG + Intergenic
1122743007 14:103882653-103882675 CACTCAGCCTGGGCAGGGCCGGG - Intergenic
1122812615 14:104296485-104296507 CCCTCGCCCTGTGCAGGGCCTGG + Intergenic
1122928948 14:104924572-104924594 CACTAAGCAGGTCCAGGGGCTGG - Intergenic
1122978186 14:105179591-105179613 CAGGCAGCAGGTGCAGGCCCAGG - Intronic
1202901997 14_GL000194v1_random:49567-49589 GACTCCCCAAGTGCAGGGCAGGG + Intergenic
1124213092 15:27780161-27780183 CTCTCAGCATGTGGAGGGCCTGG - Intronic
1127309270 15:57738016-57738038 CTCTCACCAGCTGCAGGGGTTGG + Intronic
1127766923 15:62195402-62195424 CACTCCCCCGGGGCAGGGCTGGG - Intergenic
1128330144 15:66750455-66750477 CCCACACCAGGTACAGGGCTGGG - Intronic
1129196476 15:73970348-73970370 CACTCACTATGTGCTGGGCAAGG - Intergenic
1129597012 15:76973304-76973326 CCCACCCCAGGTGCAGGGGCAGG - Intergenic
1129714482 15:77839250-77839272 CACTTACCAGGCACAGGTCCTGG - Intergenic
1129853914 15:78811114-78811136 CACCCACCTGGTGCGGGTCCGGG + Exonic
1130546421 15:84859934-84859956 CACCCACCAGGAGCCAGGCCAGG - Intronic
1131179323 15:90229244-90229266 CCCTCACCAGGTCCTGGGCTCGG + Exonic
1131263788 15:90903719-90903741 CACTCACCAGAAACAGTGCCTGG - Intronic
1131387444 15:92018911-92018933 CACTCCCCTGGTGCTGGGCCTGG + Intronic
1131686466 15:94773283-94773305 CAGGCACCAGGTGCAGGGCTAGG - Intergenic
1132336737 15:101052767-101052789 CACCCACAAGTGGCAGGGCCGGG + Intronic
1132564226 16:613467-613489 CACTCAGCGGATGGAGGGCCTGG + Intronic
1132612436 16:824080-824102 CATTCTCCAGGGGCTGGGCCAGG + Intergenic
1133100877 16:3478860-3478882 CACTCACCTGGTGGAGGAACAGG + Intronic
1133180239 16:4048866-4048888 CACTCCCCAGGAGAAGAGCCAGG + Intronic
1134003713 16:10803388-10803410 CATCTACCAGGTGGAGGGCCAGG + Intronic
1134054688 16:11162297-11162319 GACTCACCAAGAGCAGGGCCAGG - Intronic
1134608918 16:15592528-15592550 GGCTTCCCAGGTGCAGGGCCTGG - Intronic
1134978793 16:18591036-18591058 CAGCCACCAGCGGCAGGGCCAGG - Intergenic
1136514688 16:30761191-30761213 CACTCACCACATGCAGATCCGGG + Exonic
1139592389 16:67940525-67940547 CACTCAGCAGGTTGTGGGCCAGG - Intronic
1139631567 16:68234829-68234851 AACTCCCCAAGTGAAGGGCCGGG + Intronic
1140196350 16:72858818-72858840 CCCTGACCCGCTGCAGGGCCTGG - Intronic
1141947859 16:87322807-87322829 CACCCACCAGGTGCCAGGCCAGG + Intronic
1142121737 16:88389903-88389925 CACTCTCCACATGCAGGGCCAGG + Intergenic
1142617390 17:1144308-1144330 CACACACCAGATGCAGGGGCGGG + Intronic
1143455596 17:7065602-7065624 CAGTCACCAGCTGCAGGACTTGG + Intergenic
1144627966 17:16854767-16854789 CAGTCACCAGGTGCTGCTCCTGG - Intergenic
1144852021 17:18248648-18248670 CACACTGCTGGTGCAGGGCCAGG - Exonic
1145292840 17:21563509-21563531 AACTCCACAGGTGCAGGGCTTGG + Intronic
1145387121 17:22422426-22422448 AACTCCACAGGTGCAGGGCTTGG - Intergenic
1145774611 17:27519278-27519300 CACTCTCCAGTTGCAGGTCAGGG + Intronic
1147155755 17:38543816-38543838 CCCTCACCTGCTGCTGGGCCTGG + Exonic
1147374629 17:40016325-40016347 CACTCACCAGCTGCAGGGCCTGG - Exonic
1148338846 17:46861175-46861197 CATGCACCAAGTGCAGGGCCTGG - Intronic
1150673315 17:67221587-67221609 CACTCTCCAGCTGCATAGCCTGG + Intronic
1151367150 17:73625071-73625093 AACTCACAAGCAGCAGGGCCAGG + Intronic
1151535944 17:74738752-74738774 CACTCCCCTGGGGCAGGCCCGGG - Intronic
1151964055 17:77422183-77422205 CCCTTCCCAGGTGCAGGACCCGG + Intronic
1152391633 17:80007215-80007237 CCTTCATCAGGAGCAGGGCCGGG + Intronic
1152609963 17:81310545-81310567 GAGTCACCATGTGCCGGGCCTGG + Intergenic
1153466857 18:5397599-5397621 CATGCACCAGGGGCAGGGGCAGG - Intronic
1156244503 18:35284617-35284639 CAGTCACCAGGAGCAGGGAGAGG + Intronic
1157966621 18:52216051-52216073 CACACACCAGCTGCAAGTCCAGG + Intergenic
1157987470 18:52455462-52455484 CACTCACCAGCTACATGACCTGG + Intronic
1158585385 18:58728781-58728803 CATTCAGCAGTTGCAGGGCTGGG + Intronic
1160179476 18:76621179-76621201 CACCTACCATGTGCAGGGCAAGG - Intergenic
1160186588 18:76680892-76680914 CACTGGGCAGGTGCAGAGCCTGG - Intergenic
1161014755 19:1978161-1978183 CACTGCCCAGCAGCAGGGCCTGG - Intronic
1161097526 19:2401436-2401458 CACTCACCAGCCCCAGGGCTCGG - Intronic
1161454936 19:4365389-4365411 CACTCAGCACATGCAGGGCCTGG + Intronic
1161783543 19:6309573-6309595 CACTAACAAGTAGCAGGGCCAGG - Intronic
1162896640 19:13768526-13768548 CACCCACCAGGAGAAGGCCCCGG - Intronic
1162904366 19:13814777-13814799 CACTTGCCAGCCGCAGGGCCTGG - Intronic
1163849652 19:19655865-19655887 CACATCCCAGGTGCGGGGCCAGG - Exonic
1164778445 19:30872914-30872936 CACCCACCAGGCACAGGCCCTGG - Intergenic
1165383779 19:35498644-35498666 CAGTCACCCGGGGCAGGGCCAGG - Intronic
1165465973 19:35975042-35975064 CACTCAATAGCTGCAGGGGCAGG - Intergenic
1165923842 19:39314970-39314992 TGCTGTCCAGGTGCAGGGCCCGG + Exonic
1167117853 19:47498406-47498428 CACACACCAGGTGCCGCGCTGGG + Intronic
1167768229 19:51498219-51498241 CACAGACAAGGTGCAGGGACTGG + Exonic
1168354260 19:55692003-55692025 CCCTCCCCAGCTGCAGGGGCTGG - Exonic
1168723927 19:58570503-58570525 CACAGTCCAGGTGCAGGGCCAGG - Exonic
925117130 2:1389126-1389148 CACTCAGGAGGGGCAGGGCCTGG + Intronic
925157797 2:1660718-1660740 CACTCTCCTGATGCATGGCCGGG - Intronic
925749381 2:7073838-7073860 CACAGACCAGATGGAGGGCCTGG - Intergenic
926786357 2:16522206-16522228 CACCCACCAGAGGCAGGCCCTGG - Intergenic
927151737 2:20200149-20200171 CCATCAGCAGGTGCAGGGGCGGG + Intergenic
928203685 2:29268798-29268820 CACTAATCAAATGCAGGGCCAGG - Intronic
929133512 2:38602186-38602208 CCCTCCCCAAGTTCAGGGCCCGG + Intronic
931463981 2:62471043-62471065 CTCTCTCCAGATGCAGGGTCTGG + Intergenic
931542284 2:63342276-63342298 CCCTAACCAGGTCCATGGCCTGG + Intronic
931869656 2:66444702-66444724 CACTCAACAGCTCCCGGGCCAGG - Intronic
933785583 2:85838686-85838708 TCCTCACCATATGCAGGGCCAGG - Intergenic
934133188 2:88969545-88969567 CACAGACCAGGGCCAGGGCCTGG - Intergenic
934158221 2:89222934-89222956 CACTCACCAGGTGCCAGGGGAGG - Intergenic
934209043 2:89959490-89959512 CACTCACCAGGTGCCAGGGGAGG + Intergenic
934663185 2:96153992-96154014 AACTCACCCAGAGCAGGGCCTGG + Intergenic
936011014 2:108925340-108925362 CACACCCCAGGTGCCGGGCTTGG + Intronic
936076399 2:109404452-109404474 CACTCTGCAGGGGCAGGGACAGG + Intronic
936453774 2:112654745-112654767 AACTAACCAGGTGCAGTGGCAGG + Intronic
936835078 2:116699864-116699886 CTCTCACGAGGTGCTGGGCCGGG + Intergenic
938248413 2:129796320-129796342 CCCTGCCCAGTTGCAGGGCCTGG + Intergenic
938377059 2:130814951-130814973 CACTCAGCAGGCACAGGGACTGG - Intergenic
938959604 2:136329449-136329471 CACCCCTCAGGTGCAGGACCAGG + Intergenic
940634176 2:156277253-156277275 CACTAGCCAGGTGCATGGCCAGG + Intergenic
944654642 2:201865367-201865389 CATCCACCAGGAGCAAGGCCTGG + Intronic
946024820 2:216665363-216665385 CACTCACCAGATGGAAGGTCTGG - Intergenic
947545217 2:231005683-231005705 GAATTGCCAGGTGCAGGGCCTGG - Intronic
947916998 2:233839270-233839292 CACCCACCATGTGCAGCCCCTGG + Intronic
948040980 2:234901271-234901293 CACCCACCAGCCGCAGGGGCTGG - Intergenic
948455910 2:238104550-238104572 CAGTCATCACGGGCAGGGCCAGG + Intronic
948530264 2:238599671-238599693 GCCTCACCAGCTGCAGGGCAGGG + Intergenic
1168779448 20:476547-476569 AACTCACTAGGTGCCGGGCATGG - Intronic
1168834191 20:866349-866371 CAGTCCCCAGCTGCAGGGCTAGG - Intergenic
1170684422 20:18556192-18556214 CACTCACCTGGTGTGTGGCCTGG + Intronic
1171102242 20:22394989-22395011 GATGCACCAGGTGCAGGACCAGG - Intergenic
1171183403 20:23107704-23107726 CACTGACCAGCTGCAGGGCAGGG - Intergenic
1171460848 20:25297086-25297108 CATATACCAGGTGCAGAGCCAGG - Exonic
1171463110 20:25309804-25309826 CAGTCAGCAGGGGCAGGGCAGGG - Intronic
1172128074 20:32636993-32637015 GAGTCACCAGGGGCAGGGGCTGG + Intergenic
1172474728 20:35227713-35227735 CACTCACTATGTGCCAGGCCTGG + Intronic
1172640909 20:36439941-36439963 CACTCAGCATGGGCTGGGCCTGG - Intronic
1173741280 20:45404246-45404268 CACTTACTAGCTGTAGGGCCTGG + Intronic
1173789282 20:45817327-45817349 CCCTAAGCAGGTCCAGGGCCTGG + Intergenic
1174063057 20:47845910-47845932 CTCTGTCCAGGAGCAGGGCCAGG + Intergenic
1174072666 20:47909764-47909786 CTCTGTCCAGGAGCAGGGCCAGG - Intergenic
1175153655 20:56954793-56954815 TTCACGCCAGGTGCAGGGCCAGG - Intergenic
1175295178 20:57903355-57903377 CCATCACCAGGAGCAAGGCCTGG + Intergenic
1176052860 20:63129796-63129818 CACACCCCAGGAGCAGGGCAGGG - Intergenic
1176621366 21:9064334-9064356 GACTCCCCAAGTGCAGGGCAGGG + Intergenic
1177305892 21:19315939-19315961 CACACACCAAGGGCAGGACCAGG - Intergenic
1179125632 21:38588336-38588358 CACTGGCCAGGGGCAGGGCTTGG - Intronic
1179600481 21:42474351-42474373 GACTCACCTGGGGCAGGACCAGG - Intronic
1180844663 22:18974605-18974627 CACCCACCAGGTCTAGGGGCTGG + Intergenic
1180975522 22:19845770-19845792 CACTCTCCTGGTGCAGGCCTCGG - Intronic
1181033891 22:20160868-20160890 CCCTCACCCAGTGCAGGGCCAGG + Intergenic
1181509463 22:23382535-23382557 CCCTCACGCAGTGCAGGGCCAGG - Intergenic
1181572038 22:23772963-23772985 CACTCACCGGCGGCAGAGCCCGG - Exonic
1181674312 22:24441831-24441853 CACTCCCCAGTCTCAGGGCCAGG - Exonic
1181726543 22:24814984-24815006 CAGCAACCAAGTGCAGGGCCAGG - Intronic
1181785212 22:25221834-25221856 CACACAGCAGGTGCAGAGCCAGG - Intronic
1182473472 22:30562635-30562657 CATTCACCAGGTGCCAGGCTCGG - Intronic
1182483788 22:30627081-30627103 TACTCCTCAGGTGCAGGGGCAGG + Exonic
1183040683 22:35175581-35175603 CCCACACCTAGTGCAGGGCCTGG + Intergenic
1183346778 22:37312444-37312466 CACTCACCACGTGCCAGGCAAGG - Intronic
1183363606 22:37395736-37395758 CACACACCAGGTCCTGGGCTTGG + Intronic
1183529846 22:38347437-38347459 CCCTCAAGAGATGCAGGGCCAGG + Intronic
1183946225 22:41327349-41327371 CACTCACGTGGGGCAGGGCGAGG - Exonic
1184678228 22:46054715-46054737 CCCTCACCCGGTACAGGGCTGGG - Intronic
1184935325 22:47716602-47716624 CAGGCCCCAGGTGCAGGCCCTGG + Intergenic
949954429 3:9255994-9256016 CAAACACCAGATGCAGGGTCAGG - Intronic
950525518 3:13520680-13520702 CACACAGCATGTGCAGGGCAGGG - Intergenic
950571056 3:13800308-13800330 CACTTGCCGGGTGCAGGGCAAGG + Intergenic
950739849 3:15041561-15041583 CACTATCCAGGGGCAGGGCGTGG + Intronic
951890021 3:27559825-27559847 CACTCACCAGCTGCGTGACCTGG - Intergenic
952638251 3:35557727-35557749 AACTGACCTGGTGCTGGGCCAGG - Intergenic
953043819 3:39278059-39278081 CAGTCACCAAGTGCAGAGCCAGG + Intronic
953067721 3:39489699-39489721 CTCTCACCAGGGGCTGGGACAGG - Intronic
953702387 3:45206813-45206835 CACTTACCAGGTGCAAGGTGTGG + Intergenic
954276933 3:49548314-49548336 AGCTCTCCAGGTTCAGGGCCTGG + Intergenic
954392842 3:50276427-50276449 CACTCAACACGTGCAGCGACAGG - Exonic
954400762 3:50318337-50318359 GGTTCACCAGGTGCATGGCCAGG + Exonic
954462291 3:50634217-50634239 CACACCTCAGGTGCATGGCCAGG + Intronic
954616553 3:51971619-51971641 CACCATCCAGGTGCAGGGCCAGG - Exonic
954714524 3:52520534-52520556 CCCTCACCAGTCGCAGGGGCCGG - Exonic
954957037 3:54530292-54530314 CACCCACCAAGTGCCGGGCCAGG - Intronic
955396543 3:58561807-58561829 CACTTTCCAGGAGCAAGGCCTGG + Intergenic
957701520 3:83721643-83721665 CTCTGACCCGGTGCAGGGCTAGG - Intergenic
959105418 3:102059382-102059404 CCCTCACCAGGTGCAGACGCTGG + Intergenic
959574634 3:107921315-107921337 CACTCCCCGGGTGCAGAGGCAGG - Intergenic
959965372 3:112347778-112347800 CAGTCCCCAGGTGCAGCACCTGG - Exonic
960026820 3:113019535-113019557 CACTCACCAAGGGCCGCGCCGGG + Exonic
961021591 3:123512019-123512041 CCCTCACCAGATGCAGGTGCTGG + Intronic
961372592 3:126440637-126440659 AACTCCCCAGGAGCAGGGGCAGG - Intronic
961448007 3:126990099-126990121 CAAGCACCAGGTGTAGGACCAGG - Intronic
961909471 3:130300231-130300253 AACTCACCAGTTGCAGAGCCAGG + Intergenic
962095656 3:132289825-132289847 CACTAACCAAGTGCAGGGCAAGG + Intergenic
962252321 3:133843274-133843296 CACTCATCAGTAGCAGGGCTGGG + Intronic
962312575 3:134336969-134336991 CCCTCACCTGAGGCAGGGCCTGG + Intergenic
962400540 3:135055578-135055600 CACTCACTAGGTTGAGGGCCTGG + Intronic
962828695 3:139121139-139121161 CACTCTCCAGGTGCAGGTTTGGG - Intronic
963687194 3:148451109-148451131 CCCTCACCAGGAGCAGAGGCTGG + Intergenic
963891333 3:150638837-150638859 CAGACACCAGTTGCAGGTCCTGG - Intergenic
963904433 3:150762546-150762568 TACACACCAGGTGCCCGGCCTGG + Exonic
963912830 3:150829528-150829550 CACTCACCTGATGCAGTTCCAGG + Intergenic
964093301 3:152900983-152901005 CTATCACTGGGTGCAGGGCCAGG - Intergenic
965460601 3:168957296-168957318 CACTCACAAAGAGCAGGGTCTGG + Intergenic
966784642 3:183612091-183612113 AACTATACAGGTGCAGGGCCTGG - Intergenic
967977979 3:195046008-195046030 CACTCACTGTGTGCAGGGCCCGG + Intergenic
968125957 3:196160462-196160484 CACTCACCAAGAGCAAGGCCTGG + Intergenic
968914967 4:3493385-3493407 GGCTCGCCAGGGGCAGGGCCAGG - Exonic
968942412 4:3645728-3645750 CAGACGTCAGGTGCAGGGCCTGG + Intergenic
968982345 4:3857068-3857090 CACCAAGCAGGTGCAAGGCCAGG + Intergenic
969078363 4:4598844-4598866 CACTCCCAAGGGGCAGGGGCTGG + Intergenic
969184657 4:5466193-5466215 CCCTGGCCAGGAGCAGGGCCAGG + Intronic
969308949 4:6340938-6340960 AGCTCTCCAGGTGCAGGACCAGG - Intronic
969658997 4:8515519-8515541 GTGTCACCAGGGGCAGGGCCAGG + Intergenic
970454087 4:16204657-16204679 CACTGGCCAGGTGCTGGGCTTGG + Intronic
971979888 4:33738131-33738153 CACTCAGCACTTGCAGAGCCAGG - Intergenic
977996045 4:103498236-103498258 CACTGTCCAGCTGTAGGGCCAGG + Intergenic
984997604 4:185450824-185450846 CATTCACCAGGGGCAGGGGCTGG + Intronic
985541796 5:490834-490856 CACCCACCAGGTGCAGCCCAGGG - Intronic
993669858 5:90747305-90747327 GGTTCAACAGGTGCAGGGCCAGG + Intronic
993743190 5:91564577-91564599 CACACATCAAGGGCAGGGCCAGG - Intergenic
995451997 5:112312513-112312535 CAGGCACCTGGAGCAGGGCCAGG + Intronic
998177624 5:139911580-139911602 TACTCACCTGCAGCAGGGCCTGG - Intronic
998491298 5:142549121-142549143 TACTCACCGTGTGCAGGGCAGGG + Intergenic
999260091 5:150232927-150232949 CACATACCAGGTGGAGAGCCTGG + Intronic
999418741 5:151422170-151422192 CACCCACACGGTGCATGGCCAGG + Intergenic
1001638796 5:173231135-173231157 CAGTCAGCAGGTGCTGGGACCGG - Intergenic
1002067008 5:176656909-176656931 CACTCACGAGGTTCTGGGCCAGG - Exonic
1002101942 5:176862141-176862163 CACCTACTATGTGCAGGGCCAGG + Intronic
1002181414 5:177432919-177432941 CACACAGCAGGGGCAAGGCCAGG - Intronic
1002705824 5:181160458-181160480 CCCACACTAGGTGCAGGGCCGGG + Intergenic
1002758915 6:186739-186761 CACTCACAAGTGGCAGGGCTAGG + Intergenic
1003400145 6:5784174-5784196 CAGACACCAGTCGCAGGGCCAGG - Intergenic
1003469648 6:6417226-6417248 CACTTGCCAGAAGCAGGGCCCGG + Intergenic
1003873764 6:10420021-10420043 CGCCCACGAGGTGCAGGGCACGG + Intergenic
1006058627 6:31403687-31403709 CACTCACCAGCAGCAGCTCCCGG - Exonic
1006109597 6:31736552-31736574 CCCTCCCCAGGTTCAGGGCGGGG - Intronic
1006628053 6:35411386-35411408 CACTCACCAGCAGTGGGGCCTGG + Intronic
1007585507 6:42986583-42986605 CACTCCCCAAGGACAGGGCCTGG - Intronic
1007658669 6:43468802-43468824 CACTCTCCAGGTGAAGGGTAGGG - Intergenic
1007776270 6:44226152-44226174 CACTCACCAGGTGCCCAGACTGG - Exonic
1008052591 6:46915341-46915363 CACTGTGCAGGAGCAGGGCCTGG + Intronic
1008592284 6:53006308-53006330 AACTCACCAGGGGAAGGGTCTGG + Exonic
1013417128 6:109934920-109934942 CACCAACAATGTGCAGGGCCTGG - Intergenic
1015483840 6:133745972-133745994 GACTCACCTGGAGCAGGGCTTGG + Intergenic
1016826151 6:148390247-148390269 CACTCACCACTTCCAGGTCCTGG - Exonic
1016988903 6:149916154-149916176 CCCTGGTCAGGTGCAGGGCCTGG - Intergenic
1016994089 6:149948509-149948531 CCCTGGTCAGGTGCAGGGCCTGG + Intronic
1017004251 6:150019047-150019069 CCCTGGTCAGGTGCAGGGCCTGG - Intronic
1017061021 6:150485093-150485115 CACAGACCGGGTCCAGGGCCTGG + Intergenic
1017304242 6:152898390-152898412 CACTCCCTAGGAGCAGGGACTGG + Intergenic
1018056589 6:160057236-160057258 CACTCAACAAGTGGAGGGCATGG - Intronic
1019047539 6:169160378-169160400 CCCCCGTCAGGTGCAGGGCCTGG - Intergenic
1019102194 6:169640655-169640677 CAGACACCTGCTGCAGGGCCTGG + Intronic
1019376383 7:694738-694760 CAAGAACCAGGTGAAGGGCCGGG + Intronic
1019527098 7:1485283-1485305 CCCTCACCTGCTGCAGGGCCAGG + Exonic
1020917046 7:14207537-14207559 CACTCACCAAGTACATTGCCTGG - Intronic
1021612434 7:22471301-22471323 CACTCAAGAGTTGCAAGGCCTGG + Intronic
1022443711 7:30453176-30453198 CACTCCTCAGATGCAGGACCTGG + Intronic
1022949297 7:35320399-35320421 CAGACACCAGGTGAAGAGCCAGG + Intergenic
1025722218 7:64027168-64027190 ACATCACCAGGTGCTGGGCCCGG + Intergenic
1026665414 7:72336697-72336719 CACTCACCTCTTGCTGGGCCGGG + Intronic
1026840888 7:73669421-73669443 CACGCTCCAGCTGCAGGCCCTGG - Exonic
1026935047 7:74249709-74249731 CACTCAACAGGCCCAGGGCTGGG + Intronic
1026946748 7:74321053-74321075 CACACAGCAGGAGCAGGGCTAGG - Intronic
1028411653 7:90536830-90536852 CACTCTCCATCAGCAGGGCCAGG + Intronic
1029205106 7:98865167-98865189 CAGTCTCCTGGGGCAGGGCCAGG - Intronic
1029616417 7:101661163-101661185 CAGTCACCAGCTCAAGGGCCTGG + Intergenic
1032239658 7:130150779-130150801 AACTCACCAGGTGCAGTTACCGG + Intergenic
1033622184 7:143071425-143071447 CACTTACTAGGTGCATGCCCTGG - Intergenic
1034337685 7:150333953-150333975 CCCTCACCAGATGCAGGCCTGGG - Intronic
1034950023 7:155290784-155290806 CTCTCACAGGGAGCAGGGCCTGG - Intergenic
1034994353 7:155568850-155568872 AACACACCAGGTGCAGGGCTGGG - Intergenic
1035074637 7:156169582-156169604 CCCTCCCCAGGAGCAGGGACAGG - Intergenic
1035619831 8:1028533-1028555 TATTCTCCAGGTGCAGTGCCAGG + Intergenic
1035724368 8:1815383-1815405 CCCTCCCCAGGTGCAGGTGCTGG - Intergenic
1036762083 8:11516355-11516377 CACCCACCAAGTGCAGGACTCGG - Intronic
1036777200 8:11621567-11621589 CCATCTCCAGCTGCAGGGCCTGG + Intergenic
1037760580 8:21738981-21739003 CACTCAGCAGCTGCAGGAGCTGG - Intronic
1037994952 8:23345319-23345341 GACTCACCCAGGGCAGGGCCTGG + Intronic
1038001973 8:23399608-23399630 CCCTCACCAGGTACAGCTCCTGG + Intronic
1038405102 8:27315796-27315818 CACTACCCAGGGGCAGGACCTGG + Intronic
1038452964 8:27651584-27651606 CGGCCACCAGGAGCAGGGCCAGG - Exonic
1039428948 8:37510803-37510825 CCCTCACCAGGAGCAGGTGCTGG - Intergenic
1040776025 8:51044181-51044203 CACTCAGCAGGGGGATGGCCGGG + Intergenic
1041772520 8:61487136-61487158 CCCTCAGCAGGGGCAGAGCCTGG - Intronic
1047209048 8:122825965-122825987 CACTTACCAGGGGCAGGACTTGG + Intronic
1048015913 8:130497980-130498002 CGCACAACAGGTGAAGGGCCAGG + Intergenic
1048140559 8:131790173-131790195 CCCAGAGCAGGTGCAGGGCCTGG + Intergenic
1048581371 8:135732085-135732107 CAGCCACCAGGAGCGGGGCCTGG - Intergenic
1048776395 8:137951438-137951460 CACTCTCCAGGTGCAGGTTTAGG + Intergenic
1048937951 8:139372561-139372583 CACTCACCAGTTCCAGGGCTTGG + Intergenic
1049468966 8:142766873-142766895 CAGGCACCAGGCGCAGGCCCTGG + Intronic
1049479952 8:142817890-142817912 CTCTCATCAAGAGCAGGGCCAGG + Intergenic
1049510629 8:143025075-143025097 TACCCACCAGGGGCAGTGCCAGG + Intergenic
1049733039 8:144188822-144188844 CACTCCCCAGGTGTATGGCCTGG - Intronic
1052866557 9:33467738-33467760 CACCCTCCTGGAGCAGGGCCTGG - Exonic
1053066926 9:35075514-35075536 CACCCACCTGCTTCAGGGCCAGG - Exonic
1054805086 9:69389722-69389744 CATTCACCAGGTAGTGGGCCTGG + Intronic
1056395341 9:86176458-86176480 CACTCCACTGCTGCAGGGCCAGG + Intergenic
1056410758 9:86324294-86324316 CACTCAGCAGCAGCAGAGCCTGG - Intronic
1059230916 9:112720811-112720833 CACCCAGTAAGTGCAGGGCCAGG - Intergenic
1059247516 9:112861464-112861486 CACTTACCAGGTGTGTGGCCTGG - Intronic
1060209241 9:121699898-121699920 CCCTCACCACGGGCAGCGCCCGG - Intronic
1061004279 9:127919617-127919639 CACTCAGGAGGTGATGGGCCAGG - Intergenic
1061194598 9:129100843-129100865 CATTCACCAAGTGCAGGGTGTGG + Intronic
1061262950 9:129490034-129490056 CACTGACCAGGTGGAGGGGTAGG - Intergenic
1061797692 9:133097990-133098012 CACTCACCGGGTGCAGAGTCTGG + Exonic
1061923879 9:133796669-133796691 CACACACCTGGTGCATGGACTGG - Intronic
1062051105 9:134447526-134447548 AGCTCAGCAGGTCCAGGGCCAGG - Intergenic
1062093464 9:134690616-134690638 CACACACCAGGGGCAGACCCGGG - Intronic
1062269169 9:135700823-135700845 CCCTGGCCAGGGGCAGGGCCGGG - Intergenic
1062540542 9:137039964-137039986 CACTCACCGGGGCCAGGCCCGGG + Exonic
1062562482 9:137147819-137147841 CACACAGCAGGTGCACGGCAGGG + Intronic
1203744564 Un_GL000218v1:34804-34826 GACTCCCCAAGTGCAGGGCAGGG + Intergenic
1203565537 Un_KI270744v1:84680-84702 GACTCCCCAAGTGCAGGGCAGGG - Intergenic
1185477192 X:422295-422317 CACTCAGCCAGGGCAGGGCCGGG - Intergenic
1186959264 X:14717203-14717225 CACCCTCCAAGTGGAGGGCCTGG + Intronic
1187405670 X:19001412-19001434 CACAGACCAGTTGCAGTGCCTGG + Intronic
1190059617 X:47202447-47202469 CACAGAACTGGTGCAGGGCCTGG - Exonic
1197144779 X:123159413-123159435 CTCTCACCAGAAGCAGAGCCTGG - Intergenic
1199761882 X:150911234-150911256 CATTCACCAGAGGCAGGGCGAGG - Intergenic
1199841046 X:151649412-151649434 CACTTACCAGTTACATGGCCTGG + Intronic
1200114678 X:153764934-153764956 CAGTCCCCAGGGGCAGGGCTGGG + Intronic
1200115984 X:153769918-153769940 CCCCCGCCAGGAGCAGGGCCAGG + Exonic
1200234193 X:154460288-154460310 CAGTCACCCGGTGCACAGCCAGG - Exonic
1200843660 Y:7809582-7809604 CATCATCCAGGTGCAGGGCCAGG + Intergenic
1201157899 Y:11149787-11149809 GACTCCCCAAGTGCAGGGCAGGG + Intergenic
1201562950 Y:15337021-15337043 CACTCACAAGTCTCAGGGCCTGG + Intergenic