ID: 923369360

View in Genome Browser
Species Human (GRCh38)
Location 1:233295320-233295342
Sequence ACTCACCAGGTGCAGGGCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 278}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923369346_923369360 6 Left 923369346 1:233295291-233295313 CCACAGCTCCCCGGGACCGGACC 0: 1
1: 0
2: 1
3: 9
4: 175
Right 923369360 1:233295320-233295342 ACTCACCAGGTGCAGGGCCAGGG 0: 1
1: 0
2: 3
3: 33
4: 278
923369349_923369360 -4 Left 923369349 1:233295301-233295323 CCGGGACCGGACCCTCCCCACTC 0: 1
1: 0
2: 1
3: 20
4: 269
Right 923369360 1:233295320-233295342 ACTCACCAGGTGCAGGGCCAGGG 0: 1
1: 0
2: 3
3: 33
4: 278
923369350_923369360 -10 Left 923369350 1:233295307-233295329 CCGGACCCTCCCCACTCACCAGG 0: 1
1: 0
2: 5
3: 56
4: 546
Right 923369360 1:233295320-233295342 ACTCACCAGGTGCAGGGCCAGGG 0: 1
1: 0
2: 3
3: 33
4: 278
923369345_923369360 7 Left 923369345 1:233295290-233295312 CCCACAGCTCCCCGGGACCGGAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 923369360 1:233295320-233295342 ACTCACCAGGTGCAGGGCCAGGG 0: 1
1: 0
2: 3
3: 33
4: 278
923369337_923369360 30 Left 923369337 1:233295267-233295289 CCTTTCTCCTTCTTCCCTCCATA 0: 1
1: 1
2: 13
3: 128
4: 1189
Right 923369360 1:233295320-233295342 ACTCACCAGGTGCAGGGCCAGGG 0: 1
1: 0
2: 3
3: 33
4: 278
923369347_923369360 -2 Left 923369347 1:233295299-233295321 CCCCGGGACCGGACCCTCCCCAC 0: 1
1: 0
2: 1
3: 11
4: 195
Right 923369360 1:233295320-233295342 ACTCACCAGGTGCAGGGCCAGGG 0: 1
1: 0
2: 3
3: 33
4: 278
923369348_923369360 -3 Left 923369348 1:233295300-233295322 CCCGGGACCGGACCCTCCCCACT 0: 1
1: 0
2: 0
3: 8
4: 201
Right 923369360 1:233295320-233295342 ACTCACCAGGTGCAGGGCCAGGG 0: 1
1: 0
2: 3
3: 33
4: 278
923369338_923369360 23 Left 923369338 1:233295274-233295296 CCTTCTTCCCTCCATACCCACAG 0: 1
1: 0
2: 4
3: 86
4: 576
Right 923369360 1:233295320-233295342 ACTCACCAGGTGCAGGGCCAGGG 0: 1
1: 0
2: 3
3: 33
4: 278
923369339_923369360 16 Left 923369339 1:233295281-233295303 CCCTCCATACCCACAGCTCCCCG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 923369360 1:233295320-233295342 ACTCACCAGGTGCAGGGCCAGGG 0: 1
1: 0
2: 3
3: 33
4: 278
923369343_923369360 12 Left 923369343 1:233295285-233295307 CCATACCCACAGCTCCCCGGGAC 0: 1
1: 0
2: 1
3: 17
4: 189
Right 923369360 1:233295320-233295342 ACTCACCAGGTGCAGGGCCAGGG 0: 1
1: 0
2: 3
3: 33
4: 278
923369340_923369360 15 Left 923369340 1:233295282-233295304 CCTCCATACCCACAGCTCCCCGG 0: 1
1: 0
2: 0
3: 27
4: 269
Right 923369360 1:233295320-233295342 ACTCACCAGGTGCAGGGCCAGGG 0: 1
1: 0
2: 3
3: 33
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923369360 Original CRISPR ACTCACCAGGTGCAGGGCCA GGG Exonic
900592190 1:3465105-3465127 ACCCACCAGGCCCAGGCCCATGG + Intronic
900780685 1:4615557-4615579 TCTCCCCATGTGCAGGGGCAGGG + Intergenic
901074580 1:6545474-6545496 ACTCACCTGGTCTAGAGCCAGGG - Intronic
902746989 1:18481055-18481077 AGTCACCAGGAGCAGGGCAGCGG - Exonic
903271256 1:22189834-22189856 ACTCACCAGCTGCAGGACCTTGG - Intergenic
905305292 1:37013714-37013736 ACTCACCAAGAGCAGCTCCAGGG + Intronic
906193702 1:43915452-43915474 ACTCACCATGTGCAGATCCTGGG - Intronic
907338186 1:53714440-53714462 CCTCACCAGGAGCAGGGACATGG + Intronic
909618282 1:77637533-77637555 ATTAGCCAGGTGCAGGGGCAGGG + Intronic
912558195 1:110531330-110531352 ACCCAGCAGCTGCAGGGCCCTGG - Intergenic
913173514 1:116253622-116253644 ACTCACCAAGTACAGGGACTGGG + Intergenic
913661678 1:121010551-121010573 ACTCTCCAGGTGAAGGCTCAAGG + Intergenic
914013050 1:143793731-143793753 ACTCTCCAGGTGAAGGCTCAAGG + Intergenic
914164776 1:145167454-145167476 ACTCTCCAGGTGAAGGCTCAAGG - Intergenic
914651674 1:149702340-149702362 ACTCTCCAGGTGAAGGCTCAAGG + Exonic
916118926 1:161511271-161511293 ACTCTCCAGGCACTGGGCCAAGG + Intronic
917165873 1:172112529-172112551 ACTGAAGAGGTTCAGGGCCAGGG - Intronic
920328239 1:205184129-205184151 ACACACCAGGAGCAGGCCCTGGG + Intronic
920560407 1:206934520-206934542 GGTCACCAGGTTCAGGGTCAGGG + Exonic
923369360 1:233295320-233295342 ACTCACCAGGTGCAGGGCCAGGG + Exonic
924434038 1:244022953-244022975 ACGAAAGAGGTGCAGGGCCAAGG + Intergenic
1063129989 10:3169964-3169986 ACACAGCAGGAGCTGGGCCAGGG + Intronic
1063368229 10:5504343-5504365 TCTCACCAGGTGCTGGGCGGAGG - Intergenic
1063382636 10:5595857-5595879 TCTCACCAGGAGAAGAGCCAGGG + Intergenic
1064119311 10:12605489-12605511 AATCACCAGGTGCTGGGCAGGGG - Intronic
1064143110 10:12806673-12806695 ACTGAGCAGGTGGAGGGCCAGGG + Intronic
1064277299 10:13917823-13917845 ACTCACAAGGTGCATGGCCTTGG + Intronic
1064342605 10:14500329-14500351 ACACCCAACGTGCAGGGCCAGGG - Intergenic
1064704373 10:18056509-18056531 CCTCACCAGCTGCAGTGCTATGG - Intergenic
1065721185 10:28629970-28629992 ACTCACCAAGGGCAGGGACTTGG + Intergenic
1067677716 10:48399440-48399462 ACTCCCCAGGAGCAGGGCAGAGG - Intronic
1069617014 10:69812846-69812868 ACTCACCAGGTGAGGGGCCCAGG - Intronic
1073115019 10:101087105-101087127 AATCCCCAGCTCCAGGGCCAGGG - Intergenic
1073331200 10:102670922-102670944 AGCCACCAGGAGCAGGGGCAGGG - Intergenic
1075235376 10:120723069-120723091 CCTCACCGGCTGCATGGCCATGG - Intergenic
1075679454 10:124322023-124322045 GCTCACCATCTGCAGGGACAGGG - Intergenic
1075934918 10:126332094-126332116 ACACATCAGCTGCGGGGCCACGG + Intronic
1075957814 10:126539047-126539069 CATCCCCAGCTGCAGGGCCATGG + Intronic
1076765174 10:132629374-132629396 ACTGAACAGCTGCAGGGCCCTGG - Intronic
1077021173 11:417739-417761 ACACCCCAGGTGCAGGGACGGGG + Intergenic
1077096121 11:799853-799875 CACCCCCAGGTGCAGGGCCACGG + Exonic
1077097724 11:806130-806152 CCTCACCAGCTACAGGGCCTCGG - Intronic
1077145676 11:1043229-1043251 TCACACCAGGTGCCGGCCCAAGG + Intergenic
1077164743 11:1129970-1129992 CCTCAGCCGGCGCAGGGCCAGGG + Intergenic
1078102841 11:8339864-8339886 ACTCACCTGGTGGAGGGGCGTGG - Intergenic
1078102861 11:8339937-8339959 GCTCACCAGGGGCAGGGAGAAGG - Intergenic
1081976206 11:47236662-47236684 ACTTACCAGGTGCTGGGCATGGG - Intronic
1081993658 11:47350571-47350593 CCTCAGCAGGGGCAGGGGCAGGG + Exonic
1083320459 11:61842784-61842806 ACTCGGCAGGTGCACAGCCATGG + Intronic
1084271042 11:68029415-68029437 AATCACCTGATGAAGGGCCAGGG + Intergenic
1087084034 11:94198509-94198531 ACTTACTAGCTGCAGGGCCTGGG + Intergenic
1088083213 11:105945480-105945502 ACTAACCAGCTCCAGGACCAAGG + Intronic
1089976071 11:122732469-122732491 ACTTACAACGTGCAGGGCCTGGG - Intronic
1091141573 11:133239634-133239656 GCCCACCAGGTGCAAAGCCATGG + Intronic
1091157024 11:133383390-133383412 ACTCACCAGCTGTATGGCCTTGG - Intronic
1092532143 12:9353473-9353495 ACTCAGCAGGTGCAGGGCCTTGG + Intergenic
1096657825 12:53102726-53102748 AATCACATGGTTCAGGGCCATGG - Intergenic
1097154243 12:57001357-57001379 TCCCACCAGGGGCAGTGCCAGGG + Exonic
1103014670 12:117484662-117484684 ACTCAACAGAGGCAGGGCCTGGG + Intronic
1103072140 12:117953631-117953653 AGTTACCATGTGCTGGGCCAGGG + Intronic
1103534594 12:121626252-121626274 AAGCTCCAGGAGCAGGGCCACGG + Intergenic
1105347891 13:19590682-19590704 ACTTACCAGGGGCAGGGCCCTGG + Intergenic
1105605649 13:21924515-21924537 ACATTCCTGGTGCAGGGCCAGGG - Intergenic
1106519883 13:30487272-30487294 ACTCACTAGGTGCAGTGCTCAGG - Intronic
1106772864 13:32979139-32979161 AATCAGCAGGGGCAGGACCAGGG - Intergenic
1107480268 13:40780504-40780526 ACTCACCAGGGGCAGAGCCCTGG + Intergenic
1108501059 13:51070328-51070350 CCTGACCAGGTGCAGGATCATGG + Intergenic
1108623217 13:52204083-52204105 ACTCACAAGGGGCAGGGCCCTGG + Intergenic
1108663511 13:52606955-52606977 ACTCACCAGGGGCAGGGCCCTGG - Intergenic
1111490675 13:88970433-88970455 AGGCCCCAAGTGCAGGGCCATGG - Intergenic
1112693872 13:101926129-101926151 ACTCACAAGTTGCAGGGATAAGG + Intronic
1114260987 14:21036076-21036098 ACTCACCATGTGCCGGGCACTGG - Intronic
1114267518 14:21081639-21081661 GCTGCCCAGGTCCAGGGCCAGGG - Exonic
1117496345 14:56309284-56309306 ACTCACAAGGGGAAGGGCCCTGG - Intergenic
1118684594 14:68278718-68278740 ACTCAGCAGGCTCAGGACCAGGG - Intronic
1119519216 14:75273390-75273412 AATCACCATGTGCAGGGCCAGGG - Intergenic
1119552495 14:75525172-75525194 ACTTACCAGGTGCAGGGTGTCGG - Exonic
1119654636 14:76408431-76408453 ATTAACCAGGTGCAGGTGCATGG + Intronic
1119669682 14:76508934-76508956 ACTCACTGGCTGCATGGCCACGG + Intergenic
1121318474 14:92976064-92976086 ACTCACAGTTTGCAGGGCCAGGG - Intronic
1121530783 14:94651708-94651730 ACCCCCCAGGCACAGGGCCATGG - Intergenic
1122636712 14:103133375-103133397 CTTCACCAGGTGCAGGTGCAAGG - Exonic
1123029994 14:105447066-105447088 ACCCAGCACCTGCAGGGCCAAGG - Intronic
1123720801 15:23060585-23060607 ACTCACCAGATGCAGATGCAGGG - Intergenic
1124597731 15:31104322-31104344 ACACCCCAGGTGGAGGCCCAAGG + Intronic
1124617148 15:31250005-31250027 ACTCACCAGCTGCAGGGCTCAGG - Intergenic
1125774983 15:42204286-42204308 AATCTCCATGTGCAGGGCCCAGG - Intronic
1128515703 15:68340618-68340640 ACCCACCAGTTGCAGGACAAGGG + Intronic
1129330342 15:74823911-74823933 ACTCAGCAGCAGCAGGGCCCTGG + Intronic
1129514260 15:76147368-76147390 ACTCTGCAGTTGCATGGCCATGG - Intronic
1129602624 15:77009217-77009239 CCTCAGCAGGTTCAGGGCCTCGG - Intronic
1129797637 15:78390152-78390174 ACTTACTAGGTGCTGGGCCCTGG + Intergenic
1131387445 15:92018912-92018934 ACTCCCCTGGTGCTGGGCCTGGG + Intronic
1131846444 15:96494620-96494642 AGTCACCTGCTGCAGGCCCATGG - Intergenic
1132612437 16:824081-824103 ATTCTCCAGGGGCTGGGCCAGGG + Intergenic
1132882066 16:2166860-2166882 CTTCCCGAGGTGCAGGGCCAGGG + Intronic
1133008490 16:2897537-2897559 ACACAGCAGGGGCAGAGCCAAGG - Intronic
1133100878 16:3478861-3478883 ACTCACCTGGTGGAGGAACAGGG + Intronic
1133286368 16:4692676-4692698 CCTCACCAGCAGCAGGGCCCAGG - Intergenic
1134535376 16:15022300-15022322 ACTCATCACCTGCAGGACCACGG - Intronic
1134608917 16:15592527-15592549 GCTTCCCAGGTGCAGGGCCTGGG - Intronic
1134881276 16:17747088-17747110 ACTCTCCAGCTGCATGGCCTTGG + Intergenic
1139375400 16:66493591-66493613 CCTCACCCGATGAAGGGCCAGGG - Intronic
1139592388 16:67940524-67940546 ACTCAGCAGGTTGTGGGCCAGGG - Intronic
1139737169 16:69001131-69001153 ACATACCAGGTGCAGAGCCTAGG + Intronic
1139860672 16:70018489-70018511 ACTCATCACCTGCAGGACCACGG + Intergenic
1139969170 16:70763098-70763120 ACTCAGGATGTGCAGGCCCAGGG - Intronic
1140111313 16:72007896-72007918 GCACAACAGGCGCAGGGCCAGGG + Intergenic
1141926303 16:87172452-87172474 ACTGGCCAGGTGCAGAGCTAAGG - Intronic
1142743028 17:1941700-1941722 ACTCTCCAGGAGGAGGGGCAGGG - Intronic
1142761931 17:2047629-2047651 TGTCACCAGGTGCAGGATCATGG + Intergenic
1144494081 17:15736137-15736159 ACCTACCAGGGCCAGGGCCAAGG - Intronic
1144906179 17:18640542-18640564 ACCTACCAGGGCCAGGGCCAAGG + Intronic
1146479862 17:33196571-33196593 AAGCTCCAAGTGCAGGGCCATGG + Intronic
1148338845 17:46861174-46861196 ATGCACCAAGTGCAGGGCCTGGG - Intronic
1148700489 17:49583857-49583879 CCACACCAGGAGCAAGGCCAAGG - Intergenic
1148838997 17:50482690-50482712 ACTCACCAGGCCCAACGCCAAGG - Exonic
1151384390 17:73746337-73746359 TCTCAACAGGTGTGGGGCCAAGG - Intergenic
1156263614 18:35467057-35467079 ACCCTCCAGGGGCAGGGCCCAGG - Intronic
1160156842 18:76441239-76441261 GCTCACCTGGTGCAGGTTCAGGG + Exonic
1161513110 19:4682707-4682729 CTTCTCCACGTGCAGGGCCACGG + Exonic
1161580252 19:5077017-5077039 CCTCACCAGGGGAAGGACCAGGG - Intronic
1165107792 19:33484012-33484034 ACTGAACAGGGGCAGGGACAGGG + Intronic
1165509090 19:36255877-36255899 ACTCACCAGAAGAAAGGCCAAGG - Intergenic
1166124209 19:40703938-40703960 ACTCACCACATGCAGGGCCCTGG + Intronic
1166283474 19:41810001-41810023 ACTCACCAGGGGCAAGGGCTTGG - Exonic
1167593868 19:50417631-50417653 CCTGGCGAGGTGCAGGGCCATGG - Intronic
1167705965 19:51081494-51081516 ATTCACTAGGTACAGGGACAGGG + Intronic
926197165 2:10771066-10771088 ACTGACCAGCTGCGTGGCCATGG - Intronic
927566081 2:24114334-24114356 ACACACCAACTGCATGGCCACGG - Intronic
928100111 2:28431941-28431963 AGGCACCAGGTCCAGGGTCAGGG + Intergenic
928203684 2:29268797-29268819 ACTAATCAAATGCAGGGCCAGGG - Intronic
928671332 2:33606587-33606609 ACTCATCAGAGGCAGGGCCCAGG - Intergenic
931869655 2:66444701-66444723 ACTCAACAGCTCCCGGGCCAGGG - Intronic
933459144 2:82557469-82557491 ACTCACCAGGTGTGAGCCCAAGG - Intergenic
933639159 2:84741020-84741042 ACTCTCTAGGTGCAAGCCCATGG - Intronic
934158220 2:89222933-89222955 ACTCACCAGGTGCCAGGGGAGGG - Intergenic
934209044 2:89959491-89959513 ACTCACCAGGTGCCAGGGGAGGG + Intergenic
934663186 2:96153993-96154015 ACTCACCCAGAGCAGGGCCTGGG + Intergenic
935054964 2:99557726-99557748 AGTAACCAGGTGCTAGGCCATGG - Intronic
936076400 2:109404453-109404475 ACTCTGCAGGGGCAGGGACAGGG + Intronic
936428355 2:112437347-112437369 ACTCGCCATGTGCAGGGCAGTGG + Intergenic
936835079 2:116699865-116699887 TCTCACGAGGTGCTGGGCCGGGG + Intergenic
937273548 2:120670411-120670433 GCTCACCATGTCCCGGGCCACGG + Intergenic
937988861 2:127651220-127651242 GCTCACCAGCAGCGGGGCCATGG - Exonic
938087304 2:128409895-128409917 ACAGAGCAGGTGCAGGACCATGG - Intergenic
938405606 2:131031627-131031649 ACTCACGAGGGGCAGGGCACAGG - Intronic
940634177 2:156277254-156277276 ACTAGCCAGGTGCATGGCCAGGG + Intergenic
941289622 2:163659414-163659436 AATCACCAAGGGCAGTGCCATGG + Intronic
941429034 2:165389328-165389350 ACTCACCATGGGCAGATCCATGG - Exonic
947475836 2:230447031-230447053 TCTAACCAGGTGCAGGGTCCTGG + Intronic
948455911 2:238104551-238104573 AGTCATCACGGGCAGGGCCAGGG + Intronic
948893643 2:240918543-240918565 ACTCCGCAGGTGCAGAACCAAGG + Intergenic
948928865 2:241117436-241117458 CCTGTCCAGCTGCAGGGCCAAGG + Intronic
1168962053 20:1876680-1876702 ACTGACCAGGTGCATGGCCTCGG + Intergenic
1172128075 20:32636994-32637016 AGTCACCAGGGGCAGGGGCTGGG + Intergenic
1172478270 20:35254917-35254939 ATCCACCAGGGCCAGGGCCATGG + Intronic
1172567050 20:35938858-35938880 ACGCGGCAGGGGCAGGGCCAGGG - Exonic
1173974262 20:47175196-47175218 ACTAGCCAGGTGCATGGCCGTGG + Intronic
1174063058 20:47845911-47845933 TCTGTCCAGGAGCAGGGCCAGGG + Intergenic
1174072665 20:47909763-47909785 TCTGTCCAGGAGCAGGGCCAGGG - Intergenic
1174841312 20:53903992-53904014 ACTAAACAGGTACAGGGCCCAGG + Intergenic
1175153654 20:56954792-56954814 TCACGCCAGGTGCAGGGCCAGGG - Intergenic
1176179072 20:63741170-63741192 AGCCGCCAGGAGCAGGGCCAGGG - Intronic
1176373894 21:6077864-6077886 ACTCGCCATGTGCAGGGCAGTGG - Intergenic
1178465047 21:32840380-32840402 GCTCTTCAGGGGCAGGGCCAGGG + Intergenic
1178627014 21:34226827-34226849 ACTGTCCAGGTCCAAGGCCATGG - Intergenic
1179436159 21:41363617-41363639 ACTCGCATGGTGCAGGGTCATGG - Intronic
1179749583 21:43460379-43460401 ACTCGCCATGTGCAGGGCAGTGG + Intergenic
1181033893 22:20160869-20160891 CCTCACCCAGTGCAGGGCCAGGG + Intergenic
1181278480 22:21702320-21702342 ACTGACCAGGGGAAGGGCTAGGG + Intronic
1181509461 22:23382534-23382556 CCTCACGCAGTGCAGGGCCAGGG - Intergenic
1182261037 22:29073211-29073233 ACTCACCGGGTCCGGGGCCGAGG - Exonic
1182280956 22:29217425-29217447 ACACACCAGCTGCATGGCCTTGG + Intronic
1182483789 22:30627082-30627104 ACTCCTCAGGTGCAGGGGCAGGG + Exonic
1183072094 22:35403317-35403339 ACTCACCAGCTGCAGGTGCTCGG - Exonic
1183346777 22:37312443-37312465 ACTCACCACGTGCCAGGCAAGGG - Intronic
1183529848 22:38347438-38347460 CCTCAAGAGATGCAGGGCCAGGG + Intronic
1183946224 22:41327348-41327370 ACTCACGTGGGGCAGGGCGAGGG - Exonic
1184379275 22:44134905-44134927 ACCCACCAGGTGCTGGGCCCAGG - Intronic
1184413054 22:44336967-44336989 ACTCACCAGCTGTATGGCCTTGG + Intergenic
1184734376 22:46389437-46389459 CCTCACCAGCTGCAGGGCCCTGG + Exonic
1184973423 22:48043792-48043814 ACTGAACAGGTGCATGGCCCAGG - Intergenic
1185143666 22:49117634-49117656 AGTCTCCAGGGGCAGGGCCTAGG + Intergenic
949748575 3:7324869-7324891 ATTCTACAGGTGCTGGGCCAAGG - Intronic
951529038 3:23681700-23681722 AGTCACCAGGTGAAGTCCCACGG - Intergenic
951907102 3:27716218-27716240 ACTTAACAGCTGCAGGGGCAAGG - Intronic
953780210 3:45862334-45862356 CCTCACCTCGTGCATGGCCAAGG - Intronic
955239023 3:57164139-57164161 GCTCCCCAGGAGCAGAGCCAAGG + Intronic
961058408 3:123808206-123808228 TCTCACCAGGGGCAGGGCACAGG + Intronic
961372591 3:126440636-126440658 ACTCCCCAGGAGCAGGGGCAGGG - Intronic
961620885 3:128223721-128223743 ATGCACCAGGTGCTGGTCCAAGG - Intronic
962241765 3:133756217-133756239 ACTCTCCAGGTGCAGGAGAAGGG + Intronic
962400541 3:135055579-135055601 ACTCACTAGGTTGAGGGCCTGGG + Intronic
962505842 3:136045665-136045687 CCACACCAGCTGCACGGCCAAGG + Intronic
962675909 3:137758400-137758422 ACTCTCCAGGGTCATGGCCAGGG + Intergenic
963912831 3:150829529-150829551 ACTCACCTGATGCAGTTCCAGGG + Intergenic
965423502 3:168492457-168492479 ACACACCAAGTTCAGGGTCAAGG + Intergenic
967977980 3:195046009-195046031 ACTCACTGTGTGCAGGGCCCGGG + Intergenic
968125958 3:196160463-196160485 ACTCACCAAGAGCAAGGCCTGGG + Intergenic
968508988 4:987161-987183 ATGCACCAGGTGCGGGGCCTCGG - Exonic
968592953 4:1468718-1468740 AGACACCAGGTGGAAGGCCACGG + Intergenic
969308948 4:6340937-6340959 GCTCTCCAGGTGCAGGACCAGGG - Intronic
969426864 4:7129585-7129607 ACTCAGCCGGTGCTGGGGCAGGG + Intergenic
969610948 4:8227574-8227596 CGTCCCCAGGAGCAGGGCCATGG - Exonic
969658998 4:8515520-8515542 TGTCACCAGGGGCAGGGCCAGGG + Intergenic
978373826 4:108054413-108054435 ACTCGCCAGCTGCATGGCCCTGG + Intronic
980435237 4:132763929-132763951 ACTCAGCAGGTTTAGGGCCCAGG - Intergenic
985887687 5:2692763-2692785 ACTCCACAGGTGCGGGACCAAGG + Intergenic
986425392 5:7626436-7626458 ACTCCCCAGGTGCAGAGCCCAGG - Intronic
992411636 5:76510907-76510929 TCTCACCAGCTGCAAGGCCTTGG + Intronic
992737543 5:79738525-79738547 ACTCAAAAGGACCAGGGCCAAGG + Exonic
992944293 5:81794507-81794529 AGCAACCAGGTGCAAGGCCAAGG + Intergenic
993303456 5:86243721-86243743 ACTCACAAGGGGTAGGGCCTAGG - Intergenic
993570113 5:89526397-89526419 ACCCACCAGGAGCAGAGCAAGGG + Intergenic
993669859 5:90747306-90747328 GTTCAACAGGTGCAGGGCCAGGG + Intronic
995739504 5:115340156-115340178 CCTCATCAGGTTCAGGGCAATGG + Intergenic
1000108453 5:158083467-158083489 ATTCATCAGGAGAAGGGCCATGG - Intergenic
1001668929 5:173457728-173457750 ACTCACGAGTTGCAGGACCATGG - Intergenic
1002101943 5:176862142-176862164 ACCTACTATGTGCAGGGCCAGGG + Intronic
1002181413 5:177432918-177432940 ACACAGCAGGGGCAAGGCCAGGG - Intronic
1002359978 5:178662622-178662644 GCGCACCAGGGGCAAGGCCATGG + Intergenic
1002705826 5:181160459-181160481 CCACACTAGGTGCAGGGCCGGGG + Intergenic
1002758916 6:186740-186762 ACTCACAAGTGGCAGGGCTAGGG + Intergenic
1002887212 6:1308367-1308389 ACTGACCAGGTGCAAAACCAAGG - Intergenic
1003883849 6:10503030-10503052 AATCAGCAAGAGCAGGGCCAAGG - Intronic
1006614026 6:35312565-35312587 GCACACAAGGTGCAGGGCGAAGG + Intronic
1007144616 6:39615865-39615887 ACTCACCAACTGCATGGTCAGGG - Intronic
1009404912 6:63300222-63300244 ACACACCAGGTGTAGAGTCAAGG - Intronic
1013418865 6:109948590-109948612 ACAAGCCAGGTGCTGGGCCAGGG + Intergenic
1015483841 6:133745973-133745995 ACTCACCTGGAGCAGGGCTTGGG + Intergenic
1015582382 6:134739912-134739934 GCTCACCAGGTGCAGTGAGAAGG - Intergenic
1015724199 6:136283768-136283790 TCTCCCCAGTTGGAGGGCCATGG - Intronic
1018530323 6:164756212-164756234 ACTCAGCTGGTGCAGGGAGATGG - Intergenic
1018939323 6:168297911-168297933 CCTCACCAGGGGCTGGGACACGG - Intronic
1019172130 6:170138474-170138496 GGCCACCAGGTGCAGGCCCACGG + Intergenic
1019365318 7:629871-629893 ACGCTGCAGGAGCAGGGCCACGG + Intronic
1019383687 7:741449-741471 ACTCACCATGTGGAGGGTAATGG - Exonic
1019407607 7:891916-891938 ACCCACCAGCTGCTGGGCCATGG + Intronic
1019500141 7:1360626-1360648 ACCCAGCAGGTGCAGGGCTGAGG - Intergenic
1019527100 7:1485284-1485306 CCTCACCTGCTGCAGGGCCAGGG + Exonic
1021255777 7:18390698-18390720 ACTAACTAGCTGCATGGCCAAGG + Intronic
1022128885 7:27384519-27384541 ACTCACCAGGTATAGGACCTCGG - Intergenic
1022949298 7:35320400-35320422 AGACACCAGGTGAAGAGCCAGGG + Intergenic
1023909091 7:44541200-44541222 ACTCACCAAGCGCAGGAGCAGGG + Exonic
1024048009 7:45598219-45598241 AGTCACCAGTGGCAGAGCCAGGG + Intronic
1026440925 7:70443328-70443350 ACTCACCAGCTGTATGGCCTTGG + Intronic
1029283955 7:99453494-99453516 CCCCACCAGGAGGAGGGCCAGGG - Intronic
1029643005 7:101832873-101832895 TCTTACCAGGAGCAGCGCCATGG + Intronic
1032079457 7:128851395-128851417 ACTCACCAGGGGCAGGGGTGAGG + Intronic
1032239659 7:130150780-130150802 ACTCACCAGGTGCAGTTACCGGG + Intergenic
1032510895 7:132471537-132471559 ACTGATGAGGAGCAGGGCCAAGG - Intronic
1033554537 7:142477207-142477229 TCCCACCAGGTGCAGGGCACAGG + Intergenic
1034271658 7:149806093-149806115 AATCCCCAGGAGCTGGGCCAGGG - Intergenic
1034427693 7:151023303-151023325 GCTCAGCAGGGGCAGGGTCAGGG - Intronic
1034994352 7:155568849-155568871 ACACACCAGGTGCAGGGCTGGGG - Intergenic
1035051810 7:156003256-156003278 CCTCCCCATGTGAAGGGCCAAGG - Intergenic
1035817775 8:2559889-2559911 ACTTACCAGCTGTAGGACCAGGG + Intergenic
1036489015 8:9207275-9207297 GCTCACAAGGGGCAGAGCCAAGG - Intergenic
1037493601 8:19418650-19418672 ACTCACCAGCTGCTGTTCCAAGG + Exonic
1038444264 8:27592712-27592734 ACTCCTCAGGTGCAGGGCCGAGG + Intergenic
1038449869 8:27633356-27633378 GCTCGCCAGGGGCAGAGCCAGGG + Intergenic
1038583291 8:28768844-28768866 ACACAGCAGGTGAAGGGCCTCGG + Intronic
1039428621 8:37507143-37507165 ACTCCCCAGCGGGAGGGCCAAGG + Intergenic
1040506314 8:48051850-48051872 GCCCAGCAGGTGCAGGGCTAAGG - Intronic
1042928691 8:73992663-73992685 ACCCACCAGGAGAAGGGCCATGG - Intronic
1045009357 8:97944090-97944112 ACTGACCAGGGGGAGGGGCAGGG + Intronic
1046089681 8:109486658-109486680 TCTCACCAGTTCCAGGGACATGG - Exonic
1047213980 8:122862311-122862333 ACTCACCAGGTCCACAGCCATGG + Intronic
1048776396 8:137951439-137951461 ACTCTCCAGGTGCAGGTTTAGGG + Intergenic
1049180320 8:141218884-141218906 GCTGAACAGGTGCAGGGCCACGG + Exonic
1049421132 8:142517168-142517190 GCTGGCCAGGGGCAGGGCCAGGG + Intronic
1049479953 8:142817891-142817913 TCTCATCAAGAGCAGGGCCAGGG + Intergenic
1049510630 8:143025076-143025098 ACCCACCAGGGGCAGTGCCAGGG + Intergenic
1049733038 8:144188821-144188843 ACTCCCCAGGTGTATGGCCTGGG - Intronic
1050701007 9:8338660-8338682 ACTCACCAAGTGCATCCCCAAGG + Intronic
1051357440 9:16252816-16252838 CCTCACCAGGTCCAGGGCGGAGG - Intronic
1051365139 9:16316624-16316646 ACTCACCAGGGACAAGGACATGG - Intergenic
1051501937 9:17787375-17787397 CCTCACCAAGTGCTGGGCCTAGG - Exonic
1053163693 9:35829939-35829961 ACTCACCAGCCCCTGGGCCAAGG - Exonic
1053535839 9:38924801-38924823 ACTTGCCAGGTGCAGGCCTAGGG - Intergenic
1053613477 9:39739897-39739919 ACACACCAGAAGCAGGGCCGCGG - Intergenic
1053871518 9:42497854-42497876 ACACACCAGAAGCAGGGCCGCGG - Intergenic
1054208062 9:62149214-62149236 ACTTGCCAGGTGCAGGCCTAGGG - Intergenic
1054240037 9:62602500-62602522 ACACACCAGAAGCAGGGCCGCGG + Intergenic
1054554170 9:66637026-66637048 ACACACCAGAAGCAGGGCCGCGG + Intergenic
1054630293 9:67439136-67439158 ACTTGCCAGGTGCAGGCCTAGGG + Intergenic
1056655365 9:88504283-88504305 ACACACCAGGAGCAGGGCCCAGG - Intergenic
1057256270 9:93550120-93550142 ACTCTGCAGCTGCAGGTCCATGG - Intronic
1057440947 9:95082838-95082860 ACTCTCCAGGCCCTGGGCCAGGG - Intronic
1057773204 9:97984595-97984617 GCTCACCAGGCGCAGGGAGACGG - Intronic
1058813969 9:108666994-108667016 GAACACCATGTGCAGGGCCAGGG + Intergenic
1058929501 9:109704973-109704995 ACTCACCAGCTGCAGGACCTTGG + Intronic
1060524911 9:124315098-124315120 AGTCCCCAAGAGCAGGGCCAAGG - Intronic
1060617368 9:125030191-125030213 AGTCACCAGGTTCAAGGACAGGG - Intronic
1061004278 9:127919616-127919638 ACTCAGGAGGTGATGGGCCAGGG - Intergenic
1061262949 9:129490033-129490055 ACTGACCAGGTGGAGGGGTAGGG - Intergenic
1061483024 9:130906460-130906482 AGTCACCAGGTCCAGGGACCAGG + Intronic
1061762147 9:132858338-132858360 ACGCCCCAGGGGCAGAGCCAGGG - Intronic
1061828986 9:133278587-133278609 ACTCACAAGCGGCTGGGCCAGGG + Intergenic
1203770470 EBV:47576-47598 AAACATCAGGAGCAGGGCCACGG - Intergenic
1189152230 X:38720381-38720403 ATACACCAGGTGGAGGGTCAGGG + Intergenic
1196251531 X:113465863-113465885 ACACACCAGATACAGAGCCAAGG - Intergenic
1196679748 X:118458713-118458735 GCTCCCCAGCTGCTGGGCCATGG + Intergenic
1198727393 X:139691973-139691995 CCTCACGCGCTGCAGGGCCATGG + Intronic
1198855596 X:141012221-141012243 ACGCACTAGGTGTAGGGCCTAGG - Intergenic
1198876538 X:141233975-141233997 ACGCACTAGGTGTAGGGCCTAGG + Intergenic
1198907099 X:141575147-141575169 ACGCACTAGGTGTAGGGCCTAGG + Intergenic
1198909692 X:141599261-141599283 ACGCACTAGGTGTAGGGCCTAGG - Intronic
1198917394 X:141688885-141688907 ACGCACTAGGTGTAGGGCCTAGG + Intronic
1200252627 X:154561834-154561856 ATTCTCAAGGTTCAGGGCCACGG - Intronic
1200265140 X:154642582-154642604 ATTCTCAAGGTTCAGGGCCACGG + Intergenic
1201477394 Y:14397377-14397399 ACACAGCAGGAGCAGGACCAAGG - Intergenic
1202368950 Y:24184653-24184675 ACTCAGCAAGTGCAAAGCCAAGG - Intergenic
1202501835 Y:25485464-25485486 ACTCAGCAAGTGCAAAGCCAAGG + Intergenic