ID: 923369361

View in Genome Browser
Species Human (GRCh38)
Location 1:233295321-233295343
Sequence CTCACCAGGTGCAGGGCCAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 359}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923369345_923369361 8 Left 923369345 1:233295290-233295312 CCCACAGCTCCCCGGGACCGGAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 923369361 1:233295321-233295343 CTCACCAGGTGCAGGGCCAGGGG 0: 1
1: 0
2: 2
3: 28
4: 359
923369347_923369361 -1 Left 923369347 1:233295299-233295321 CCCCGGGACCGGACCCTCCCCAC 0: 1
1: 0
2: 1
3: 11
4: 195
Right 923369361 1:233295321-233295343 CTCACCAGGTGCAGGGCCAGGGG 0: 1
1: 0
2: 2
3: 28
4: 359
923369346_923369361 7 Left 923369346 1:233295291-233295313 CCACAGCTCCCCGGGACCGGACC 0: 1
1: 0
2: 1
3: 9
4: 175
Right 923369361 1:233295321-233295343 CTCACCAGGTGCAGGGCCAGGGG 0: 1
1: 0
2: 2
3: 28
4: 359
923369350_923369361 -9 Left 923369350 1:233295307-233295329 CCGGACCCTCCCCACTCACCAGG 0: 1
1: 0
2: 5
3: 56
4: 546
Right 923369361 1:233295321-233295343 CTCACCAGGTGCAGGGCCAGGGG 0: 1
1: 0
2: 2
3: 28
4: 359
923369338_923369361 24 Left 923369338 1:233295274-233295296 CCTTCTTCCCTCCATACCCACAG 0: 1
1: 0
2: 4
3: 86
4: 576
Right 923369361 1:233295321-233295343 CTCACCAGGTGCAGGGCCAGGGG 0: 1
1: 0
2: 2
3: 28
4: 359
923369343_923369361 13 Left 923369343 1:233295285-233295307 CCATACCCACAGCTCCCCGGGAC 0: 1
1: 0
2: 1
3: 17
4: 189
Right 923369361 1:233295321-233295343 CTCACCAGGTGCAGGGCCAGGGG 0: 1
1: 0
2: 2
3: 28
4: 359
923369348_923369361 -2 Left 923369348 1:233295300-233295322 CCCGGGACCGGACCCTCCCCACT 0: 1
1: 0
2: 0
3: 8
4: 201
Right 923369361 1:233295321-233295343 CTCACCAGGTGCAGGGCCAGGGG 0: 1
1: 0
2: 2
3: 28
4: 359
923369349_923369361 -3 Left 923369349 1:233295301-233295323 CCGGGACCGGACCCTCCCCACTC 0: 1
1: 0
2: 1
3: 20
4: 269
Right 923369361 1:233295321-233295343 CTCACCAGGTGCAGGGCCAGGGG 0: 1
1: 0
2: 2
3: 28
4: 359
923369340_923369361 16 Left 923369340 1:233295282-233295304 CCTCCATACCCACAGCTCCCCGG 0: 1
1: 0
2: 0
3: 27
4: 269
Right 923369361 1:233295321-233295343 CTCACCAGGTGCAGGGCCAGGGG 0: 1
1: 0
2: 2
3: 28
4: 359
923369339_923369361 17 Left 923369339 1:233295281-233295303 CCCTCCATACCCACAGCTCCCCG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 923369361 1:233295321-233295343 CTCACCAGGTGCAGGGCCAGGGG 0: 1
1: 0
2: 2
3: 28
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923369361 Original CRISPR CTCACCAGGTGCAGGGCCAG GGG Exonic
900279607 1:1858011-1858033 CTCAGCTAGTGCAGTGCCAGAGG - Intronic
900354051 1:2251420-2251442 CTCAGCAGGGGCTGGGGCAGGGG - Intronic
900439242 1:2645125-2645147 CACACAGGGAGCAGGGCCAGAGG + Intronic
900506586 1:3032436-3032458 ACCACCTGGTGCAGGGCCTGGGG + Intergenic
900532301 1:3160588-3160610 CCCACGAGGTGCAGGTGCAGGGG + Intronic
900588361 1:3444949-3444971 CTGACCAGCTGCAAGCCCAGTGG + Intergenic
900780686 1:4615558-4615580 CTCCCCATGTGCAGGGGCAGGGG + Intergenic
901931418 1:12598120-12598142 CTCTACATGTGCAGGGGCAGTGG + Intronic
903570131 1:24298068-24298090 CTCACCAGGGGCAAGTTCAGCGG - Intergenic
904160319 1:28518208-28518230 CTCACCCGGGTCGGGGCCAGAGG + Intronic
905313344 1:37065707-37065729 CTGTCCAGGTGGACGGCCAGTGG - Intergenic
905403405 1:37718384-37718406 TGCTCCAGCTGCAGGGCCAGGGG - Exonic
905420631 1:37841166-37841188 CACACCAGGTTCAAGGCCATCGG + Intronic
906103694 1:43279234-43279256 AGGACAAGGTGCAGGGCCAGGGG + Intergenic
906128196 1:43440513-43440535 CTCCCCAGGGACAGGGGCAGGGG - Exonic
906318240 1:44801589-44801611 CTCACCAGGGGCTGAGGCAGTGG + Intronic
907278895 1:53332181-53332203 CTCTCCAGTACCAGGGCCAGAGG + Intergenic
907513878 1:54981063-54981085 CCCACCTGGGGCAGGGCCATCGG - Exonic
908403039 1:63788817-63788839 CTAACCAGGTTGAGGCCCAGAGG - Intronic
908464980 1:64384820-64384842 CTGACCAGGTGCATTGCCAATGG - Intergenic
909632259 1:77779729-77779751 AGCTCCAGGTACAGGGCCAGGGG + Exonic
910643631 1:89490276-89490298 CTGACCTGGTGCAGTCCCAGTGG + Intergenic
913173515 1:116253623-116253645 CTCACCAAGTACAGGGACTGGGG + Intergenic
913510106 1:119553630-119553652 CTCACCACCTGCAGCCCCAGGGG + Intergenic
915298922 1:154941176-154941198 CTCACCTGTTCCTGGGCCAGGGG - Intergenic
918533772 1:185551729-185551751 CTCACAAGGTAGAGGGCAAGTGG - Intergenic
920286106 1:204881070-204881092 CTCCCCTGGGGCAGGGGCAGAGG + Intronic
920491016 1:206415453-206415475 CACACCAGGAGCAGTGCCAATGG - Intronic
920831168 1:209467057-209467079 CTCTCCAGGATCCGGGCCAGTGG + Intergenic
920911347 1:210220310-210220332 TAAACCAGGTGCAGGGGCAGAGG + Intergenic
921157804 1:212451958-212451980 CCCAGCAGGTGCAGGGACATAGG + Intergenic
921191198 1:212710244-212710266 ATGCCGAGGTGCAGGGCCAGAGG - Intergenic
921391631 1:214621204-214621226 CTTTCCAGATGCAGGGCGAGTGG + Intronic
921876584 1:220203212-220203234 CTCACTAGGTGAAGGGACTGAGG - Intronic
922988454 1:229885029-229885051 CACATCATGTGCAGGGCCAGCGG + Intergenic
923369361 1:233295321-233295343 CTCACCAGGTGCAGGGCCAGGGG + Exonic
1063709497 10:8463566-8463588 CTCACAAGGTGCGGGACCACAGG + Intergenic
1063883146 10:10551429-10551451 CTCCCCAGCTGCCGGGCCAAAGG - Intergenic
1064277300 10:13917824-13917846 CTCACAAGGTGCATGGCCTTGGG + Intronic
1065021501 10:21505810-21505832 CTCAGCACATGCAGGGCAAGAGG + Intergenic
1065980778 10:30894410-30894432 CTTCCCAGGTGCTGGGTCAGCGG - Intronic
1067284018 10:44894523-44894545 CTCATGAGGAGCAGGGTCAGAGG + Intergenic
1067788996 10:49273313-49273335 CTCACCAGTAGCTGGGCCAGAGG - Intergenic
1069104879 10:64371682-64371704 CTCACCAGAAGTAGGTCCAGTGG + Intergenic
1069726867 10:70585778-70585800 CTCAGCTGCTGCAGGGCCTGAGG - Intergenic
1070515091 10:77197641-77197663 CTCACCACGTTCAGGGCCATCGG + Intronic
1070585657 10:77764023-77764045 CTCTCCAGCCTCAGGGCCAGGGG - Intergenic
1071163879 10:82782379-82782401 CTCACCAGATGCAGGTCCCTTGG + Intronic
1073435544 10:103513741-103513763 CTCACCAGCTCCTAGGCCAGAGG - Intronic
1075957815 10:126539048-126539070 ATCCCCAGCTGCAGGGCCATGGG + Intronic
1076221088 10:128733742-128733764 TGCAGCAGGTGCATGGCCAGTGG - Intergenic
1076606332 10:131692009-131692031 CTCCCGAGGAGCAGGGACAGGGG - Intergenic
1076608154 10:131702698-131702720 CACACCGTGTGCAGGGCCTGTGG + Intergenic
1076647588 10:131963860-131963882 CTCACACCGTGCAGGGCTAGTGG + Intergenic
1077097723 11:806129-806151 CTCACCAGCTACAGGGCCTCGGG - Intronic
1077145677 11:1043230-1043252 CACACCAGGTGCCGGCCCAAGGG + Intergenic
1077164744 11:1129971-1129993 CTCAGCCGGCGCAGGGCCAGGGG + Intergenic
1078064218 11:8067314-8067336 CTCATGAGGAGCAGAGCCAGGGG - Intronic
1078842976 11:15096346-15096368 CTGACCAAGTGCAGTTCCAGTGG - Intergenic
1079075400 11:17382525-17382547 CTCTCCAGCAGAAGGGCCAGAGG + Intergenic
1081976205 11:47236661-47236683 CTTACCAGGTGCTGGGCATGGGG - Intronic
1081993659 11:47350572-47350594 CTCAGCAGGGGCAGGGGCAGGGG + Exonic
1083271607 11:61575677-61575699 CTGGCCAGGTACAGGGCCGGGGG + Intronic
1083924520 11:65797901-65797923 CTCCCCAGGTGCCTGGACAGAGG - Intergenic
1084589902 11:70084563-70084585 CTCTCCAGCTGCAAGGCCTGGGG - Intronic
1085258386 11:75190289-75190311 CTCACCAGCCACAGGGCCTGAGG - Intronic
1087084035 11:94198510-94198532 CTTACTAGCTGCAGGGCCTGGGG + Intergenic
1087686600 11:101272563-101272585 GGCACCAGGTGGAAGGCCAGTGG + Intergenic
1088546405 11:110963843-110963865 TTCATCAGGTGAAGGGGCAGGGG - Intergenic
1089951770 11:122534731-122534753 CTCACCAGGGCCAGGGCCTCTGG - Intergenic
1090643517 11:128748791-128748813 CTCATGAGGTGAGGGGCCAGAGG + Intronic
1091791226 12:3273367-3273389 CGGAGCAGGTGCAGGTCCAGGGG - Intronic
1096292111 12:50351924-50351946 CTCAGCAGGCGCAGGCTCAGGGG - Exonic
1096292131 12:50351996-50352018 CTCAGCAGGCGCAGGCTCAGGGG - Exonic
1096292186 12:50352176-50352198 CTCAGCAGGTCCAGGCCCTGGGG - Exonic
1096292374 12:50352860-50352882 CTCAGCAGGCGCAGGCCCTGGGG - Exonic
1096292537 12:50353436-50353458 CTCAGCAGGCGCAGGCCCTGGGG - Exonic
1100971680 12:100077996-100078018 CTTCCCAGGAGCAGGGTCAGAGG - Intronic
1103014671 12:117484663-117484685 CTCAACAGAGGCAGGGCCTGGGG + Intronic
1103072141 12:117953632-117953654 GTTACCATGTGCTGGGCCAGGGG + Intronic
1103339948 12:120215925-120215947 CTCACCGGGCGCTGGGCCTGGGG + Intronic
1103885560 12:124197721-124197743 CTCCCCAGGAGAGGGGCCAGAGG + Intronic
1104974474 12:132546304-132546326 CTCACCAAGGGCTGGGCCACAGG - Intronic
1104980475 12:132571169-132571191 CTCGCCACGTGCGGGCCCAGGGG - Intronic
1105347892 13:19590683-19590705 CTTACCAGGGGCAGGGCCCTGGG + Intergenic
1105605648 13:21924514-21924536 CATTCCTGGTGCAGGGCCAGGGG - Intergenic
1106279209 13:28248778-28248800 CTCTCAAAGTGCTGGGCCAGAGG + Intronic
1106449286 13:29865146-29865168 CTCACCAAGTGAAGTGCTAGGGG + Intergenic
1107480269 13:40780505-40780527 CTCACCAGGGGCAGAGCCCTGGG + Intergenic
1107972529 13:45657482-45657504 ATGGCCAGGTCCAGGGCCAGAGG - Intergenic
1108623218 13:52204084-52204106 CTCACAAGGGGCAGGGCCCTGGG + Intergenic
1108663510 13:52606954-52606976 CTCACCAGGGGCAGGGCCCTGGG - Intergenic
1111303354 13:86373580-86373602 CTGACCAAGTGCAGTCCCAGTGG - Intergenic
1113910831 13:113840435-113840457 CTCAGCTCCTGCAGGGCCAGAGG + Intronic
1113923115 13:113925509-113925531 CTCACCAGGGGCTGGACCAGAGG - Intergenic
1113944490 13:114036210-114036232 CTCCCCTGATGCAGGGCCAGCGG - Intronic
1114549816 14:23526243-23526265 CTCTCCCCGTGCAGGGGCAGAGG + Exonic
1117064841 14:52002451-52002473 CTGCCCAGGTGAAGGGACAGGGG + Intronic
1117208358 14:53469441-53469463 CTCACCTAGTGCAGTCCCAGTGG - Intergenic
1117336944 14:54764025-54764047 CTCGCCAGGTGCAGAGACAGCGG - Intronic
1119519215 14:75273389-75273411 ATCACCATGTGCAGGGCCAGGGG - Intergenic
1121928182 14:97948275-97948297 GTCACCAGGTGCAGTGGCAGAGG - Intronic
1122071151 14:99206081-99206103 CTCTCCAGGAGCAGAGGCAGAGG + Intronic
1122157635 14:99759758-99759780 CTCAGCAGCAGCAGGGCCTGGGG + Intronic
1122369600 14:101222058-101222080 CCCAGCAGGGGCAGGGGCAGCGG - Intergenic
1122631825 14:103110752-103110774 CTGACCAGGCACAAGGCCAGTGG - Intergenic
1122802551 14:104238941-104238963 CTCCTCCGGTGCATGGCCAGGGG - Intergenic
1122812618 14:104296487-104296509 CTCGCCCTGTGCAGGGCCTGGGG + Intergenic
1123062514 14:105600657-105600679 CTGACCTGGTCCCGGGCCAGTGG - Intergenic
1123087255 14:105722385-105722407 CTGACCTGGTCCCGGGCCAGTGG - Intergenic
1123720800 15:23060584-23060606 CTCACCAGATGCAGATGCAGGGG - Intergenic
1123995671 15:25716346-25716368 CTGGCCTGGGGCAGGGCCAGAGG - Intronic
1124082915 15:26517816-26517838 ATCACCAGGTGGAGGGACTGTGG - Intergenic
1124606280 15:31172315-31172337 CAGTCCAGGTGCAGAGCCAGAGG - Intergenic
1124615166 15:31236465-31236487 CTCCCCACGGGCCGGGCCAGGGG + Intergenic
1125608705 15:40956857-40956879 TCCTCCAGCTGCAGGGCCAGCGG + Intergenic
1125727165 15:41874001-41874023 CTCACCAGGGGCAGGTGCAACGG - Exonic
1125921127 15:43526599-43526621 CTCACGAGCTGGATGGCCAGGGG + Exonic
1126538531 15:49795735-49795757 CTCATCAGGTGCCAGGCGAGAGG + Intergenic
1126660623 15:51030108-51030130 CTGACACAGTGCAGGGCCAGTGG - Intergenic
1126706970 15:51414869-51414891 CTCACCCAGTGCAGTCCCAGTGG + Intergenic
1127993697 15:64139007-64139029 AGCACCAGGGGAAGGGCCAGTGG + Exonic
1128515705 15:68340619-68340641 CCCACCAGTTGCAGGACAAGGGG + Intronic
1129990225 15:79955545-79955567 CTCACCAGGGCCAGGCGCAGTGG - Intergenic
1131094888 15:89648811-89648833 CGCTCCAGGCCCAGGGCCAGCGG + Intronic
1132337527 15:101057993-101058015 CTCACCACCGACAGGGCCAGCGG - Exonic
1132691180 16:1182602-1182624 CTCCCCAGGGGCCTGGCCAGGGG - Intronic
1132868370 16:2104732-2104754 CTCTCCAGCTGCAGGGCTGGGGG - Intronic
1133207130 16:4240473-4240495 CTGAGCAGGAGCAGGGACAGAGG + Intronic
1133255877 16:4515273-4515295 CAAATCAGGGGCAGGGCCAGAGG + Intronic
1133275962 16:4638627-4638649 CCCACCAGGTGGGAGGCCAGAGG - Intronic
1133286367 16:4692675-4692697 CTCACCAGCAGCAGGGCCCAGGG - Intergenic
1134523359 16:14928269-14928291 CTCTCCAGCTGCAGGGCTGGAGG + Intronic
1134710953 16:16326753-16326775 CTCTCCAGCTGCAGGGCTGGGGG + Intergenic
1134948630 16:18341856-18341878 CTCTCCAGCTGCAGGGCTGGGGG - Intergenic
1135768958 16:25201672-25201694 CTCCCAAAGTGCTGGGCCAGAGG - Intergenic
1136687555 16:32004044-32004066 CTCACCTTGTGCAGGGGGAGGGG + Intergenic
1136788165 16:32947595-32947617 CTCACCTTGTGCAGGGGGAGGGG + Intergenic
1136881619 16:33906194-33906216 CTCACCTTGTGCAGGGGGAGGGG - Intergenic
1137691302 16:50429970-50429992 ATCACCAGGCCCAGGGGCAGAGG + Intergenic
1139004826 16:62558101-62558123 CTGACCTGGTGCAGACCCAGTGG - Intergenic
1139375399 16:66493590-66493612 CTCACCCGATGAAGGGCCAGGGG - Intronic
1139592387 16:67940523-67940545 CTCAGCAGGTTGTGGGCCAGGGG - Intronic
1140196347 16:72858816-72858838 CTGACCCGCTGCAGGGCCTGGGG - Intronic
1141132567 16:81445609-81445631 GGCTCCAGGTGCAGCGCCAGGGG - Intronic
1142350157 16:89576043-89576065 TGCAGCAGGCGCAGGGCCAGTGG + Exonic
1142426104 16:90003160-90003182 CTCCCCAGGACCAGTGCCAGTGG + Intergenic
1203090394 16_KI270728v1_random:1209252-1209274 CTCACCTTGTGCAGGGGGAGGGG + Intergenic
1142743027 17:1941699-1941721 CTCTCCAGGAGGAGGGGCAGGGG - Intronic
1143106338 17:4532316-4532338 CAGACCAGGGGCAGGACCAGAGG - Intronic
1143658999 17:8313247-8313269 CCAAACAGGTGCAGGGCCTGGGG + Exonic
1143906665 17:10214739-10214761 CTAACCTGGTGAAGGGCCACAGG - Intergenic
1144853289 17:18254754-18254776 CACAACAGGTGCCAGGCCAGTGG - Exonic
1144877953 17:18412155-18412177 CACACCAGGCGCAGGGACACAGG - Intergenic
1145154276 17:20532270-20532292 CACACCAGGCGCAGGGACACAGG + Intergenic
1145183739 17:20775908-20775930 CTCACAATGGGCAGGGCCTGGGG + Intergenic
1145241217 17:21241955-21241977 CTCCCCCGGTGCAGGGGCAGTGG - Exonic
1145918514 17:28591950-28591972 CTCACGAGGTGCAAGGACATAGG + Intronic
1146693690 17:34893349-34893371 CTCCCCTAGTGCAGGGTCAGAGG + Intergenic
1147148536 17:38499713-38499735 CTCACCTTGTGCAGGGGGAGGGG + Intronic
1147375202 17:40018919-40018941 CTCAGCTGGGGAAGGGCCAGGGG - Intergenic
1147598796 17:41733564-41733586 CGCAACAGGTGCAGGGTGAGTGG - Intronic
1147668127 17:42161583-42161605 CTAAGCAGATGCAGGGGCAGGGG - Intronic
1148322403 17:46765502-46765524 CTCACCGTGTGGAGGGCCCGGGG + Intronic
1149646051 17:58242449-58242471 CTCTCCTGGGGCTGGGCCAGAGG + Intronic
1150284189 17:63946241-63946263 CTGACCAGCTGCATGGCCACAGG + Intronic
1152022197 17:77785933-77785955 CTCATCAGCTGAAGGCCCAGCGG + Intergenic
1152622030 17:81369783-81369805 CTCCCCAGGAGCAGGGCTAGAGG - Intergenic
1152689731 17:81712502-81712524 CTCACCTTGAGCAGGTCCAGCGG - Exonic
1152863631 17:82709759-82709781 CTCCCCAGGTACAGGCCAAGGGG - Intergenic
1152922653 17:83073619-83073641 CTCACCAGGAGCCTGTCCAGTGG - Intergenic
1155382895 18:25244159-25244181 TCCACCAGATGCAGGTCCAGGGG + Intronic
1157557583 18:48622791-48622813 TTCCCCAGGAGCAGGGCCTGTGG + Intronic
1157911399 18:51620369-51620391 CTCACATGGTGCAGGGGGAGTGG - Intergenic
1158403430 18:57140956-57140978 CTCCCCAACTGCAGGGCCATTGG - Intergenic
1158691547 18:59665774-59665796 CTCACCAAGAGCAGAGCAAGTGG + Intronic
1160156843 18:76441240-76441262 CTCACCTGGTGCAGGTTCAGGGG + Exonic
1160929523 19:1563612-1563634 CTCAGCAGGAGCAGGGCCGGAGG + Intronic
1161063998 19:2228675-2228697 CTCACGGGGTGCCAGGCCAGGGG + Intronic
1161265665 19:3362788-3362810 CTGAGCAGGTGCGGGGCTAGGGG + Intronic
1161366683 19:3883961-3883983 CTCACTGGGGGCAGGGGCAGGGG - Intronic
1162458128 19:10798150-10798172 CTCACCCAGTGCTGGGCAAGAGG + Intronic
1162918922 19:13889098-13889120 CTCACTCGGTGCAGTGGCAGAGG - Intronic
1163156441 19:15442440-15442462 CCTGCCAGGAGCAGGGCCAGAGG - Intronic
1163832149 19:19552197-19552219 CTGGCCAGGGGCTGGGCCAGGGG - Intergenic
1164773853 19:30835060-30835082 CTCGCCAAGGGCAGGGCCTGGGG + Intergenic
1165107793 19:33484013-33484035 CTGAACAGGGGCAGGGACAGGGG + Intronic
1165126170 19:33599452-33599474 CTCCCCATGTGCAGGGCCAGAGG - Intergenic
1166042964 19:40214204-40214226 CTCACCAGGGCCATGGCCCGCGG - Exonic
1166124210 19:40703939-40703961 CTCACCACATGCAGGGCCCTGGG + Intronic
1166743261 19:45126879-45126901 ATCACCAGGAGCACGGCCTGTGG + Intronic
1167094861 19:47369741-47369763 CTCACCTGACCCAGGGCCAGAGG - Intronic
1167169171 19:47819851-47819873 CTTCCCTGCTGCAGGGCCAGGGG + Intronic
1167394443 19:49218819-49218841 CTCACCAGGTCCCGGGTGAGGGG - Intergenic
1167705966 19:51081495-51081517 TTCACTAGGTACAGGGACAGGGG + Intronic
1168354257 19:55692001-55692023 CTCCCCAGCTGCAGGGGCTGGGG - Exonic
1168580633 19:57553049-57553071 CTTACAAGGTGGAGGGACAGAGG - Intronic
924965138 2:69585-69607 CTCAGCAGGGCCAGGGCCACTGG + Intergenic
924975549 2:171227-171249 CTCCCCAGTAGCAGGGGCAGTGG + Intergenic
925869275 2:8255042-8255064 TCCACCAGGTGCCAGGCCAGAGG - Intergenic
928174569 2:29024897-29024919 CTCCCCAGGAGCAGGTCCAGTGG - Intronic
928366588 2:30707615-30707637 CTCAACAGGCTCTGGGCCAGGGG + Intergenic
928407236 2:31024021-31024043 CTCAGTAGGAGCAGGTCCAGAGG - Intronic
931282623 2:60807571-60807593 GTCACCAGGTGAAGGGCGTGGGG + Intergenic
931542287 2:63342278-63342300 CTAACCAGGTCCATGGCCTGGGG + Intronic
931745988 2:65292510-65292532 CTGACCAGGTTCAGAGGCAGCGG - Intergenic
932131929 2:69195383-69195405 GTCACCAGGTGCAAGGGGAGGGG - Intronic
932593094 2:73078866-73078888 CTCACCAGGTGGCTGGTCAGGGG - Intronic
932736512 2:74258244-74258266 CTCTTCAGGTGCAAGCCCAGAGG - Intronic
932741214 2:74292409-74292431 CTCACCACATGCTGGGCCACTGG + Intronic
934819541 2:97360282-97360304 CTCCCCAGGGGCTGGGACAGAGG - Intergenic
935357427 2:102215587-102215609 CTTGCCAGGTGCAGGGCTACTGG - Intronic
936076401 2:109404454-109404476 CTCTGCAGGGGCAGGGACAGGGG + Intronic
937273549 2:120670412-120670434 CTCACCATGTCCCGGGCCACGGG + Intergenic
938406631 2:131036534-131036556 GTCACCAGGTGTCGGGCAAGAGG - Intronic
938658631 2:133462884-133462906 CTCAGCAGGAGTAGGGCCGGTGG - Intronic
938954894 2:136288287-136288309 CTCGCCAGGTGCTGCTCCAGGGG + Intergenic
940840688 2:158577376-158577398 AGCACCAGGTACAGGGCCAATGG + Exonic
941115087 2:161462663-161462685 CTCACCAGGGGAAGTGCAAGGGG - Intronic
942095221 2:172530828-172530850 CTCACCAGTTTCAGGTCCACAGG - Intergenic
942265686 2:174223085-174223107 CTCACAATGGGCAGGGCCTGGGG - Exonic
945539707 2:211069848-211069870 CACACCAGGGCCAGGGGCAGTGG + Intergenic
946364230 2:219238700-219238722 CTTACCAGGTGCAGAGTCACAGG + Exonic
947856351 2:233327056-233327078 CTCCCTGGGTGCCGGGCCAGAGG - Intronic
948455912 2:238104552-238104574 GTCATCACGGGCAGGGCCAGGGG + Intronic
948621281 2:239236276-239236298 CTCACGGGGATCAGGGCCAGGGG + Intronic
948981263 2:241496090-241496112 GCCACCAGGTGGAGGGGCAGAGG + Intronic
1168962054 20:1876681-1876703 CTGACCAGGTGCATGGCCTCGGG + Intergenic
1169244646 20:4015756-4015778 CTAACCAGGAACAGAGCCAGCGG - Intergenic
1170610156 20:17906290-17906312 CACACCTTGTGCAGGGGCAGTGG - Intergenic
1171169788 20:23005923-23005945 TTCACAAGATGCAGGGTCAGTGG + Intergenic
1172049393 20:32105166-32105188 TTGACCAGGTGCAGGTGCAGTGG + Intergenic
1172567049 20:35938857-35938879 CGCGGCAGGGGCAGGGCCAGGGG - Exonic
1172666650 20:36605100-36605122 CTCACCATGTGCTGCGTCAGTGG - Intronic
1173789285 20:45817329-45817351 CTAAGCAGGTCCAGGGCCTGGGG + Intergenic
1174147003 20:48459079-48459101 CACAGCAGGGGAAGGGCCAGGGG + Intergenic
1174186021 20:48706909-48706931 CCCACCTGGGGCAGGGGCAGTGG - Intronic
1174461869 20:50689008-50689030 CTCAGAAGCTGCAGGGCCATAGG + Intronic
1174516408 20:51095700-51095722 CCCACCAGGTGGAGTTCCAGTGG - Intergenic
1174718087 20:52781553-52781575 GTGGGCAGGTGCAGGGCCAGTGG + Intergenic
1175809014 20:61847458-61847480 CCCACCATGTGCAGAGACAGTGG + Intronic
1175913255 20:62414446-62414468 CTCTGAAGGTGCAGGGACAGGGG + Exonic
1176515644 21:7781496-7781518 CTCACAAGGTGCAGAGAGAGAGG + Intergenic
1177801995 21:25836961-25836983 CTCACCAGGAGCTGGGAGAGAGG - Intergenic
1178649672 21:34411508-34411530 CTCACAAGGTGCAGAGAGAGAGG + Intergenic
1178727962 21:35071922-35071944 CTCACCAGGTGCATGTACATTGG + Intronic
1180226370 21:46394974-46394996 ATCACCATCTTCAGGGCCAGGGG - Intronic
1180968130 22:19801082-19801104 CTCACCAAGGACAGGGCCCGGGG - Intronic
1181111183 22:20603923-20603945 CTCACCTGGTACTGGCCCAGGGG + Intergenic
1181473361 22:23154136-23154158 TTCTCCAGGTGCCGGGGCAGAGG - Intronic
1181509460 22:23382533-23382555 CTCACGCAGTGCAGGGCCAGGGG - Intergenic
1182325751 22:29511396-29511418 CTCTGCAGGGGCTGGGCCAGGGG + Intronic
1182367515 22:29788992-29789014 GAGACCTGGTGCAGGGCCAGTGG - Exonic
1183496097 22:38144945-38144967 CTCACCAGGTGCCAGGTCTGTGG - Intronic
1183529849 22:38347439-38347461 CTCAAGAGATGCAGGGCCAGGGG + Intronic
1183725037 22:39583881-39583903 CCTACTATGTGCAGGGCCAGTGG - Intronic
1183726004 22:39590065-39590087 CTCTCCAGGAGCCGAGCCAGAGG - Intronic
1183751069 22:39720719-39720741 GTTACCAGGGGCTGGGCCAGGGG + Intergenic
1184064337 22:42108633-42108655 CTCACAATGGGCAGGGCCTGGGG - Intergenic
1184104954 22:42362159-42362181 CTCTCCACGTGGATGGCCAGTGG - Intergenic
1184108339 22:42381491-42381513 CCCACCAGGTCAGGGGCCAGTGG + Exonic
1184382655 22:44155521-44155543 CTCAGCAGGCTCAGGGCCTGCGG + Intronic
1184818520 22:46890963-46890985 CCCACCTGCTGCAGGGCCTGTGG + Intronic
1184877541 22:47285013-47285035 CTCACCAGCTGCAGGGGCCTCGG + Intergenic
1185001670 22:48250155-48250177 CTTACCATGGGCAGGGTCAGGGG + Intergenic
1185043809 22:48518869-48518891 CTCACCTGGAGGAGGGACAGAGG + Intronic
950831632 3:15880091-15880113 CTCCCCAGGGCCAGGGACAGGGG - Intergenic
951709018 3:25571044-25571066 GTGACCAGGAGCAGGCCCAGAGG + Intronic
952066996 3:29582661-29582683 CTCACCAGATGTAGGTACAGAGG + Intronic
953680835 3:45036773-45036795 CTTACCAGCTTCAGGACCAGTGG - Intergenic
954793275 3:53148223-53148245 CTCAGCAGGCCCAGGGCCACAGG - Intergenic
954845614 3:53552904-53552926 CTCAGCAGGTGAAGGTACAGTGG - Intronic
956008119 3:64802135-64802157 CTCAGCAGGGGCAGGGCCAAAGG - Intergenic
956717083 3:72088171-72088193 CGCACCTGGGGCAGGGCCAGTGG + Intergenic
959189770 3:103096892-103096914 CTCACCCAGGGCAGTGCCAGAGG - Intergenic
960972421 3:123149380-123149402 CTCAGCTGGTGCAGGGGCTGTGG + Intronic
961058409 3:123808207-123808229 CTCACCAGGGGCAGGGCACAGGG + Intronic
961333310 3:126155489-126155511 CTCCCCAGGTGCAGGCCGTGAGG - Exonic
961360870 3:126366315-126366337 CTCAGCAGGTGGGAGGCCAGAGG - Intergenic
961372590 3:126440635-126440657 CTCCCCAGGAGCAGGGGCAGGGG - Intronic
961378486 3:126482372-126482394 CTCACAAGGTGGAGGACGAGCGG - Exonic
961503512 3:127354928-127354950 TTGGCCACGTGCAGGGCCAGAGG - Intergenic
962312510 3:134336672-134336694 GACACCAGGAGCAGGTCCAGGGG - Intergenic
963713000 3:148768824-148768846 CTCACATGGTGGAGGGGCAGGGG - Intergenic
964882583 3:161440628-161440650 ATCATCAGGGGCAGGGCCTGGGG - Intergenic
967994374 3:195155469-195155491 CTCTCCAGGCCCAGGGCCACAGG + Intronic
968004883 3:195236017-195236039 CTGACCAAGTGCAGTCCCAGTGG - Intronic
969477862 4:7431540-7431562 CTCTCCAGGAGCAGCCCCAGAGG - Intronic
969516931 4:7653077-7653099 CTCACCAGGGACAAGGACAGTGG + Intronic
969568049 4:7991878-7991900 CTCCCCAGGGGCAAGGCCACAGG - Intronic
971227425 4:24767769-24767791 TACATCAGGTGCAGTGCCAGGGG + Intergenic
975112642 4:70644110-70644132 CTCCCCAGGTGCAAGACCATAGG - Exonic
976076216 4:81302011-81302033 CACAGAAGGTACAGGGCCAGTGG - Intergenic
976320340 4:83707285-83707307 CTCACCAGGTTCAAGGGGAGGGG - Intergenic
980053912 4:128061943-128061965 TGCGCCAGGTGCAGCGCCAGGGG - Intronic
981170299 4:141615584-141615606 TGCACCAAGTGCAGGGCCTGTGG - Intergenic
982139476 4:152304288-152304310 CTGCCCTGGTGCAGGGACAGAGG - Intergenic
983449744 4:167895246-167895268 GTTTCCAGGTGGAGGGCCAGAGG - Intergenic
985634398 5:1028755-1028777 CTCGCTAGGGACAGGGCCAGAGG + Intronic
986425391 5:7626435-7626457 CTCCCCAGGTGCAGAGCCCAGGG - Intronic
987645968 5:20672613-20672635 CTCACCCAGTGCAGTCCCAGTGG + Intergenic
988181702 5:27803426-27803448 CTCACCAGATGCTGCCCCAGAGG - Intergenic
992613274 5:78526011-78526033 CTCCCCAAGTCCAGTGCCAGGGG + Intronic
992888218 5:81180514-81180536 CTCAGAAGCTGCAGGGACAGAGG - Intronic
995739505 5:115340157-115340179 CTCATCAGGTTCAGGGCAATGGG + Intergenic
998382262 5:141734353-141734375 CTCCCCAGGAGTAGTGCCAGTGG - Intergenic
1001694624 5:173660813-173660835 CTCACCAGGTCCAGGCCCCAAGG + Intergenic
1002164095 5:177333921-177333943 CTCACTAGGTGCTGGGGCAGTGG - Intronic
1002359979 5:178662623-178662645 CGCACCAGGGGCAAGGCCATGGG + Intergenic
1002419661 5:179139088-179139110 CTAAGCAGCTGCAGGGCCTGCGG + Intronic
1003113945 6:3270971-3270993 CTGTCCAGGTGCAGGCTCAGGGG + Exonic
1006020060 6:31112503-31112525 CAGACCAGGAGCAGGCCCAGAGG + Exonic
1006614027 6:35312566-35312588 CACACAAGGTGCAGGGCGAAGGG + Intronic
1007476191 6:42121608-42121630 GTCACCAGGGGCTGGGCCAGTGG + Intronic
1008226734 6:48928186-48928208 CTGAGCAGGTGCAGTGCAAGAGG + Intergenic
1013702815 6:112794819-112794841 CACAACATGAGCAGGGCCAGAGG + Intergenic
1015394307 6:132717684-132717706 TTCACCAGGTGAAGTGCAAGAGG - Intergenic
1016728906 6:147406957-147406979 CCCCCCAGGGGCAGGGCCCGCGG + Intergenic
1019172131 6:170138475-170138497 GCCACCAGGTGCAGGCCCACGGG + Intergenic
1019339849 7:503794-503816 CTCAACAGTTGCAGGGCGTGGGG + Intronic
1019527716 7:1488201-1488223 CTCACCAGAGCCAAGGCCAGCGG + Intronic
1019663913 7:2241952-2241974 GTCTCCAGGGGCAGGGCCGGCGG - Intronic
1019817280 7:3210616-3210638 CTCACCAGGCCCAGCCCCAGAGG + Intergenic
1019928032 7:4206085-4206107 CTCTCCAGGTGGAGCGCCTGCGG - Intronic
1020007726 7:4791323-4791345 CTGACCGTGCGCAGGGCCAGGGG - Exonic
1021571059 7:22065655-22065677 ATCACCAGGGCCAGGACCAGGGG - Intergenic
1021909118 7:25366662-25366684 GTCCCCAGGGGCAGAGCCAGAGG + Intergenic
1024000424 7:45185713-45185735 CTCACCAGGGACAGGGCCGGTGG + Intronic
1024213603 7:47227946-47227968 CTCACCAGGAGGCAGGCCAGGGG - Intergenic
1024296989 7:47852494-47852516 CTCTCCAGGGCCAGGGCCTGTGG + Intronic
1025022759 7:55492657-55492679 CTCACCAGGGGCTGTCCCAGAGG - Intronic
1027778942 7:82499688-82499710 CACTCCCAGTGCAGGGCCAGCGG - Intergenic
1028103555 7:86850499-86850521 CTCAACAGGTTCAGTGTCAGTGG + Exonic
1029188359 7:98755193-98755215 CTCAGCAGGTGCATCCCCAGGGG + Intergenic
1030222558 7:107111473-107111495 CTGACCAAGTGCAGTCCCAGTGG + Intronic
1032433624 7:131882581-131882603 CCCACAAGGTGCATGGCCAGTGG + Intergenic
1032625905 7:133591014-133591036 GTCAGCAGGTGCAGGGGCTGGGG - Intronic
1034516648 7:151586044-151586066 CTCACTCTGTGCAGGGGCAGTGG - Intronic
1035047686 7:155980047-155980069 CACACCAGCTGCAGGGGAAGGGG + Intergenic
1035785137 8:2254043-2254065 CTCCCCAGGTGCAGGGGCTCAGG - Intergenic
1035807674 8:2467673-2467695 CTCCCCAGGTGCAGGGGCTCAGG + Intergenic
1035817776 8:2559890-2559912 CTTACCAGCTGTAGGACCAGGGG + Intergenic
1036258141 8:7221343-7221365 CTCACCTGGCGAGGGGCCAGTGG - Intergenic
1036310190 8:7679939-7679961 CTCACCTGGCGAGGGGCCAGTGG - Intergenic
1038584340 8:28775910-28775932 CACACCACGTGCAGGGGCTGAGG + Exonic
1039549856 8:38435521-38435543 CTCCCCAAGTTCAGGGCCACTGG - Intronic
1039842602 8:41304559-41304581 CTCCCCGAGTGCAGGGTCAGCGG - Intronic
1041778171 8:61547353-61547375 CTCCATAGTTGCAGGGCCAGTGG + Intronic
1044550176 8:93503410-93503432 CACACCTGGTGCAATGCCAGTGG + Intergenic
1045270577 8:100657719-100657741 GTCACCTGGTGAAGGTCCAGAGG + Intronic
1045693127 8:104779906-104779928 CTCATCAGGGGAAGGGACAGAGG - Intronic
1047225365 8:122952010-122952032 GTCACCAGTTCCAGGGCCACTGG - Exonic
1047275636 8:123402616-123402638 CTCCCCAGGGCCAGGGACAGGGG - Intronic
1047933733 8:129754221-129754243 CTAACCCAGTGCAGAGCCAGTGG + Intronic
1048776397 8:137951440-137951462 CTCTCCAGGTGCAGGTTTAGGGG + Intergenic
1048878874 8:138857287-138857309 CTCCCCAGATGTAGGGCCTGTGG - Intronic
1049171787 8:141166016-141166038 CTCACCAAGTGCAGCCTCAGGGG - Intronic
1049218664 8:141418958-141418980 CTCACCTGGGGCAGGGGTAGGGG + Intronic
1049275256 8:141717118-141717140 CTCACCAGCTCCAGGTCCACAGG + Intergenic
1049359187 8:142203887-142203909 GTCAGCAGGGGCGGGGCCAGGGG + Intergenic
1049421213 8:142517460-142517482 CTCACAGGGGGCAGGGCTAGAGG + Intronic
1049547542 8:143240522-143240544 CTCTCCAGGGGCAGTGTCAGTGG + Intergenic
1051357439 9:16252815-16252837 CTCACCAGGTCCAGGGCGGAGGG - Intronic
1051770409 9:20572191-20572213 GTTACCAGGGGCAGGGACAGAGG + Intronic
1052941055 9:34132635-34132657 CTCCCCAGGGCCAGGGACAGGGG + Intergenic
1055640920 9:78318366-78318388 ATTCCCAGGTGCAGGGGCAGTGG - Intronic
1056655364 9:88504282-88504304 CACACCAGGAGCAGGGCCCAGGG - Intergenic
1056688521 9:88786270-88786292 CTCACCAGCATCAGGGACAGTGG - Intergenic
1057773203 9:97984594-97984616 CTCACCAGGCGCAGGGAGACGGG - Intronic
1057789022 9:98110414-98110436 CTCACGTAGTCCAGGGCCAGAGG - Intronic
1058813970 9:108666995-108667017 AACACCATGTGCAGGGCCAGGGG + Intergenic
1059820949 9:117971399-117971421 AGCACCATGTGGAGGGCCAGTGG + Intergenic
1060405564 9:123371346-123371368 CTGACCAGCTGCAGGACCTGGGG + Exonic
1060791257 9:126487073-126487095 CCCAGGAGGTGCAGAGCCAGGGG + Intronic
1060912727 9:127363592-127363614 GTCAGCCAGTGCAGGGCCAGTGG + Intronic
1060926300 9:127457586-127457608 CTCCCCAGGGACAGGGCCTGTGG - Intronic
1061262948 9:129490032-129490054 CTGACCAGGTGGAGGGGTAGGGG - Intergenic
1061940980 9:133883642-133883664 CTCCCCAGGTCCAGTGCCTGAGG - Intronic
1062452032 9:136619860-136619882 CTGACCAGGGCCTGGGCCAGCGG + Intergenic
1188542562 X:31266595-31266617 CTCCCCAGGCGCCGGGCTAGTGG - Intronic
1189361691 X:40358640-40358662 CTCCCCAGGGCCAGGGACAGGGG + Intergenic
1189859413 X:45257799-45257821 CTCAGCAGGTCCAGGTACAGAGG - Intergenic
1192815892 X:74591781-74591803 CTCATCAGGTGCCAGGCGAGAGG - Exonic
1193084123 X:77433462-77433484 CTCACATGGTGAAGGGCAAGAGG + Intergenic
1193255379 X:79342539-79342561 CTCTCCTTGTGCAGGGCTAGTGG - Intergenic
1196419061 X:115504355-115504377 CTCTCCAAGTTCAGGGGCAGTGG + Intergenic
1198259473 X:134952903-134952925 GTCACCAGGTGCAGGACTAGAGG - Intergenic
1198962922 X:142201895-142201917 CTCACCAGTTACAGAGCCACAGG + Intergenic
1199849517 X:151715494-151715516 CTTAGAAGGTGCAGGGCCTGAGG + Intergenic
1200793460 Y:7319406-7319428 GTCACCATGTGCAGGGGCTGTGG - Intergenic