ID: 923373037

View in Genome Browser
Species Human (GRCh38)
Location 1:233331394-233331416
Sequence CAGGATAAAGACCATGTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923373037 Original CRISPR CAGGATAAAGACCATGTATG AGG (reversed) Intronic
901560339 1:10065309-10065331 CAGGATATAGAGCAGTTATGGGG + Intronic
902140496 1:14349784-14349806 CAGGCTAAAGAGCATGGATCTGG + Intergenic
903389581 1:22954387-22954409 AATGATAGTGACCATGTATGAGG + Intronic
907512019 1:54968806-54968828 CAGGATGAATTCCATGTGTGTGG + Intergenic
914993670 1:152520145-152520167 CAGGAGAAAGAACAAGTGTGAGG + Intronic
918212772 1:182366310-182366332 AAGAAGAAAGACCATTTATGAGG + Intergenic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
923373037 1:233331394-233331416 CAGGATAAAGACCATGTATGAGG - Intronic
924667882 1:246092105-246092127 TAGACTAAAGGCCATGTATGTGG + Intronic
1064560339 10:16589399-16589421 CAGGATAAAAAACATGGACGGGG + Intergenic
1064602087 10:17004502-17004524 CCAGATAAAGACCATGTTTGGGG - Intronic
1065854544 10:29819540-29819562 CAGGATAAAGAATACCTATGGGG - Intergenic
1069526690 10:69178607-69178629 TATGATGGAGACCATGTATGTGG - Intergenic
1071813346 10:89207134-89207156 CAGGCAAAAGCCCACGTATGTGG + Exonic
1076049209 10:127319308-127319330 TAGCATAAAGAAAATGTATGTGG + Intronic
1076274656 10:129186904-129186926 CAGTGTGAAGACCATGTAGGGGG + Intergenic
1080846547 11:36032042-36032064 CAGGAAAGAGACCATGTAAGAGG - Intronic
1080990421 11:37528485-37528507 CAGGATAAAGAAAATGAATGGGG + Intergenic
1085124593 11:73991248-73991270 CAGGAAAAAGACCACATCTGTGG - Intergenic
1090241449 11:125184856-125184878 AAGCATAAAGACCGTGTAGGTGG - Intronic
1090859193 11:130638140-130638162 CAGGATAAAGAGGATTTATGAGG + Intergenic
1091933449 12:4415871-4415893 AAGGATAAAGAACAGATATGGGG + Intergenic
1092944101 12:13437086-13437108 CAGGAGAAAAGCCATGGATGTGG - Intergenic
1092952904 12:13524664-13524686 CAGGAGAATGAACAGGTATGGGG + Intergenic
1096200887 12:49681965-49681987 CAGGAGAAAGACCCTGTAAGTGG + Intronic
1098333450 12:69377753-69377775 AAGGATAAAGACCATATGTTAGG - Intronic
1100526788 12:95427069-95427091 CAGAAAAAAGACCAGGTATGAGG - Intergenic
1101294450 12:103406695-103406717 CAGGATAAAGACTATGAAAATGG + Intronic
1101859201 12:108468792-108468814 CAGGATAAAGACTCTACATGGGG + Intergenic
1102547874 12:113669858-113669880 CAGGACAGAGACCAGGGATGGGG - Intergenic
1102901635 12:116643027-116643049 CATGATAAAGAGCATTTAGGAGG - Intergenic
1103206590 12:119134315-119134337 GAAGATAAGGACCATGTGTGAGG - Intronic
1111378998 13:87421105-87421127 CAGTATAACAACTATGTATGTGG - Intergenic
1111878954 13:93931182-93931204 CAGTATAATAACCATCTATGAGG + Intronic
1112576591 13:100641829-100641851 CAGGATCAAAACCATTGATGAGG + Intronic
1112797591 13:103072964-103072986 CAGGCAAGAGACCATGTACGGGG + Intergenic
1116474891 14:45328248-45328270 TAGTATAATGACCATGTTTGGGG + Intergenic
1116758591 14:48981192-48981214 CTGCATAAAGACTATGGATGTGG - Intergenic
1117015814 14:51515616-51515638 CACTATAAAGACCATGTAGCAGG - Intronic
1118923001 14:70167129-70167151 CATGTCAAAGACCATGTATGTGG - Exonic
1120355576 14:83429052-83429074 CAGGACAAAGGCCATGTGAGTGG - Intergenic
1120357661 14:83455052-83455074 CAGGATAATGACTATTTCTGAGG - Intergenic
1123583717 15:21738736-21738758 CAGAATATAAACCATGTTTGAGG - Intergenic
1123620367 15:22181339-22181361 CAGAATATAAACCATGTTTGAGG - Intergenic
1125311368 15:38381970-38381992 CTGGGTGAAGACAATGTATGTGG - Intergenic
1126995485 15:54438759-54438781 CAGGAGAAAGAACAGGTTTGAGG - Intronic
1129177798 15:73852611-73852633 CAGGAAAAATACCGTGAATGAGG - Intergenic
1130672678 15:85926470-85926492 CAGGATAGAGACCATGTGGATGG - Intergenic
1134159702 16:11877216-11877238 CAGCTTGAAGACCTTGTATGAGG + Intronic
1137508255 16:49075696-49075718 CTGCATAAAGGCCATGTATTAGG - Intergenic
1137536343 16:49329709-49329731 CATGGTAAGGACTATGTATGGGG - Intergenic
1140483158 16:75273579-75273601 CAGGATAAAGCCCGGATATGCGG + Intergenic
1143796173 17:9338567-9338589 CATGACAAAGACCATGTGAGTGG - Intronic
1144495742 17:15743595-15743617 CAGGAGGAAGACCAGGTAGGAGG - Intronic
1145104035 17:20100038-20100060 CAGTATAACAACTATGTATGCGG - Intronic
1145134487 17:20389320-20389342 CAGGATAAAGTCACTGTAAGTGG - Intergenic
1147816707 17:43215832-43215854 CAGGAAAAAGACGATGAAGGAGG - Exonic
1148137038 17:45300135-45300157 CAGGGTAAATACAATTTATGGGG + Intronic
1149129590 17:53282063-53282085 CAGGATAAAGTCCATGGAAGTGG + Intergenic
1149625882 17:58080556-58080578 CATGGTAAAAACCATGAATGTGG + Intergenic
1149756947 17:59194871-59194893 AAGCAAAAAGAGCATGTATGTGG - Intronic
1151258763 17:72900409-72900431 CAGGATTATGAGGATGTATGAGG + Intronic
1153598349 18:6752627-6752649 CATGAGAAAGACCATGTCTAAGG + Intronic
1155528904 18:26745640-26745662 AGGAATAAAGACCATGTAGGAGG + Intergenic
1157322581 18:46645942-46645964 CAGGAGAAACACCATGAAAGAGG + Intronic
1158002452 18:52635564-52635586 CAGGATAATGACAATTTATAAGG + Intronic
1158861035 18:61592632-61592654 CAGGAAAAATACCAAGAATGAGG + Intergenic
1163945853 19:20533348-20533370 CAGAATAAAGACATTGAATGTGG - Intergenic
1168254012 19:55156374-55156396 CAGGATAAAGACCAGGCGTGGGG + Intronic
926273459 2:11385670-11385692 TAGGAGAAAGAGCATGTAGGAGG - Intergenic
927262983 2:21113082-21113104 CAGGATAACTACCACGTATAAGG + Intergenic
928400170 2:30972016-30972038 CAGGAGGAAGATCATGTATCTGG - Intronic
931112716 2:59129588-59129610 CCTGATAAAAAGCATGTATGAGG + Intergenic
936961945 2:118085314-118085336 CAGGATGAAGAACAGGTGTGAGG - Intergenic
938738509 2:134208638-134208660 TGGGATAAAGACCATGTTTCTGG - Intronic
941881428 2:170484212-170484234 CAGAATAAATACCATCTATCTGG - Intronic
945616084 2:212068972-212068994 CAGGCAAGAGAGCATGTATGGGG - Intronic
946117609 2:217477240-217477262 GAAGATAAGGACCATGTCTGTGG - Intronic
1172652632 20:36514892-36514914 CAGGAGAAAGGCCATGTCTGAGG + Intronic
1173121257 20:40291654-40291676 CAGGATTAACACCATTTATGTGG + Intergenic
1180952956 22:19728961-19728983 CAGGACAAAGGCCATGTCAGTGG - Intergenic
1182475717 22:30575273-30575295 GAGGAGCAAGACCATGGATGAGG + Intergenic
950123127 3:10495072-10495094 CAGGATAAAGACCAAGGACATGG + Intronic
955729562 3:61970297-61970319 CAGGATAAAGACCATACTTAAGG + Intronic
959903208 3:111683091-111683113 CATGATAGAGAAAATGTATGGGG + Intronic
961953087 3:130771040-130771062 CAGGATAGTGTCCTTGTATGGGG - Intergenic
963407801 3:144889858-144889880 CAGGAAATAGACCATGTAAAGGG - Intergenic
963818597 3:149862417-149862439 CAGGATAATGATCATCTATAAGG - Intronic
964128061 3:153257352-153257374 CTGTATAAAAACTATGTATGGGG + Intergenic
964330441 3:155596069-155596091 CAGAATAATGACCATCTTTGGGG - Intronic
966343916 3:178957077-178957099 CAGGTTAAGGAACATGTATCTGG + Intergenic
966874977 3:184316307-184316329 GAGGATTAAGGCCAGGTATGGGG - Intronic
967979199 3:195055377-195055399 CAGGAGAAAGCCCAGGTAGGGGG - Intergenic
970091448 4:12412639-12412661 CAGGAAAAATACCATATTTGAGG + Intergenic
973576029 4:52290268-52290290 CAAAACAAAGACCATGTCTGGGG + Intergenic
974436424 4:61862708-61862730 TAGGATAGAGACCATGAATCTGG - Intronic
977859586 4:101940716-101940738 GAGGAGAAAGACCATGGAGGTGG + Intronic
979385726 4:120063662-120063684 CAGGATAAAGACCCTGAAAAAGG + Intronic
979500717 4:121436892-121436914 CAGGAGAAATACGGTGTATGTGG + Intergenic
982515059 4:156335499-156335521 TAGGGTAAAGTCCATGTCTGTGG - Intergenic
983682590 4:170370976-170370998 CAGGATAAAGACCAAATTTTAGG + Intergenic
984327666 4:178274388-178274410 CAGGTTAAGAACCCTGTATGGGG - Intergenic
984684427 4:182650196-182650218 CAGCACAAGGACCATGTCTGTGG + Intronic
985314077 4:188635936-188635958 CTTGATAAAGACCATGTATGGGG - Intergenic
987533282 5:19149459-19149481 CTGGATAAAGAAAATGAATGTGG + Intergenic
988157618 5:27475671-27475693 CAGGTTAAGAACCCTGTATGTGG - Intergenic
989554249 5:42773721-42773743 CCTGATAAAGAGCTTGTATGGGG - Intronic
990252696 5:53932653-53932675 CAGGATAAAGCCAATGTTTGTGG + Intronic
990622219 5:57571834-57571856 CATGATAAATAGCATGTATTTGG + Intergenic
990814243 5:59765618-59765640 CAGGAGAAAGACCATGAAAGAGG - Intronic
990927202 5:61040068-61040090 CACTATATTGACCATGTATGAGG - Intronic
990998559 5:61758392-61758414 AATTATAAAGACCATATATGTGG - Intergenic
992519556 5:77536593-77536615 CAGGATCAACATCATATATGTGG - Intronic
994952599 5:106483554-106483576 CAGGATAATGCCCAGGTTTGTGG + Intergenic
996316687 5:122168336-122168358 CAGTAAAAAAACCATGAATGTGG - Intronic
996684616 5:126266669-126266691 CTGGATAAAGACAATGTAGATGG - Intergenic
996890896 5:128418777-128418799 CAGGATAGAGACCATATGTTAGG - Intronic
1000115448 5:158149337-158149359 CAGCATAAAGACCAGCTAGGAGG - Intergenic
1001379274 5:171292771-171292793 AAGGAGAAAGACCAGGGATGAGG - Intronic
1003567793 6:7235286-7235308 CAGGAGAAAGATCAGGTCTGTGG - Intronic
1004254026 6:14046300-14046322 CAGCATAAAGAGCATTTATTTGG - Intergenic
1004260275 6:14101799-14101821 TAGGATGAGGTCCATGTATGAGG + Intergenic
1004944844 6:20600534-20600556 CAGGATAAATACCACTTTTGAGG + Intronic
1005423823 6:25680116-25680138 TATAATAAAGACCATTTATGAGG - Intronic
1005940161 6:30554925-30554947 CAGGAAAAAGTCCAAGTGTGAGG + Intronic
1006954650 6:37857328-37857350 CATGATAAATACCTTGTATTGGG + Intronic
1009272533 6:61632052-61632074 AAGGATAAAGGGCATGTAAGTGG - Intergenic
1011712201 6:90066201-90066223 GAGGAGAAAGAGCATCTATGTGG + Intronic
1012703904 6:102497036-102497058 AAGGATAAAGACTACATATGTGG - Intergenic
1014322472 6:119947347-119947369 CAGGAACAAGAACATGCATGGGG + Intergenic
1016385542 6:143527407-143527429 CAGGGAAAATACCATGCATGCGG - Intergenic
1019556031 7:1631883-1631905 CAGCTCAAAGACCATGTCTGTGG - Intergenic
1026376929 7:69761211-69761233 CAGGTTAAAGACCAGATCTGAGG - Intronic
1026594911 7:71726405-71726427 CAGGATAAAGTCCTGGTGTGTGG + Intergenic
1027600758 7:80237757-80237779 CAGGAGAAAGAGCATGAAGGGGG + Intergenic
1031594807 7:123637723-123637745 AATGATTAAGACCATGGATGTGG - Exonic
1035350234 7:158240397-158240419 CAGCAGAAAGACCAGGTGTGTGG + Intronic
1037699793 8:21263859-21263881 CAGGATGAAGACACTGTCTGTGG - Intergenic
1038033451 8:23664740-23664762 CAGGAAAACGACAATGTATATGG - Intergenic
1038391448 8:27205492-27205514 CAGGATAAAGCTAATGCATGTGG + Intergenic
1038965382 8:32566051-32566073 CAGGATCAAGACAATGTGTCTGG + Intronic
1039444926 8:37623367-37623389 GAGGAGAATGATCATGTATGGGG - Intergenic
1040922094 8:52632447-52632469 CAGGATATAGACCATTTGTCTGG - Intronic
1047125670 8:121957280-121957302 GAGGAAATATACCATGTATGTGG - Intergenic
1053562630 9:39211573-39211595 CAGGATGGAGACCATGAATAGGG - Intronic
1053828437 9:42049557-42049579 CAGGATGGAGACCATGAATAGGG - Intronic
1054134520 9:61407466-61407488 CAGGATGGAGACCATGAATAGGG + Intergenic
1054602124 9:67137897-67137919 CAGGATGGAGACCATGAATAGGG + Intergenic
1058902356 9:109453010-109453032 CAGCATAAAGAGCTGGTATGGGG + Intronic
1059380255 9:113917970-113917992 CAGAAAAAAGACCATTAATGGGG - Intronic
1059437235 9:114284187-114284209 GAGGATAAAGAGCATGCACGAGG + Intronic
1188334400 X:28912186-28912208 CAAGAAAAAGAGCATGTTTGGGG + Intronic
1189332815 X:40153717-40153739 CAAAATGAAGACCATGTGTGAGG + Intronic
1189738582 X:44095925-44095947 GAGAGTAAAGGCCATGTATGTGG + Intergenic
1194538219 X:95134516-95134538 CAGGATAATAACCTTTTATGTGG - Intergenic
1194748886 X:97661873-97661895 CAGCAAGAAGATCATGTATGTGG + Intergenic
1195844536 X:109211557-109211579 TATGATAAAGGCCATATATGAGG + Intergenic
1196696303 X:118616489-118616511 CAGCATAGAGGCCATGGATGGGG + Intronic
1199101355 X:143804267-143804289 CAGGAAAAATAACATGTATAAGG - Intergenic