ID: 923373111

View in Genome Browser
Species Human (GRCh38)
Location 1:233332348-233332370
Sequence CAGGGAAGGCACTCCGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 249}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923373111 Original CRISPR CAGGGAAGGCACTCCGAGGA AGG Intronic
900387939 1:2419144-2419166 CAGGGCAGGCTCTCCTGGGACGG - Intergenic
900906741 1:5564623-5564645 CAGGGAGGGAACTCCCGGGAAGG + Intergenic
901005692 1:6170605-6170627 CAGGGAGGGCACCCTGTGGAGGG + Intronic
901177770 1:7317142-7317164 CAGGGAAGGAAGGCCTAGGATGG + Intronic
901534642 1:9874261-9874283 CAGGGAAGGCTTCCCTAGGAAGG - Intronic
901612510 1:10510024-10510046 CAGGGAAGGCAGCCCAGGGATGG + Intronic
902277138 1:15347954-15347976 CAGAGAAGCCACCCAGAGGAAGG + Intronic
902919120 1:19656178-19656200 CAGGGTAGGCGCTCTGTGGAAGG + Intronic
903278754 1:22238242-22238264 CAGTGAAGGGTCTCAGAGGAGGG - Intergenic
903383456 1:22912160-22912182 TAGGGAAGGCACTGCAGGGATGG - Intronic
904032248 1:27540513-27540535 CAAGGAGGGCATTCCCAGGAAGG + Intronic
904418414 1:30376379-30376401 CAGAGAAGGTTCTCTGAGGAGGG - Intergenic
905013446 1:34761975-34761997 CAGGGAGGGCACCCTGAGGATGG + Exonic
907759871 1:57347119-57347141 CAGGGAAGGCACTTCTGGGGAGG + Intronic
908248575 1:62247266-62247288 CCGGCAAGGCACTCTGAGGAGGG + Intronic
909949079 1:81697834-81697856 CAGGAAATGCACTCTGAGGAGGG - Intronic
911631880 1:100192730-100192752 CAGGAAAGGAAGTCTGAGGATGG - Exonic
912373567 1:109192079-109192101 CAGGGCAGGGACTACAAGGAGGG - Intronic
913477060 1:119248066-119248088 GAGGGAAGGCACCCAGAGAATGG - Intergenic
915064875 1:153216632-153216654 CAGGAAAGGCTCTCAGAGGGTGG + Intergenic
915107296 1:153542412-153542434 CAGGGAGGGCGCTCCCAGGGAGG + Intergenic
918517181 1:185375954-185375976 CAGGGAAAACAATCCGAGAAAGG - Intergenic
919758995 1:201085221-201085243 CAGGGGAGGCGCTATGAGGATGG + Intronic
920061957 1:203233070-203233092 CAGGGAGGGCAGCCCCAGGAGGG - Intronic
921874392 1:220177318-220177340 CCTGGAAGGCCCTCTGAGGAAGG + Intronic
922612297 1:226939741-226939763 CACAAAAAGCACTCCGAGGAGGG - Intronic
923373111 1:233332348-233332370 CAGGGAAGGCACTCCGAGGAAGG + Intronic
1065786309 10:29218955-29218977 CAGGGAAGGCAGTACCAGAATGG + Intergenic
1066470655 10:35694519-35694541 CAGGGAAGTGTCTGCGAGGAAGG - Intergenic
1067792139 10:49296413-49296435 CAGTGAAGCCACTGCAAGGATGG + Intergenic
1068943962 10:62709735-62709757 CAGGAAAGGCACTCCAGAGAAGG + Intergenic
1069150574 10:64954228-64954250 CCTGGAAGGCACTCAGGGGAGGG - Intergenic
1070450579 10:76553413-76553435 ATGGGGAGGCACTCCGAGGCTGG - Intronic
1070467519 10:76738603-76738625 CAGGGAAAACACTCCAAGCATGG - Intergenic
1070714350 10:78708315-78708337 CAGGGAAGGGACCCCCAGAATGG - Intergenic
1071843138 10:89493689-89493711 AAGGGGAGCCAATCCGAGGAAGG - Intronic
1072241321 10:93497761-93497783 GAGGGAAGGCATGCTGAGGAAGG + Intronic
1072808613 10:98443094-98443116 CAGGGTAGGCAGTCCCAGGAGGG - Intronic
1073319022 10:102602763-102602785 CCGGGAAGGCAGTGGGAGGAGGG - Intronic
1075849996 10:125579078-125579100 CAGGGAAGCCTCACCAAGGAAGG - Intronic
1076649300 10:131976732-131976754 CAGGGCAGCCCCTCCTAGGAGGG - Intronic
1077467044 11:2738333-2738355 CAAGGAAGGCTCTCTGAGGGAGG + Intronic
1078416795 11:11172618-11172640 CATAGAAGGCACTCGAAGGATGG + Intergenic
1083968700 11:66059083-66059105 CAGGGAAGGGGCTCAGAGGTGGG + Intronic
1084445797 11:69202814-69202836 CAGGGAAGGCGCCCCGACGGAGG - Intergenic
1084501870 11:69539908-69539930 CAGGGAAGTGCCTCCGTGGAGGG - Intergenic
1085054899 11:73397843-73397865 CAGAGAAGGCACTGCTAGGGAGG + Intergenic
1088249140 11:107847757-107847779 CAGTGAAAGCAATCCCAGGAGGG + Intronic
1088318382 11:108530455-108530477 CAGGGAAGGCAATAGGAAGATGG + Intronic
1088606764 11:111540649-111540671 CTGGGACGTCACTGCGAGGAGGG - Exonic
1089696753 11:120220632-120220654 CTGGGAGGGCAGTCAGAGGAGGG + Intronic
1090134694 11:124185250-124185272 CATGGAAGCCAGTCCTAGGAAGG - Exonic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1091020150 11:132092314-132092336 GAGGCCAGGCACTCTGAGGAAGG - Intronic
1091233176 11:134001580-134001602 CAGGGAAGGCAGGCATAGGATGG - Intergenic
1092192790 12:6533092-6533114 CAGGAAAGGCAATCCCAGAAAGG + Intergenic
1092767913 12:11869825-11869847 CAGTCCAGGCTCTCCGAGGACGG + Exonic
1092950433 12:13498555-13498577 CAGGAAAGACACTCTGAGGGAGG - Intergenic
1092995315 12:13944202-13944224 CATGGAAGGCACTTATAGGAAGG - Intronic
1093421856 12:18982915-18982937 CAGGGAAGGCACTCACAAGAGGG + Intergenic
1095890567 12:47231834-47231856 CAGGGAAGGCACATCGAGCTGGG + Intronic
1099337567 12:81382901-81382923 AAGGGAAGACACTCCAAGGTCGG + Intronic
1104768748 12:131346788-131346810 CAGGGCAGGCATTTAGAGGAAGG - Intergenic
1104950062 12:132435912-132435934 CAGGAAGGGGACCCCGAGGATGG - Intergenic
1106287255 13:28328713-28328735 CATGGAAGCCCCTCTGAGGACGG - Intronic
1107464330 13:40635776-40635798 CAGGGCAGGCCCTCAGTGGAGGG - Intronic
1107963915 13:45582246-45582268 CAGGGATGGCACTCCAATGCAGG + Intronic
1108275140 13:48800718-48800740 CAGGGAGGGAACTGGGAGGAAGG + Intergenic
1114398341 14:22387167-22387189 CAGAAAAGGCACCCAGAGGAAGG - Intergenic
1118164372 14:63321580-63321602 CAGGGAAGGCAGTCCCACGTGGG + Intergenic
1118715159 14:68554528-68554550 CAGGGAAGGCACCACTGGGAAGG - Intronic
1119693647 14:76695785-76695807 CAGGGAAGAAACCCTGAGGAGGG - Intergenic
1121120976 14:91375765-91375787 CAGGGAAGGTGCTCCGGGCACGG - Intronic
1121121253 14:91377129-91377151 CAGGGCAGGCAGTCTGAGGTGGG - Intronic
1122370025 14:101224554-101224576 CAGGGAAGGGACACTGAGGCAGG + Intergenic
1122956681 14:105074582-105074604 CAGGGGAGGGTCTCTGAGGAGGG - Intergenic
1127295988 15:57608868-57608890 CAGTGAAGGGACTCCAAGCATGG - Intronic
1127849413 15:62900010-62900032 CAGGGAGAGCACTCAGAAGACGG - Intergenic
1127857732 15:62966563-62966585 CAGGGAAGGTGCTCAGAGGCAGG - Intergenic
1128680326 15:69646897-69646919 CAAGAAATGCACTCAGAGGATGG - Intergenic
1129740889 15:77989073-77989095 CAGGGAAGGCCTTCTGAGGAGGG + Intronic
1129844832 15:78763478-78763500 CAGGGAAGGCCTTCCAAGGAGGG - Intronic
1130256989 15:82330375-82330397 CAGGGAAGGCCTTCCGAGGAGGG + Intergenic
1130597959 15:85259613-85259635 CAGGGAAGGCCTTCCGAGGAGGG - Intergenic
1130651878 15:85766668-85766690 CACGGAAGGCACTCTGTGGGAGG - Intronic
1130937896 15:88485573-88485595 CAGCCAAGGCCCTGCGAGGATGG - Intergenic
1131463637 15:92637489-92637511 CAGGGAAGGCACTGCACGAAGGG + Intronic
1133441011 16:5820938-5820960 CAGGGAGGGCACTGTGATGAGGG - Intergenic
1135663704 16:24318005-24318027 CAGGGAAGCCTCTCAGAGAAGGG - Intronic
1136290503 16:29268610-29268632 CAGGAAAGGCACTCAGAGCCCGG + Intergenic
1136505049 16:30698007-30698029 CGGTAAAGGCGCTCCGAGGAAGG + Intergenic
1136923039 16:34346903-34346925 CAGGGAAGGGGCTGTGAGGATGG - Intergenic
1136981534 16:35064903-35064925 CAGGGAAGGGGCTGTGAGGATGG + Intergenic
1137468045 16:48729134-48729156 CAGGGAAGACTATCCGGGGAAGG - Intergenic
1137819624 16:51431515-51431537 CAGGGAAGGAATTGAGAGGAAGG - Intergenic
1139027879 16:62841524-62841546 GAGGGAAGGCACAGTGAGGATGG + Intergenic
1139169688 16:64615565-64615587 CAGGGAAGGCCCGCCGAGTGAGG + Intergenic
1139477410 16:67209647-67209669 CAGGGAAGGAGCACTGAGGAAGG - Intronic
1139700816 16:68707068-68707090 CAGGGAAGGCACTGCTGGGAAGG + Intronic
1142258240 16:89026204-89026226 CAGGGAAGGTACTCAGAGCCTGG - Intergenic
1143519693 17:7438248-7438270 CCGGGCCGGCTCTCCGAGGAGGG + Intergenic
1145230720 17:21171534-21171556 CAGAGCAGACACTCAGAGGACGG - Intronic
1145899190 17:28478939-28478961 CAGGGAAGGCCTCCTGAGGAGGG + Intronic
1146470212 17:33118279-33118301 CACTGAAGGCACTCCAGGGAGGG - Intronic
1146825492 17:36019029-36019051 CAGTGGAGGCACTGAGAGGATGG - Intergenic
1147905178 17:43818010-43818032 CAGGGATGGCACTCCAGGGAGGG - Intronic
1148323275 17:46770084-46770106 CAGGGCAGGCGCTCCCAGGCCGG - Intronic
1149010427 17:51850975-51850997 CAGGGCAGGCACTGGGAAGAAGG - Intronic
1150130319 17:62665684-62665706 CAGGAAAGGCCCCCCCAGGACGG - Intronic
1151226398 17:72651330-72651352 CAGGGAAGGGGCTCCTGGGAGGG - Intronic
1151227086 17:72655591-72655613 CAGGGAAGGGGCTCCTGGGAGGG - Intronic
1151608176 17:75153677-75153699 GAGGGGAGGCACTTCGAAGAGGG + Intronic
1152365593 17:79854568-79854590 CAGGGAAGGCTCACTGAGGAAGG + Intergenic
1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG + Intronic
1153768216 18:8394876-8394898 CATGGAAGGCACTGCCAGGAAGG - Intronic
1155073729 18:22337771-22337793 CAGGGAAGGAACTCTTAGGAAGG - Intergenic
1155135322 18:22985991-22986013 CAGGGAAGGGACTGGGGGGAGGG - Intronic
1156337621 18:36185265-36185287 CACGAATGGCACTCTGAGGAGGG - Intergenic
1157446669 18:47751457-47751479 CAGGGAAGGCTTTCTGGGGAGGG - Intergenic
1158043293 18:53124018-53124040 CAGGGAAGGCACTTCAGGGATGG - Intronic
1160627719 18:80224006-80224028 GAGGGCAGGCACTCCGAACAGGG + Intronic
1160712455 19:558822-558844 CAGGGAAGGCTTTCCAGGGAAGG + Intergenic
1162805690 19:13137012-13137034 CACAGCAGGCACCCCGAGGATGG + Intronic
1163648525 19:18503787-18503809 CAGGGAAGGCTCCCTGAGGAGGG - Intronic
1163829192 19:19539787-19539809 CAGAGACGGGACTCCGAGGCAGG - Intronic
1164601582 19:29566709-29566731 CAGGGAAGGGACTGCTATGATGG + Intergenic
1165639665 19:37373679-37373701 CAGGGAAGTCCCTCTGATGAAGG + Intronic
925677695 2:6383066-6383088 CAGGAAAGGCAGTCAGAGAAGGG - Intergenic
926085399 2:10016643-10016665 CAGAGCAGGCACTCCAAGCATGG + Intergenic
926754408 2:16223847-16223869 CAGGGCAGTCCCTCCTAGGAGGG + Intergenic
926843065 2:17104712-17104734 CAGTGAAGGCCTTCAGAGGAGGG + Intergenic
926901419 2:17754666-17754688 CAGGGAGGGCTCTCCCGGGATGG - Intronic
927864078 2:26577622-26577644 GAGGGCAGGCACTCACAGGACGG - Exonic
927886484 2:26721641-26721663 CAGGGAGGGCCCTCAGAGGAAGG - Intronic
931464403 2:62474007-62474029 CAGGGAGGCCACACTGAGGATGG + Intergenic
931657793 2:64525158-64525180 CAGAAAAGGTACTCTGAGGAAGG - Intronic
931786146 2:65621085-65621107 CAGAGAAGGAACTCTGAGCAGGG - Intergenic
935920610 2:108009435-108009457 CAAGGAAGGAACTTAGAGGACGG - Intronic
937281397 2:120719725-120719747 CAGGGAAGGCACACCGTGGGGGG + Intergenic
937321593 2:120964183-120964205 CAGGGAAGGCATCCCAAGGGAGG + Intronic
938065109 2:128277618-128277640 CAGGGCAGCTTCTCCGAGGAGGG + Intronic
938763536 2:134445423-134445445 GAGGGAAGGCACTCAAGGGAAGG + Intronic
939914471 2:148021651-148021673 CAGGGAAGGCACTCAAAAGTGGG + Exonic
942959523 2:181813337-181813359 CAGGGAAGGCTCTCTGAATATGG + Intergenic
946336287 2:219038777-219038799 CAGGGAAGGCACTCCAAAGAGGG + Intronic
946973382 2:225120515-225120537 CAGGGTAGGCAGGCAGAGGAAGG - Intergenic
947129521 2:226906784-226906806 CAGCGAAGGAAGTCCTAGGAGGG - Exonic
947874195 2:233457718-233457740 CAGGGCAGGCACATGGAGGATGG + Intronic
948124907 2:235557385-235557407 AAGGGAAATCACTCCGAAGACGG + Intronic
1168835498 20:874574-874596 CAGGGAAGGCAATCCAGGAAGGG - Intronic
1169116938 20:3072065-3072087 CAGGGGAGGCACTGCGGGGACGG - Exonic
1169118733 20:3083168-3083190 CAGGGGAGGCACTGCGGGGACGG + Exonic
1172020676 20:31911575-31911597 CAGGGAAGGCGCAGTGAGGAAGG + Intronic
1173287599 20:41687419-41687441 TAGAGAAGTAACTCCGAGGAAGG + Intergenic
1173827851 20:46058706-46058728 CAGGGAGGAAACTCCGGGGAGGG - Intronic
1174362933 20:50039927-50039949 CAAGGAGGGCTCTCTGAGGAGGG + Intergenic
1175200368 20:57272844-57272866 CTGGGAAGGGACTCTGGGGAAGG - Intergenic
1175278343 20:57787139-57787161 CAGGAAAGGCAGTCTGAGGTGGG - Intergenic
1175469384 20:59216325-59216347 AAGGGAAGGCTCTTCCAGGAGGG - Intronic
1175809777 20:61851787-61851809 CAGGGAGGCCTCTCGGAGGAGGG - Intronic
1176293962 21:5060752-5060774 CAGGGAAGCCACTCCCAGGCAGG + Intergenic
1176567869 21:8396382-8396404 CAGGGCGGGCCCTCGGAGGAGGG - Intergenic
1179440522 21:41390404-41390426 CGGGGCAGGCATTCCCAGGACGG + Intronic
1179473880 21:41631143-41631165 CAGCGAACGCATGCCGAGGATGG - Intergenic
1179863297 21:44202896-44202918 CAGGGAAGCCACTCCCAGGCAGG - Intergenic
1180076774 21:45467147-45467169 CTGGGAAGTCACTCTGAGCAGGG + Intronic
1180800213 22:18628237-18628259 CAGGGAAGGCGCTCCTGGGAGGG + Intergenic
1180851446 22:19023801-19023823 CAGGGAAGGCGCTCCTGGGAGGG + Intergenic
1181221503 22:21367029-21367051 CAGGGAAGGCGCTCCTGGGAGGG - Intergenic
1181483707 22:23217818-23217840 GAGGGAGGGCACTCCCATGAAGG + Intronic
1182760934 22:32721859-32721881 CAGGGAAGGCTTTCTGAGAAGGG + Intronic
1184781139 22:46650278-46650300 CAGGGAAGTTACTGGGAGGAAGG - Intronic
949789905 3:7781614-7781636 CAGGAAAAGCACTGTGAGGAGGG + Intergenic
950390198 3:12690529-12690551 CAGGCAAGGGCCTCCGTGGATGG + Intergenic
950463747 3:13141004-13141026 CAGGGAGGGCACCACGACGAAGG + Intergenic
950749872 3:15120170-15120192 CAGGGCTGGAACTCCGAGAAAGG - Intergenic
954214971 3:49119603-49119625 CAGGGCTGGCACTCCGAGCAGGG + Intronic
954690518 3:52393178-52393200 CAGTGAAGGGGCTCGGAGGAGGG - Intronic
954876206 3:53804661-53804683 GAGGGAAGGCACTCAGGAGAGGG + Intronic
954894810 3:53966216-53966238 CAGGGAAGGGACTCAGGGAAGGG - Intergenic
957322798 3:78653706-78653728 CAGTCAAGGCTCTCCTAGGAGGG + Intronic
961444174 3:126971320-126971342 CTGGGAATGCACACAGAGGAAGG + Intergenic
962224029 3:133589700-133589722 CAGGAATTGGACTCCGAGGAGGG + Exonic
962895443 3:139709845-139709867 CAGGAAAGGGACTCAGTGGATGG - Intergenic
965319372 3:167233051-167233073 CAGGGAAGGGACTCAAAGGGAGG - Intergenic
966892319 3:184416532-184416554 CAGGGACGGCACCCAGAAGAGGG - Intronic
967259036 3:187623778-187623800 CTGGGAACGCACTCCCTGGAGGG - Intergenic
969016539 4:4107429-4107451 CAGGGATGGCCCTCCCAGGAGGG - Intergenic
969322139 4:6418712-6418734 CATGGAAGTCACTGCTAGGATGG + Intronic
971257447 4:25028439-25028461 CAGAGACGGCCCTCCAAGGATGG + Intronic
972169826 4:36332458-36332480 CTGGGAAGGCACTATGATGATGG + Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
979333953 4:119446076-119446098 AAGGGAAGGCACTGCCAGGCTGG + Intergenic
982303158 4:153900691-153900713 AAAGGAAGGCTCTCCCAGGAGGG + Intergenic
985768878 5:1796617-1796639 CAGGGGAGGCAACCCGAGGAGGG - Intergenic
989559917 5:42838300-42838322 CAGGGAAGGCATTCCAGAGAAGG + Intronic
990700340 5:58468026-58468048 AAGGGATGGCATTCTGAGGATGG + Intergenic
990794689 5:59526157-59526179 CAGGGCAAGCAGTCCTAGGAAGG + Intronic
991970044 5:72131774-72131796 CAGAGAAGACACTGGGAGGAAGG - Intronic
994355407 5:98788701-98788723 CAGGGAAGACACTTGAAGGAAGG + Intronic
995133125 5:108651228-108651250 CATGGAAGGCACTTAGTGGATGG - Intergenic
995751390 5:115456680-115456702 CAGGGCAGGCTCTAAGAGGAAGG + Intergenic
996154384 5:120080002-120080024 CAGGAAAGGCACAATGAGGAGGG + Intergenic
996470190 5:123851961-123851983 CTGGGAAGGCCCTCTGAAGAAGG - Intergenic
996695766 5:126393131-126393153 CAGGGAAGGGAAACAGAGGAAGG - Intronic
997767036 5:136514928-136514950 CTAGGAATGCTCTCCGAGGAGGG - Intergenic
998016099 5:138733638-138733660 CAGGAAAGGCATTTTGAGGAAGG + Intronic
998441688 5:142167944-142167966 CAGGGAAGGCACTCTTATGGTGG + Intergenic
999227328 5:150036885-150036907 CAGAGAAGGCACTGCGTGGACGG - Exonic
1001137031 5:169111164-169111186 CAGGGAAGGCTCCCTGAGAAAGG - Intronic
1001682158 5:173566207-173566229 CAGGCAAGACACTCAGAGAATGG - Intergenic
1002288576 5:178182390-178182412 TAGGGAAGCCACACTGAGGAAGG + Intergenic
1002448648 5:179306814-179306836 CAGGGAAAGGACACCCAGGAAGG + Intronic
1003396812 6:5760474-5760496 CAGTGAAGCCACTCAGAGCAGGG + Intronic
1004336267 6:14767318-14767340 AATGGAAGGCACTGAGAGGAAGG + Intergenic
1004996758 6:21200760-21200782 AAGGAAAGGCACTCCTGGGAGGG - Intronic
1005298593 6:24449725-24449747 CAGGGAGGGGACTCTGAGGGAGG - Intronic
1006026728 6:31151609-31151631 CAGTGAAGCCACCCTGAGGAGGG - Intronic
1006166015 6:32065407-32065429 CAGGGAAGGCCCACAGAAGAAGG - Intronic
1010588387 6:77682836-77682858 CAGAAAAGGCATTCAGAGGAAGG + Intergenic
1012542063 6:100372664-100372686 CAGGAAAGCCACACGGAGGATGG + Intergenic
1012944161 6:105448314-105448336 CTGGGGAGGCTCTCTGAGGAGGG - Intergenic
1015785980 6:136922057-136922079 CAGGGAAGACGCTCTGCGGAGGG - Intergenic
1015942308 6:138464401-138464423 CAGGGCAGGAAGGCCGAGGATGG + Intronic
1017066119 6:150530872-150530894 CAGGAAAGGCTTTCCGAAGAAGG + Intergenic
1017592466 6:155992427-155992449 CAGGGAAGGCGCTCAAAGAAAGG + Intergenic
1019062222 6:169264791-169264813 CAGGGCAGGGGCTCTGAGGATGG + Intergenic
1019176781 6:170163466-170163488 CAGGGAAAGCACTGTGGGGACGG + Intergenic
1019278849 7:190390-190412 CAGCGCAGGCTCTCAGAGGAGGG - Intergenic
1019337437 7:492026-492048 CAGGGAAGCCACTCACAGGTGGG + Intergenic
1019614953 7:1954987-1955009 CAGTGACGGCCCTCCCAGGAAGG + Intronic
1019788878 7:2997424-2997446 CAGGGGAGGCAGGGCGAGGATGG + Intronic
1020256713 7:6506492-6506514 CAGGGCAGGGACACTGAGGATGG + Intronic
1020812496 7:12864267-12864289 CAGGGGAGGCAGGCCAAGGAGGG - Intergenic
1021550751 7:21868743-21868765 CAGGAAAGTCACTCAGAAGATGG + Intronic
1022287262 7:28965445-28965467 CAGGAAAGGAAATCAGAGGAAGG + Intergenic
1022333930 7:29405443-29405465 CAGGGGAGGCAATGCCAGGAAGG - Intronic
1022964584 7:35460614-35460636 CTGGGTGGGCACTCCTAGGAAGG + Intergenic
1023154646 7:37236441-37236463 CAGTCAAGGTACTCAGAGGAAGG + Intronic
1025187200 7:56870573-56870595 AAGGGAAGGCACTGCCAGGCCGG + Intergenic
1025684722 7:63706344-63706366 AAGGGAAGGCACTGCCAGGCCGG - Intergenic
1026300001 7:69089524-69089546 CAGGGAAGGTGCTCAGAGGAAGG + Intergenic
1026661731 7:72308733-72308755 CCGGGAAGGAACTAAGAGGAGGG - Intronic
1028443563 7:90892671-90892693 CAGGGGAAGGAATCCGAGGAGGG - Intronic
1029551616 7:101239740-101239762 CAGGGAAAGGACAGCGAGGATGG + Exonic
1029610631 7:101624819-101624841 CAGGGAAGGCATTCCAAGCAGGG - Intronic
1032356107 7:131212254-131212276 CAGGGAAGGAATTTAGAGGAAGG - Intronic
1032622693 7:133553461-133553483 CAGGGAATGAAATCGGAGGAAGG - Intronic
1032917138 7:136504297-136504319 CAAGAAAGGTACTCCGAGGCCGG - Intergenic
1033333744 7:140435402-140435424 CAGGCAAGCAACTCCGTGGAAGG - Intergenic
1033653624 7:143359829-143359851 CCTGGAAGGCCCTCTGAGGAAGG - Intronic
1035829885 8:2684159-2684181 AAGGGAAGGCATTCAGAGAAGGG - Intergenic
1036307288 8:7611519-7611541 CAGGGATGGCAGTCCCAGGATGG + Intergenic
1036358132 8:8059506-8059528 CAGGGATGGCAGTCCCAGGATGG + Intergenic
1036892819 8:12607440-12607462 CAGGGATGGCAGTCCCAGGATGG - Intergenic
1037319853 8:17632026-17632048 CAGGGATGGCACGCGGAGGATGG - Intronic
1037389406 8:18377821-18377843 CAAGGACGGCACTAAGAGGATGG + Intergenic
1037504274 8:19515107-19515129 CAGGAAAGGCACTCTGAGGCTGG - Intronic
1039032796 8:33328175-33328197 CAGGACAGGCTGTCCGAGGAGGG + Intergenic
1040541619 8:48362158-48362180 CAGGGAAACCACTCAGAGGGGGG + Intergenic
1044582697 8:93837987-93838009 CCGGGAAGGCTTCCCGAGGAGGG - Intergenic
1044602500 8:94019777-94019799 CAGAGAAGCCAGTCCCAGGAGGG + Intergenic
1046613141 8:116447168-116447190 CAGAGAAGGCAGTCAAAGGAAGG - Intergenic
1049207063 8:141368519-141368541 CAGGGAAGGCTCCCCAAGGGAGG + Intergenic
1049591801 8:143466119-143466141 CAGGTGAGGGACTCAGAGGAGGG - Intronic
1050388087 9:5111449-5111471 CTGGGCAGGTACGCCGAGGATGG - Intronic
1052615943 9:30842243-30842265 CAAGGAAGACACTCTGAGAAAGG - Intergenic
1053418667 9:37963065-37963087 CGGGGAAGGCACTCCTGGGTTGG - Intronic
1057082035 9:92180442-92180464 CTGGGTGGGCACTCCGAGTAGGG - Intergenic
1057795147 9:98150508-98150530 CTGGGAAGGCATTCCTGGGAAGG - Intronic
1059067092 9:111096816-111096838 AAGGGAAGGCACTCCGTTGTTGG - Intergenic
1060146713 9:121259399-121259421 CAGGGAAGGCTTTGCAAGGAGGG + Intronic
1060589621 9:124808616-124808638 CAGGGAAGACCTTCCCAGGAAGG + Intronic
1060675835 9:125513767-125513789 CAGGGAGGGCACACCGGGGCAGG + Intronic
1060909574 9:127338865-127338887 CAGAGAAGGCACTCCTGGCATGG + Intronic
1061090083 9:128421320-128421342 CAGGGAAGGCCCCAAGAGGAAGG - Intronic
1061527722 9:131181109-131181131 CAGGGAAGGCCTTCTCAGGAAGG + Intronic
1061674498 9:132208164-132208186 CAGGGAAGGCCCTCCAGGGAGGG + Intronic
1062096263 9:134705525-134705547 CAGGGAAGGAAGTCCAAGGCTGG - Intronic
1062167687 9:135116152-135116174 GAGGGAATGAACTCAGAGGAGGG + Intronic
1062339973 9:136089559-136089581 GAGGGAGGGCACCCCGAGGGTGG - Intronic
1185818580 X:3180271-3180293 CAAGGAAGGCTCTTGGAGGATGG + Intergenic
1188878973 X:35468659-35468681 CAGGGAAGGCAGTGTGGGGAGGG + Intergenic
1191807487 X:65150467-65150489 CAGGGAAGGAACTTAGAGGATGG - Intergenic
1195341744 X:103913445-103913467 CAGGGAAGCCACCCACAGGAAGG - Intergenic
1196860061 X:120018261-120018283 CAGGGACAGTACTCAGAGGATGG - Intergenic
1197800219 X:130340100-130340122 CAGGGAAGGGACTCAGCTGAGGG - Exonic
1200150460 X:153948934-153948956 CAGGAAAGCCACTCTGGGGAGGG + Exonic
1200173678 X:154097387-154097409 CAGGGAGGCCGCGCCGAGGACGG + Intronic