ID: 923375313

View in Genome Browser
Species Human (GRCh38)
Location 1:233356104-233356126
Sequence TTCTGTGCCCATTTCATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 390}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923375306_923375313 26 Left 923375306 1:233356055-233356077 CCTTGGCACACGTTCTTTCCTCT 0: 1
1: 0
2: 5
3: 48
4: 379
Right 923375313 1:233356104-233356126 TTCTGTGCCCATTTCATGAATGG 0: 1
1: 0
2: 1
3: 30
4: 390
923375308_923375313 8 Left 923375308 1:233356073-233356095 CCTCTGCTGAGGATCCTGTTTCC 0: 1
1: 1
2: 3
3: 24
4: 226
Right 923375313 1:233356104-233356126 TTCTGTGCCCATTTCATGAATGG 0: 1
1: 0
2: 1
3: 30
4: 390
923375309_923375313 -6 Left 923375309 1:233356087-233356109 CCTGTTTCCTCCCTAGCTTCTGT 0: 1
1: 0
2: 3
3: 41
4: 382
Right 923375313 1:233356104-233356126 TTCTGTGCCCATTTCATGAATGG 0: 1
1: 0
2: 1
3: 30
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923375313 Original CRISPR TTCTGTGCCCATTTCATGAA TGG Intronic
900651096 1:3730444-3730466 TTCTGTGGCCATTTGCTGATGGG - Intronic
901053174 1:6435909-6435931 TGTTGTCCCCATTTCATGGATGG + Intronic
901053648 1:6438401-6438423 TGTTGTCCCCATTTCATGGATGG + Intronic
901335766 1:8447746-8447768 TTCTGTGTCCATTGCATACACGG - Intronic
902988463 1:20170202-20170224 TATTGTACCCATTTCATGGATGG + Intronic
903533712 1:24052557-24052579 TTCTGTGCCCATCTGTTTAATGG + Intergenic
903666790 1:25012952-25012974 TTTTATCCCCATTTCATGGATGG + Intergenic
904340975 1:29834318-29834340 TACTGTGCCCATTTCACAGAGGG - Intergenic
905049003 1:35032322-35032344 TTTAGTGCCCATTTCCTGAAAGG + Intergenic
906176434 1:43777676-43777698 TCCTGTGCCTATGTCCTGAATGG - Intronic
907796857 1:57726376-57726398 TCCTGTTCCCATTCAATGAAAGG - Intronic
908079032 1:60554896-60554918 ATCTTTGCCCATTTTATTAATGG - Intergenic
909698480 1:78492975-78492997 TTCTTTGGCCATCTCATCAATGG + Exonic
910481584 1:87663874-87663896 TTCTCTGCCCTTTTCATGTTTGG - Intergenic
911148526 1:94574553-94574575 GTCAGTGCCCATGTCCTGAATGG + Intergenic
911456677 1:98133162-98133184 TTTTGTGCCCATTTCTAAAAGGG - Intergenic
911475818 1:98370940-98370962 TTCTGAGCCCTTTTGTTGAATGG - Intergenic
911991251 1:104699521-104699543 TTCAGTGCCCATATCATATAAGG - Intergenic
912214336 1:107590340-107590362 TTCTGAGGCTATTTCATGCAAGG + Intronic
912299194 1:108496264-108496286 TCCTGTGCCTATGTCCTGAATGG - Intergenic
913260171 1:116990686-116990708 TTCTGTGACCATATCGTGACTGG + Intergenic
915216363 1:154343215-154343237 GGCTGTGCCCATCTCATGGACGG - Exonic
916182721 1:162101008-162101030 TCCTGTGCCTATGTCCTGAATGG + Intronic
916252341 1:162751316-162751338 TTCTTTGCCCATTTTTTGATGGG - Intronic
916704788 1:167337977-167337999 TTCAGTGCCCATATCATAAAAGG - Intronic
917302755 1:173594186-173594208 TTTTGTGTCCTTTTCATTAAAGG - Intronic
917916403 1:179706763-179706785 CTCTGTGGCCATTTCCTGGAGGG - Intergenic
919325020 1:196096787-196096809 TTCAGTGCCCATATCATAGAAGG + Intergenic
919398246 1:197077494-197077516 TTCTCTGCCCATATCATAGAAGG + Intergenic
919738890 1:200970862-200970884 TTCTGTGCCCATCTTAAGACTGG - Intronic
921947768 1:220898284-220898306 TCCTTTGCCCATTTTATGATGGG + Intergenic
923375313 1:233356104-233356126 TTCTGTGCCCATTTCATGAATGG + Intronic
923399590 1:233603405-233603427 TTCAGTGCCCATATCATAGATGG + Intergenic
1062903619 10:1164523-1164545 GTGTGTGCCCATTTCCTCAAGGG + Intergenic
1062964390 10:1596033-1596055 TTCTGTGAACAAGTCATGAAGGG - Intronic
1063284113 10:4664157-4664179 TTTTGTTCCCATTTTATGTATGG - Intergenic
1064063975 10:12164579-12164601 CTCGGTGCCCATTTCAGAAACGG - Exonic
1065421396 10:25548550-25548572 TGCTGTGCCCATTTTACAAATGG + Intronic
1066082411 10:31944600-31944622 TTCTGTAGCCACTTCCTGAAAGG - Intergenic
1066452061 10:35538631-35538653 TTCTTTGCCCATTTTAAGAACGG + Intronic
1067070564 10:43127981-43128003 TTCTGTGCCAATTATATTAATGG - Intronic
1067214268 10:44287816-44287838 TTCTTTGCCCTATTCATTAAAGG + Intergenic
1067305176 10:45057305-45057327 TTCTATGCCCGGTTCATGTAAGG + Intergenic
1070225905 10:74505253-74505275 TTCAGTGCCCATATCATAGAAGG + Intronic
1070369029 10:75764231-75764253 TTCTGTAACCATGTCATCAACGG + Intronic
1071288798 10:84173282-84173304 TCCTGTGCCCATTTCACAGATGG + Intergenic
1071383320 10:85094028-85094050 TTCTTTGCCCATTTTTTAAATGG + Intergenic
1074397606 10:113111354-113111376 TTCAGTGCCTATTTCATGCCTGG - Intronic
1074897416 10:117789425-117789447 GTCTGTGCCCATTTCATAGATGG + Intergenic
1075236785 10:120737635-120737657 TTCTGTGCACACTTCATATATGG + Intergenic
1075941439 10:126393670-126393692 TTCTGAGGCCAAATCATGAAAGG + Intergenic
1076027837 10:127131030-127131052 CTAGGTGCCCATTTCCTGAAGGG + Intronic
1076377293 10:130000074-130000096 TACTGTGCTCACTTCAAGAATGG - Intergenic
1076754530 10:132562345-132562367 GTCTGTGCCCACTTCCAGAAGGG - Intronic
1077241912 11:1515111-1515133 TTCCGTGCCCAGCTCATGATGGG - Intergenic
1077734484 11:4774699-4774721 TCCTGTGCCTATGTCCTGAATGG + Intronic
1078247424 11:9587505-9587527 TTCTGTTCTTATTTTATGAAAGG + Intronic
1079474566 11:20815482-20815504 TCCTTTGCCCATTTCTTAAATGG + Intronic
1080928174 11:36780171-36780193 TTCTGAGCCAATTTCATAAGAGG - Intergenic
1082680961 11:56169487-56169509 TTCTTTGCCCATTTTTTAAATGG - Intergenic
1083510097 11:63201577-63201599 TCCTGTGCCTATGTCCTGAATGG - Intronic
1083693626 11:64427567-64427589 TTCAATGCCTTTTTCATGAAGGG + Intergenic
1085270358 11:75266500-75266522 CTCTCTGCCCCTTTCATGACTGG - Intronic
1086659331 11:89395324-89395346 TTCTTTGCCCACTTTATGATGGG + Intronic
1086667601 11:89502417-89502439 TTGTGTTCCAATCTCATGAATGG - Intergenic
1086762480 11:90649844-90649866 GTCTGTGCCTATATCCTGAATGG - Intergenic
1088169918 11:106984344-106984366 TTCTTTGTCTATTGCATGAATGG - Intronic
1089439380 11:118502413-118502435 TACTGTGACTATTTCATGAGTGG - Exonic
1090074238 11:123569433-123569455 TTCTGTGCCCATGTCACGGCAGG - Intronic
1090946213 11:131431713-131431735 TTCTATGCCCATTTCACAGATGG + Intronic
1091113748 11:132994880-132994902 TGCTGTGCACATTAAATGAAAGG - Intronic
1091206905 11:133827881-133827903 TTTTGTACCCAGATCATGAAGGG + Intergenic
1091390823 12:125254-125276 TACTGTGCCCATTTTATAGATGG + Intronic
1092728204 12:11504860-11504882 GTCTTTTCCCATTTCATGGAAGG - Intergenic
1092793001 12:12085661-12085683 TTCTGTGGCCTTTCCGTGAATGG + Intronic
1092952402 12:13518949-13518971 TCCTGTGCCTATGTCTTGAATGG + Intergenic
1093529953 12:20148904-20148926 TTCTGTGCCTATATCACGGAAGG + Intergenic
1093793463 12:23283341-23283363 TTCTTTGCCCATTTTTTGATGGG + Intergenic
1093849769 12:24021239-24021261 CTCTGTCCCCATCTCATGCAGGG - Intergenic
1094256268 12:28430920-28430942 TGCTCTGCCCATGGCATGAATGG + Intronic
1094266400 12:28565087-28565109 TTCTGTGCCATTTTCAGGACTGG + Intronic
1094428653 12:30342199-30342221 TTCTCTGCTCATTCCCTGAAAGG + Intergenic
1094762308 12:33548249-33548271 TTATGTGGCCATTCTATGAATGG - Intergenic
1095140881 12:38660534-38660556 TTCTATGCCTATGTCCTGAATGG - Intronic
1095445831 12:42281260-42281282 TTCTGTTTTCATTTCAGGAAGGG - Intronic
1096195209 12:49645248-49645270 TTCTCTGCCCATTTCATTCTAGG - Exonic
1096928822 12:55181308-55181330 GTCTGTGCCTATGTCCTGAATGG + Intergenic
1097652128 12:62312269-62312291 TTCTCTTCCCATTTCAGGGAGGG + Intronic
1097757449 12:63422580-63422602 TTCTGTGCCCTATTCAGGAAAGG - Intergenic
1097955162 12:65477621-65477643 TACTGGGCCTATTTCATGAAAGG - Intronic
1098463400 12:70759260-70759282 TTGTGTGCCCATTGCATGCCAGG + Intronic
1099378455 12:81923780-81923802 TTCTCTGCCCATTTCAAAATTGG + Intergenic
1099429034 12:82558868-82558890 GTCTGTGCCTATGTCCTGAATGG + Intergenic
1100374662 12:94003135-94003157 TTCTTTGCCCATTTTTTGATGGG + Intergenic
1100531775 12:95467807-95467829 TTCTGTGCCATTTTCAGGACTGG + Intergenic
1101215913 12:102582592-102582614 GTCTGTGCCTATGTCCTGAATGG + Intergenic
1101543723 12:105689558-105689580 TTCTGTGCCCAGATCATGCCAGG + Intergenic
1101812429 12:108119589-108119611 TTCTGTCCCCAGGTCATGCAAGG - Intergenic
1101854519 12:108431109-108431131 CTCTGTGCCCATTTCACAGATGG - Intergenic
1102602199 12:114039899-114039921 GTCTGGCCCCATTTCAAGAATGG - Intergenic
1104517839 12:129444180-129444202 TGCTGTGCCTATGTCCTGAATGG - Intronic
1104786127 12:131448944-131448966 TTCTGGGCCCCTTATATGAATGG + Intergenic
1107518077 13:41151164-41151186 TTCTTTGCCCTATTCATTAAAGG + Intergenic
1108384307 13:49884762-49884784 GTCTTTGCCCATGTCCTGAATGG - Intergenic
1108450454 13:50557382-50557404 TTTAGTGCCCATATCATGGAAGG - Intronic
1109093788 13:58084732-58084754 TTCTGTGACTATGTAATGAAAGG + Intergenic
1109361956 13:61304530-61304552 TCCTGTGCCTATGTCCTGAATGG - Intergenic
1110036174 13:70687666-70687688 TTCTTTGCCCATTTCTTAATGGG + Intergenic
1111379883 13:87435371-87435393 TTCTTTGCCCACTTTATGATAGG - Intergenic
1111857552 13:93657772-93657794 TTCTTTGCCCATTTTTTTAATGG - Intronic
1113190539 13:107740697-107740719 TTCTGTGATCATTTTATAAATGG + Intronic
1113374671 13:109753296-109753318 TTCTGTGTGCATGTCATGGAGGG + Exonic
1113524044 13:110959920-110959942 CTCTGTGCCCGTTGAATGAATGG + Intergenic
1115013463 14:28579428-28579450 TTTTTTGCCCATTTCTTAAAGGG + Intergenic
1115482608 14:33876114-33876136 TTGTGTGCTAATTTCATGCAGGG - Intergenic
1116454527 14:45104010-45104032 TATTGTTCCCATTTTATGAAAGG + Intronic
1117316869 14:54579732-54579754 TTCTGTGGCCTCTGCATGAATGG + Intronic
1118970228 14:70630213-70630235 TTCAGTGCCTATATCATGGAAGG - Intergenic
1121028139 14:90631943-90631965 TCCTTTGCCCATTTCCTAAAGGG + Intronic
1121043336 14:90768686-90768708 TTCTGTGAGCATTTCTTGCAGGG - Intronic
1122794141 14:104197296-104197318 TTCAGTGCCCACTTGATGACAGG + Intergenic
1123131591 14:105990145-105990167 TTCATTGCACATTTAATGAAAGG - Intergenic
1123581823 15:21721331-21721353 TTCATTGCACATTTAATGAAAGG - Intergenic
1123618472 15:22163931-22163953 TTCATTGCACATTTAATGAAAGG - Intergenic
1124478866 15:30060272-30060294 TTCTGTCTCCATGCCATGAATGG - Intergenic
1124553346 15:30703569-30703591 TTCTATTCTTATTTCATGAAGGG + Intronic
1124677899 15:31702099-31702121 TTCTATTCTTATTTCATGAAGGG - Intronic
1125978899 15:43981633-43981655 TTCAGTGCCCATATCATAGAAGG + Intronic
1126245047 15:46495062-46495084 TTCTTTGCCCACTTCTTGATGGG - Intergenic
1127225434 15:56922850-56922872 TTCTGTGGCCAGTTCTTAAAGGG + Intronic
1128139744 15:65290706-65290728 TTCAGTGCCCATGTCATAGAAGG - Intronic
1130735430 15:86543594-86543616 TTCAATGCCCTTTTCATGCATGG + Intronic
1131635379 15:94227942-94227964 TTCTTTACCCATCTAATGAATGG + Intergenic
1131670453 15:94614375-94614397 TTCTGTCCCCATCGCTTGAATGG - Intergenic
1131970690 15:97889941-97889963 TTCTGTGTCTATTTCATTCACGG + Intergenic
1133104612 16:3499022-3499044 TTCTTTGCCCATTTCAAAATTGG - Intergenic
1133770407 16:8864484-8864506 TTCTATCCCCATTTCACTAATGG + Intronic
1137231865 16:46574067-46574089 TTTTGTGCACATTTCACAAACGG - Intergenic
1137359595 16:47801428-47801450 TCCTGTGCCTATGTCCTGAATGG - Intergenic
1137369603 16:47892792-47892814 TGCTGTCCCCATTTTATAAATGG - Intergenic
1137616825 16:49853687-49853709 TTCAAGGCTCATTTCATGAAAGG + Intronic
1140092737 16:71851133-71851155 TTGCCTTCCCATTTCATGAAAGG + Exonic
1140234068 16:73142827-73142849 TACTATGTCCATTTCATGGATGG + Intronic
1141252890 16:82374862-82374884 TTCTGTGTCCTTTTCATCATGGG + Intergenic
1142283914 16:89163518-89163540 TTCTTTGCCCATTTCCTGTTGGG + Intergenic
1142599975 17:1048907-1048929 TTCTGTGACCATGAAATGAAGGG - Intronic
1143469357 17:7162141-7162163 TTCTTTGCCCATTTCTCCAATGG + Intergenic
1143567721 17:7734679-7734701 TGCTGTGCCAGTTTCATAAAGGG - Exonic
1144517598 17:15929449-15929471 TTCTCAGCCCAGTTCATGAGGGG + Intergenic
1145293580 17:21570592-21570614 TTCTTTGCCCATTTTTTGATTGG - Intronic
1146920815 17:36709623-36709645 TGCTTTGCCCATTTCTTGATTGG + Intergenic
1147363502 17:39945593-39945615 TTGTGAGCCCAATTCAGGAAAGG - Intergenic
1147363929 17:39948003-39948025 TTGTGAGCCCAATTCAGGAAGGG - Intergenic
1150169551 17:62978787-62978809 TTCTGTGCCATTTTCAGGACTGG + Intergenic
1150321781 17:64220275-64220297 GTCTGTGCCTATGTCATGAATGG - Intronic
1151700888 17:75742084-75742106 TTCTCTGCCCACCTCATCAAGGG - Intronic
1153429286 18:4998359-4998381 GTCTGTACCCATTTTATTAAAGG - Intergenic
1153659228 18:7311777-7311799 TTCAGTGCCCATATCATGGAAGG + Intergenic
1153739961 18:8114142-8114164 TTCAGTTCCCATTTCTTTAATGG - Intronic
1154316367 18:13307077-13307099 TTCAGTGCCCACTTCATAGACGG - Intronic
1155047346 18:22114367-22114389 TTCTGTTTCCAGTTCATCAACGG - Intergenic
1155255325 18:23992269-23992291 TTCAGTGACTATTTAATGAATGG - Intergenic
1155294830 18:24375442-24375464 TTCTCTGCACATTTGATGCAAGG + Intronic
1155432646 18:25776820-25776842 GTCTGTGCCTATGTCCTGAATGG - Intergenic
1155542471 18:26882776-26882798 TTCTGTGCACAGCTCATGCAGGG - Intergenic
1155665551 18:28304223-28304245 GTCTGTGCCTATGTCCTGAATGG + Intergenic
1155789380 18:29946380-29946402 TTCAGTGCCCATATCATAGAAGG + Intergenic
1156038382 18:32792408-32792430 TTCAGTGCCCATATCATAGAAGG + Intergenic
1157462335 18:47910439-47910461 TTCAGTGCCCATGTAATGGAAGG - Intronic
1157998605 18:52589312-52589334 TTCTGTGACCATTTCATTTCTGG - Intronic
1158003742 18:52648399-52648421 AAGTGTGCCCATTTCATAAATGG - Intronic
1158676602 18:59525663-59525685 TCCTGTGCCTATGTCCTGAATGG + Intronic
1159142306 18:64412318-64412340 TTCTGTGCCCATCCCATTTATGG + Intergenic
1159356577 18:67344420-67344442 TTATGTGCCACTTTCATGAACGG - Intergenic
1159373276 18:67557844-67557866 TTCTGTTCACATTTCTTGCAAGG + Intergenic
1159403701 18:67972456-67972478 GTCTTTGCCCATTTTTTGAATGG + Intergenic
1161454245 19:4362228-4362250 TTCTCTGCCCATCTCAAGCAGGG - Intronic
1162006209 19:7781330-7781352 TCCTGTGACCCTTCCATGAAAGG - Intergenic
1164704497 19:30310332-30310354 ATCTGTGCTCATTTTCTGAAAGG - Intronic
1166486279 19:43215806-43215828 TTCTGGGCCCTATTCATTAATGG - Intronic
1167928037 19:52838367-52838389 TGCTGTGGTCATTTCATGGATGG - Exonic
1167932668 19:52879467-52879489 TGCTGTGGTCATTTCATGGATGG - Exonic
1168489763 19:56798531-56798553 GCCTGTGCCCATGTCCTGAATGG - Intronic
925189863 2:1874291-1874313 TTCCGTGCCCATTTCACAGATGG - Intronic
925555047 2:5121424-5121446 TTCCATGACAATTTCATGAAAGG - Intergenic
926477837 2:13349734-13349756 TCCTGTGCCTATGTCCTGAATGG + Intergenic
926861336 2:17312642-17312664 ATATGTGCGCATTTTATGAATGG - Intergenic
929625875 2:43406117-43406139 TGCTGTGCCTATTTCTTGCAGGG - Intronic
930479841 2:51933792-51933814 TTCTGTCCACATTTCACGAGAGG - Intergenic
930580576 2:53206499-53206521 TCCTGTGCCCACGTCCTGAATGG - Intergenic
930907087 2:56583513-56583535 TTCTGTGCACAGTTAATTAACGG - Intergenic
931985712 2:67740035-67740057 TTCTATGCCTATGTCCTGAATGG + Intergenic
932029283 2:68166684-68166706 TTCAGTGCCCACGTCATAAAAGG + Intronic
932280860 2:70490918-70490940 TTCTGAGTCAATTTTATGAATGG - Intronic
932441564 2:71739948-71739970 TCCTGTGCCTATGTCCTGAATGG + Intergenic
932874488 2:75436059-75436081 GCCTGTGCCCATGTCCTGAATGG - Intergenic
934062597 2:88309290-88309312 TACTGTGGACATTTCATAAATGG - Intergenic
934729405 2:96647122-96647144 TTGTGAGCCCATGTCCTGAAGGG - Intergenic
935082462 2:99811561-99811583 TCCTGCTCCTATTTCATGAAAGG + Intronic
935864936 2:107376966-107376988 TTCTGTGACTAGGTCATGAAAGG + Intergenic
937419866 2:121745118-121745140 TTCTTTGCCCATTTTTTGATGGG + Intronic
937768401 2:125689081-125689103 TTCAGTGCCCATGTCATAGAAGG - Intergenic
938136375 2:128761259-128761281 TGCTGTGCCTATGTCCTGAATGG + Intergenic
939521588 2:143238114-143238136 GTCTGTGCCTATGTCCTGAATGG - Intronic
940459613 2:153947753-153947775 TTCTGTGCCCATGTCCTGGATGG + Intronic
941104393 2:161335870-161335892 TACTGTGCCTATTTTATAAATGG - Intronic
941276420 2:163496472-163496494 ACCTGTGCCCATATCCTGAATGG - Intergenic
941743160 2:169057874-169057896 GTGTGTGCCCATGTCCTGAATGG - Intergenic
942135157 2:172918167-172918189 TTCTGTGCCCTTTTAAAGAAGGG + Intronic
942827001 2:180190662-180190684 TCCAGTGCCCATTTTAAGAAAGG + Intergenic
943239682 2:185366466-185366488 TTCAGTGCCCATATCATAGAAGG - Intergenic
943539609 2:189196122-189196144 TCCTTTGCCCATTTCTTGATGGG - Intergenic
943801421 2:192062845-192062867 TTTTCAGCCCATTTCATGAAGGG - Intronic
944792058 2:203141279-203141301 TTCAGTGCCCATTCCATAATAGG + Intronic
945347399 2:208734156-208734178 TTCTTTGCCCATTTTTTAAAGGG + Intronic
945612485 2:212021641-212021663 GCCTGTGCCCATGTCCTGAATGG - Intronic
947894785 2:233659770-233659792 TTCAGTGCCCATATCATAGAAGG + Intronic
1170947423 20:20903806-20903828 TTCTTGGCCCATTTCCTGATGGG - Intergenic
1171411488 20:24951234-24951256 TTATCTTCCCATTTCATGGATGG - Intronic
1173385944 20:42587930-42587952 TTTTGTGCCCATTTTATAAATGG - Intronic
1173491431 20:43485962-43485984 TTCTTTGCCCAATTCCTGAATGG - Intergenic
1174178731 20:48661733-48661755 TGCTGTGCCCCTTTCATAGACGG + Intronic
1175601323 20:60276004-60276026 TTCTGTGTGCATTTCCTTAATGG + Intergenic
1177118358 21:17111845-17111867 GTCTGTGCCTATGTCCTGAATGG - Intergenic
1179530463 21:42015080-42015102 TTCTCTGCCTCTTTCATAAAGGG + Intergenic
1180047428 21:45315488-45315510 GCCTGTGCCCATGTCCTGAATGG - Intergenic
1181433623 22:22897589-22897611 GTCTGAGCCCATTTCATGGAGGG + Intergenic
1181863543 22:25837656-25837678 TCCTGTGCCCATATCAGGACAGG + Intronic
1182124990 22:27809882-27809904 ATGTGTGCCCATTTTATGGACGG + Intergenic
1183707645 22:39484304-39484326 CTCTGTGCCCATTTCACAGATGG + Intronic
1184476104 22:44722281-44722303 TAGTGTCCCCATTTCATGGATGG - Intronic
949211920 3:1513273-1513295 TTCTGTGGCCATTTCAAGACAGG + Intergenic
950587624 3:13906304-13906326 GTCTGTGCCTATGTCCTGAATGG - Intergenic
950718126 3:14864033-14864055 TTCTGTCCCCATGGCATGAATGG + Intronic
951322120 3:21257814-21257836 TTCAGTGCCCATTTCAGAAGTGG + Intergenic
951628606 3:24694190-24694212 TTCCGTGCCTATTTCCTGAATGG + Intergenic
955015646 3:55066409-55066431 TTTTGTACCCATTTAATGAAAGG + Intronic
955337809 3:58101463-58101485 TTCTGTGGACATTTCAAGTAAGG + Intronic
955382571 3:58451672-58451694 TTTAGTGCCCATATCATGGAAGG + Intergenic
956375222 3:68607118-68607140 GCCTGTGCCCATGTCCTGAAAGG - Intergenic
957351767 3:79032545-79032567 TTCTATTGCCATTTCATAAAGGG - Intronic
957366500 3:79231139-79231161 GTCTGTGCCTATGTCCTGAATGG - Intronic
957400046 3:79699778-79699800 TTCTGGGAACATTTCTTGAAAGG + Intronic
957872067 3:86102045-86102067 TTCTGTGCCCATGTCCTGAATGG + Intergenic
958170238 3:89930434-89930456 ATCTGTGTCCAATTCATGCATGG + Intergenic
959291666 3:104482822-104482844 TACTGTGCCTATTTCATTACAGG + Intergenic
959607269 3:108255450-108255472 GTCTGTGCCCCCCTCATGAATGG - Intergenic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
961089259 3:124095365-124095387 TACTGTGCCCATTTTATAGATGG - Intronic
962650314 3:137482150-137482172 GTCTGTGCCTATGTCCTGAATGG + Intergenic
962732977 3:138299996-138300018 GTCTGTGCCCACTTCACGAGTGG - Intronic
962843201 3:139253604-139253626 TGTTGTCCCCATTTCATGAATGG + Intronic
962879408 3:139562141-139562163 TATTGTGCCCATTTTATGGAGGG + Intronic
964555255 3:157930220-157930242 TTCATTGCCCATTTAATTAAAGG - Intergenic
964742069 3:159976863-159976885 TTCTGTGTCCATTGCCTAAAAGG + Intergenic
965159590 3:165115216-165115238 GTCTGTGCCTATGTCCTGAATGG + Intergenic
965428773 3:168561059-168561081 TTCAGTGACTATTTCATGAGAGG + Intergenic
965789538 3:172372890-172372912 TGCTGTGCCCATTTTACAAATGG + Intronic
966748426 3:183300066-183300088 CTCTGTGACGATTTCATCAATGG - Exonic
968700108 4:2051752-2051774 TTCTGTGCCCTGTTCACTAAAGG + Intergenic
971217918 4:24678800-24678822 TTTTGTGCCCAGTTAATTAATGG - Intergenic
971922964 4:32967964-32967986 TTCTTTGCCCATTTTGTGATGGG - Intergenic
971962294 4:33504766-33504788 TTCTTTGCCCTTTTCCTTAAGGG + Intergenic
971981485 4:33756744-33756766 TTCTATCACCATTTGATGAAAGG - Intergenic
973094811 4:46183232-46183254 TCCTGTGCCTATGTCTTGAATGG - Intergenic
973118505 4:46489542-46489564 GGCTGTGCACTTTTCATGAAAGG + Intergenic
973554368 4:52067322-52067344 TTCTTTGCCCATTTTTTGATGGG + Intronic
973635055 4:52854387-52854409 TTCTTTCCCCATATCATGGATGG + Intergenic
975284524 4:72601759-72601781 ATCAGTGGCCATTCCATGAATGG + Intergenic
976769903 4:88639899-88639921 TCCTTTGCCCACTTTATGAAGGG - Intronic
976801750 4:89000444-89000466 TTCTATGGACATTTCATAAATGG - Intronic
978317644 4:107457451-107457473 TTCTGTAACCATTTCATCTAAGG + Intergenic
979285969 4:118925038-118925060 TTCTGTGCACATCCCATGCAAGG - Intronic
979732375 4:124040717-124040739 TCCTGTGCCTATGTCCTGAATGG + Intergenic
980519449 4:133911197-133911219 GTCTGTGCCTATGTCCTGAATGG - Intergenic
981153145 4:141402133-141402155 TCCTCTGCCCATTACGTGAAAGG - Intergenic
981162470 4:141514925-141514947 TTTTCTTACCATTTCATGAAGGG - Intergenic
981198171 4:141944443-141944465 TCCTGTGCCTATGTCCTGAATGG + Intergenic
981230694 4:142351506-142351528 TTTTGTCCCCATTTCAGAAAGGG + Intronic
981648481 4:147027698-147027720 TGCTGTGCCCATTTACAGAAAGG + Intergenic
986438246 5:7756431-7756453 CTCAGTGTCCATTTTATGAATGG + Intronic
986959905 5:13199690-13199712 GGCTGTGCCCTTTTCATGGAAGG + Intergenic
986998855 5:13638325-13638347 TTCTGTGCCATTTTCAGGACTGG + Intergenic
987327352 5:16824386-16824408 GTCTGTGCCCATTTAATGCCAGG - Intronic
987853069 5:23381954-23381976 TTCTGTGTCTATGTCCTGAATGG - Intergenic
989432098 5:41367711-41367733 TGCTGTGCCTATATCCTGAATGG + Intronic
989697484 5:44220200-44220222 TTCTTTGCCCATTTTACTAATGG - Intergenic
991291431 5:65036920-65036942 TCCTTTTCCCACTTCATGAAAGG + Intergenic
992185768 5:74242826-74242848 CTCTGTCCCCATACCATGAAGGG + Intergenic
993087758 5:83384294-83384316 TTCTGTGGGCCTTTCATGTATGG - Intergenic
993322296 5:86487025-86487047 TTCTTTGCCCATTTTTTTAATGG - Intergenic
993674449 5:90800245-90800267 TCCTTTGCCCATTTCTTGATGGG - Intronic
993881801 5:93371633-93371655 TTATTTTACCATTTCATGAAAGG - Intergenic
993929714 5:93922864-93922886 TTCAGTGCCCATATCATTGAAGG - Intronic
994448752 5:99912252-99912274 GTCTGTGCCTATGTCCTGAATGG - Intergenic
994694296 5:103055211-103055233 TTCTTTGCCCATTTGTTGATGGG + Intergenic
995069147 5:107898183-107898205 TTCAGTGCCCACTTCATAGAAGG - Intronic
995327791 5:110911280-110911302 TTCAGTGCCCATATCATGGAAGG + Intergenic
995704256 5:114970077-114970099 TTCTGTAGAAATTTCATGAATGG + Intergenic
996006103 5:118422407-118422429 TCCTTTGCCCACTTCATGATGGG - Intergenic
997204629 5:132038773-132038795 GTCTGTGCCTATGTCCTGAATGG + Intergenic
997983446 5:138485329-138485351 TTCTGTAACCATTGCATGAAAGG - Intergenic
998679202 5:144446726-144446748 TTCTTTGCCCATTTTTTGATGGG - Intronic
998715352 5:144877624-144877646 TTCTCTGTTCATTTCATGTATGG + Intergenic
998793303 5:145789811-145789833 TTCTTTGCCCATTTCTTAATTGG - Intronic
999165483 5:149545745-149545767 TTCTGTGCCATTTTCAGGACTGG + Intronic
999562577 5:152820687-152820709 TTTTGTGTCCATGTCATGATGGG - Intergenic
1000368666 5:160514493-160514515 TTCTGTACTCATTTCATCATGGG - Intergenic
1001060654 5:168486166-168486188 TTTTGTGCCCATTTCACAAAGGG + Intergenic
1001273087 5:170330472-170330494 TTGTGTCCCCATTCCATGATGGG - Intergenic
1002369962 5:178743848-178743870 TCCTTTGCCCATTTTATGATGGG - Intergenic
1004307465 6:14514069-14514091 TTCTTTTCCCCTTTCATGGAAGG - Intergenic
1004810236 6:19251999-19252021 TCCTGTGCCTATGTCCTGAATGG - Intergenic
1005069106 6:21848243-21848265 ATCTCTGCCCATTTCATGATGGG - Intergenic
1005795457 6:29356211-29356233 CTCTTTGCCCAATTCCTGAAAGG - Exonic
1010117806 6:72335896-72335918 TTCTTTGCCCATTTTATGATGGG + Intronic
1010729265 6:79371132-79371154 TTCTGTTGCCATTTCAATAATGG - Intergenic
1010739664 6:79485507-79485529 TTCTGTTCCCAATAAATGAAAGG + Exonic
1011436165 6:87339611-87339633 TTCTGTGCCTATTATATAAAAGG + Intronic
1011783259 6:90814356-90814378 GTCTGTGCCTATGTCCTGAATGG + Intergenic
1012619855 6:101329975-101329997 TTGTGTGTCCTTGTCATGAAAGG + Intergenic
1012784164 6:103602055-103602077 TCCTGTGCCGATGTCCTGAATGG + Intergenic
1012834508 6:104248167-104248189 TTCTTTGCCCACTTCGTGATGGG - Intergenic
1013726883 6:113109041-113109063 GTCTGTGCCCATGTCTTCAATGG + Intergenic
1015058285 6:128930402-128930424 TTCTGTTCACATTTCATTGACGG - Intronic
1015609948 6:135006079-135006101 CTCTGTGCCTTTTTCGTGAATGG - Intronic
1015919310 6:138250790-138250812 TTCTGTGAGCATTTCATGGTTGG - Intronic
1016129375 6:140446851-140446873 TTCTGTGCCAAATTTATGACAGG - Intergenic
1016339401 6:143045594-143045616 ATCTGTGCCTATGTCCTGAATGG + Intergenic
1017280865 6:152623442-152623464 GTCTGTGCCTGTGTCATGAATGG - Intronic
1017876322 6:158527763-158527785 GCCTGTGCCTATGTCATGAACGG - Intergenic
1018262535 6:161984780-161984802 TGCTGTTAGCATTTCATGAAGGG + Intronic
1018781335 6:167068893-167068915 TCCTTTGCCCATTTCTTGATGGG + Intergenic
1019098158 6:169603784-169603806 ATTTAAGCCCATTTCATGAATGG - Intronic
1020430893 7:8115065-8115087 TTCAGTGCCATTTTGATGAAAGG - Intronic
1020439647 7:8203726-8203748 TTCTGTGCCTATTTGCTGTAGGG + Intronic
1020839365 7:13195690-13195712 TTTTTTGCCCTTTTCATTAAAGG + Intergenic
1021010032 7:15451139-15451161 TTCTGTAGCCTTTTCATTAAGGG + Intronic
1023215168 7:37854553-37854575 TTCAGTGCCCATATCATAGAAGG + Intronic
1023705740 7:42940137-42940159 TTCTGTTTTCAATTCATGAATGG + Intronic
1023769765 7:43545958-43545980 TTCAGTGCCCATATCTAGAAAGG + Intronic
1024342521 7:48281918-48281940 TTCTGTGTGCATTTCCTGATGGG + Intronic
1024743053 7:52375953-52375975 TTCTGAGCCCATCAAATGAAGGG + Intergenic
1024761632 7:52604063-52604085 TTCTGTGCCCATTTCTTATTGGG + Intergenic
1025578533 7:62679845-62679867 ATTTGTGTCCATTCCATGAATGG + Intergenic
1025623754 7:63199100-63199122 TTCAGTGCCTGTATCATGAAAGG + Intergenic
1026029529 7:66778544-66778566 TTGTGTACCTCTTTCATGAACGG + Intronic
1026542141 7:71288956-71288978 TAATGTGCCCATTTTATGTATGG + Intronic
1027368103 7:77479591-77479613 AGGTGTGTCCATTTCATGAAAGG + Intergenic
1027647107 7:80815538-80815560 TTTTTTGCCCATTTAAAGAAAGG - Intronic
1027775774 7:82462963-82462985 GTCTTAGCCCTTTTCATGAAAGG - Intergenic
1028787826 7:94816634-94816656 TCCTTTGCCCATTTCTTGATGGG + Intergenic
1030755108 7:113278280-113278302 TTCTGTCATCATTTGATGAAAGG + Intergenic
1031365163 7:120892091-120892113 TTCAGTGCCCATATCATAGAAGG + Intergenic
1032250816 7:130255934-130255956 TTCTGTGCCATTTTCAGGACTGG - Intergenic
1033018616 7:137698724-137698746 TGCTATGCCCATTTTATGAATGG + Intronic
1033976687 7:147111439-147111461 GCCTGTGCCCATGTCCTGAATGG + Intronic
1034834552 7:154339600-154339622 TTCAGTCCCCATCTAATGAATGG + Intronic
1036749130 8:11432388-11432410 TCCTTTGCCCATTTCTTGATGGG - Intronic
1036750642 8:11441720-11441742 CACTGTGTCCATTTCATGGATGG - Intronic
1037373188 8:18201875-18201897 TTCCTTGCCCTTTTCATCAAAGG + Intronic
1038116732 8:24564084-24564106 TTTTTTGCCCATTTTTTGAAAGG - Intergenic
1038469669 8:27803872-27803894 TTCTGTGCCCAATTTGTAAAGGG + Exonic
1040627263 8:49162813-49162835 TTCTATGCCCATTTCATGTTAGG + Intergenic
1040926798 8:52693192-52693214 TGCTGTGCCTATGTCCTGAATGG - Intronic
1041020041 8:53629585-53629607 TTCAGTGCAAATTTCATCAAAGG - Intergenic
1041124161 8:54618225-54618247 TTTTGAGCCCAGTGCATGAAGGG - Intronic
1041641649 8:60209105-60209127 TTCTGTTGTCATTTCTTGAAAGG - Intronic
1041653410 8:60323545-60323567 TCCTGTGCCTATGTCCTGAATGG + Intergenic
1043166014 8:76903357-76903379 TTCTGTGCCCACTTTTTGATGGG + Intergenic
1043421848 8:80106010-80106032 TTGTCTGCCCTATTCATGAATGG + Intronic
1044762042 8:95530220-95530242 TTCAGTGCCCATATCATAGAAGG + Intergenic
1046738914 8:117808174-117808196 TTCTATGATCATTTGATGAATGG + Intronic
1047380714 8:124359965-124359987 TTCTTTGCCCTTTTCCTTAATGG + Intronic
1047917671 8:129600156-129600178 TCCTGTGCCCATGTCCTGAATGG + Intergenic
1049124646 8:140775723-140775745 TTATTTGCCCAGTTCATTAAAGG + Intronic
1050126789 9:2364964-2364986 TTCTGATTCCATTTCATTAATGG - Intergenic
1050937458 9:11415775-11415797 TTCTGTGCCAATTAATTGAAGGG - Intergenic
1050968706 9:11841416-11841438 GTCTATGCCTATTTCCTGAATGG - Intergenic
1052082021 9:24218206-24218228 TTCTGAGACCAGGTCATGAAAGG + Intergenic
1053436653 9:38080005-38080027 TTCTGGGACCATATCATTAATGG - Intergenic
1056270047 9:84938557-84938579 TTCTGGGCTTATTTAATGAATGG + Intronic
1057421180 9:94913978-94914000 GTCTTTGCCCTTTGCATGAAGGG + Intronic
1057537005 9:95920046-95920068 TTCAGTGCCCATATCATAGAAGG - Intronic
1057724034 9:97555776-97555798 TACTGTCCCCATTTTATGGATGG + Intronic
1058172671 9:101701618-101701640 GTCTGTGCCAATGTCCTGAATGG - Intronic
1059063668 9:111059960-111059982 TTCTGTATCATTTTCATGAAAGG + Intergenic
1060567799 9:124609180-124609202 GTCTGTGCCTATGTCCTGAATGG + Intronic
1186464054 X:9770677-9770699 TCTTGTGGCCAGTTCATGAATGG + Intronic
1186581339 X:10822410-10822432 GCCTGTGCCTATTTCCTGAATGG - Intronic
1187121632 X:16413286-16413308 TTCAGTGCCCATATCATAGAAGG - Intergenic
1190795020 X:53732841-53732863 TTCAGTGCCCATGTCATAGAAGG - Intergenic
1191032082 X:55985196-55985218 GTCTGTGCCTATGTCCTGAATGG + Intergenic
1192013610 X:67302997-67303019 TTCTTTGCCCATTTTTTGAAGGG - Intergenic
1192856214 X:75015284-75015306 GCCTGTGCCTATGTCATGAATGG + Intergenic
1193095402 X:77542887-77542909 GTCTTTGCCCATGTCCTGAATGG - Intronic
1193177091 X:78406986-78407008 GCCTGTGCCTATGTCATGAATGG - Intergenic
1193458447 X:81759888-81759910 GTCTGTGCCTATGTCCTGAATGG - Intergenic
1193687574 X:84596577-84596599 GCCTGTGCCCATATCCTGAATGG - Intergenic
1194145040 X:90251827-90251849 ACCTGTGCCCATGTCTTGAATGG - Intergenic
1194220220 X:91181137-91181159 GTCTGTGCCTATGTCCTGAATGG + Intergenic
1194533853 X:95081729-95081751 TTCTATGCCGATTTTGTGAAGGG - Intergenic
1194575775 X:95612787-95612809 TTCTTTGCCCACTTTTTGAAGGG - Intergenic
1194575867 X:95613770-95613792 TTCTTTGCCCACTTTTTGAAGGG + Intergenic
1194964749 X:100274850-100274872 TTCAGTGTTCATTTCATCAAAGG + Intergenic
1195432803 X:104808335-104808357 TATTATGCCCATTTCATAAATGG + Intronic
1195960846 X:110384816-110384838 TATTCTGCCCATTTCAGGAAGGG - Intronic
1196202155 X:112898560-112898582 CTATGTACCCATTTCTTGAAAGG - Intergenic
1196905246 X:120424918-120424940 TTCTGTAACCATTTAATGTAAGG + Intergenic
1196929797 X:120670202-120670224 TTCTGAGCACATTTAATGTAGGG + Intergenic
1197010095 X:121550403-121550425 TTCTATGCCCAGTTTATTAATGG - Intergenic
1197525901 X:127562497-127562519 TTCTGTGCCTATGTCCTGAATGG + Intergenic
1197777170 X:130126005-130126027 TTCCTTGGCCATTTCATAAACGG - Intergenic
1197810536 X:130438202-130438224 TCCTTTGCCCATTTCTTTAATGG + Intergenic
1198548555 X:137719952-137719974 TTCAATCCCCATTTCCTGAATGG + Intergenic
1198570522 X:137950709-137950731 TCCTGTGCCTATGTCCTGAATGG + Intergenic
1199561339 X:149166287-149166309 TCCTGTGCCTATGTCCTGAATGG - Intergenic
1199566555 X:149221814-149221836 TTCTGTGGCCCTTTCATGTCTGG - Intergenic
1200556734 Y:4644889-4644911 GTCTGTGCCTATGTCCTGAATGG + Intergenic
1201231150 Y:11865924-11865946 TTCTTTGCCCATTTTTTGATGGG - Intergenic
1201252983 Y:12079360-12079382 TTCTGTGACCAATTCAGCAAGGG - Intergenic
1201313969 Y:12624837-12624859 TTCTTTGCCCACTTCTTGATGGG + Intergenic