ID: 923376686

View in Genome Browser
Species Human (GRCh38)
Location 1:233371053-233371075
Sequence CAATATTACCAGAGGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 300}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923376686_923376690 9 Left 923376686 1:233371053-233371075 CCCTCTTTCCTCTGGTAATATTG 0: 1
1: 0
2: 1
3: 25
4: 300
Right 923376690 1:233371085-233371107 CCATATGAACCTATAGATCTTGG 0: 1
1: 0
2: 0
3: 8
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923376686 Original CRISPR CAATATTACCAGAGGAAAGA GGG (reversed) Intronic
900132797 1:1095941-1095963 CCATATTACTAGAATAAAGAAGG - Intronic
901091044 1:6641687-6641709 AAATATTATCTGAGGAGAGATGG + Intronic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
904846057 1:33417516-33417538 GAATATTGCCAGAAAAAAGAAGG + Intronic
905712216 1:40115815-40115837 CACTATTAACAGAGTAAAAAAGG + Intergenic
906670660 1:47651968-47651990 CAAGATTATGAGAAGAAAGATGG - Intergenic
906740487 1:48178241-48178263 CAATTTTTTGAGAGGAAAGAAGG + Intergenic
907567926 1:55454210-55454232 CAATAAAACAAGAGGAAAAAAGG + Intergenic
907650677 1:56291863-56291885 CAAGCTTGCCAGAGCAAAGAAGG + Intergenic
907897577 1:58706263-58706285 AAACCTTACCAGAGGAAAAAAGG + Intergenic
908957781 1:69655439-69655461 CCATATTACAAGCAGAAAGATGG + Intronic
909837455 1:80274999-80275021 CATTATTACCAAAGGAAGTATGG - Intergenic
910527532 1:88198009-88198031 CAATGTTACCAGAAGAAACCTGG + Intergenic
911111605 1:94193810-94193832 AAGTGTTACCAGAGGAAAGATGG + Intronic
914017649 1:143835171-143835193 AAAAATTACCACAAGAAAGAAGG - Intergenic
914656259 1:149743703-149743725 AAAAATTACCACAAGAAAGAAGG - Intergenic
915968972 1:160338971-160338993 CAAAATCACCAGAGACAAGATGG + Intronic
916619059 1:166475837-166475859 CTATATTACCAAGGGAAAAAAGG + Intergenic
917506260 1:175629721-175629743 GAATTTTACCAGTGGAAATAGGG + Intronic
917701299 1:177584248-177584270 CAATTTTACCATAGGCAAGTGGG - Intergenic
918545430 1:185678238-185678260 AAATATTTCAAGAGGTAAGAAGG + Intergenic
918705879 1:187661419-187661441 CAATGTTAAAACAGGAAAGAAGG - Intergenic
919016594 1:192045672-192045694 AAATATTACCGAAGGAAAAAGGG - Intergenic
919116765 1:193289571-193289593 CATTATTACCAAAGGAAAAGGGG + Intergenic
922030145 1:221789878-221789900 CAACATGACCAGAGGAAATGTGG + Intergenic
922625677 1:227039181-227039203 CATTATTAACTGAAGAAAGATGG - Intronic
922789255 1:228301418-228301440 CATTATAACCAGAGGGTAGAGGG - Intronic
923376686 1:233371053-233371075 CAATATTACCAGAGGAAAGAGGG - Intronic
923891847 1:238224660-238224682 CAATAATAACAGAGCAAAGGAGG - Intergenic
924069809 1:240264864-240264886 CAATAATATCAGAGGGAAGGAGG - Intronic
924131846 1:240917458-240917480 CAATATTATAAGAGATAAGAAGG + Intronic
1063296096 10:4808189-4808211 CCATATTAACAGACTAAAGAAGG - Intronic
1063347270 10:5323816-5323838 CACTATTAGCAAAGAAAAGATGG + Intergenic
1064704676 10:18059555-18059577 AATTATTATCAGAGGAAAGGAGG - Intergenic
1068535450 10:58236507-58236529 CCATATTAACAGATTAAAGAAGG + Intronic
1069852089 10:71414428-71414450 CCACATTAGCAGAAGAAAGAAGG - Intronic
1069875186 10:71558471-71558493 GAATATTCCAAGAGGAAAAAAGG - Intronic
1071049321 10:81427516-81427538 CAATCTTACCAGACTGAAGAAGG - Intergenic
1072144601 10:92623337-92623359 CAATAATAACAGAGAAAACAAGG + Intronic
1072599286 10:96909395-96909417 CAATAGAAGCAGAGGAACGATGG - Intronic
1072828640 10:98634321-98634343 CAATATTGCCAAATGAATGAGGG + Intronic
1074628092 10:115216855-115216877 CAAAATTACCAAAAGAAAAAAGG - Intronic
1076436380 10:130446748-130446770 CTATATTACTAGAGGAAATTTGG - Intergenic
1078644643 11:13129207-13129229 CAGTATTAACTGAGGAAAAATGG + Intergenic
1078713519 11:13817609-13817631 CAAGATCACCAGAGGAGAGAAGG + Intergenic
1078832087 11:14987556-14987578 CAATATTCACATAGGAAATATGG + Intronic
1079078238 11:17396735-17396757 CAATAGAAGGAGAGGAAAGATGG + Intronic
1079517423 11:21285508-21285530 AAATAAGACCATAGGAAAGATGG - Intronic
1080054954 11:27896948-27896970 CAAGATAACCAGTAGAAAGATGG + Intergenic
1081023625 11:37980695-37980717 TAATATAACCAGAGATAAGAGGG + Intergenic
1086312594 11:85550886-85550908 CCGTATTTCCAAAGGAAAGAAGG + Intronic
1087340999 11:96907012-96907034 CAATCACACCAGAGGAAAGGTGG - Intergenic
1087592830 11:100214363-100214385 CAATTGTAGCAGTGGAAAGAAGG - Intronic
1087982706 11:104635931-104635953 CCATGTGATCAGAGGAAAGATGG - Intergenic
1089370668 11:117953886-117953908 CAATAGCACCAGAGCAAAAAGGG + Intergenic
1090739749 11:129647160-129647182 CAAAATTATCAGAGATAAGAGGG + Intergenic
1095512129 12:42963089-42963111 CAATATTGAAAGAGCAAAGAAGG + Intergenic
1095675190 12:44908536-44908558 CAATACCACCAAAGGAAAGAAGG + Intronic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1096239366 12:49951365-49951387 CAATGATACCAGAGCAAAGCAGG + Intronic
1097036304 12:56126733-56126755 CCATATTCCCAGAGGTAAGCAGG - Exonic
1098665509 12:73157664-73157686 CAAAAGTAGCAAAGGAAAGAAGG - Intergenic
1099257495 12:80331901-80331923 CAATAGAATCAGAGGAAAGAAGG + Intronic
1099381893 12:81964706-81964728 CAATATAACCAGAAGTGAGATGG + Intergenic
1100181092 12:92087439-92087461 TAATAACACCAGAGAAAAGATGG - Intronic
1100372753 12:93983663-93983685 CACTATTACCAAAGGAATGTGGG - Intergenic
1101010490 12:100444386-100444408 CTATATTACCAAATGAAAAAGGG - Intergenic
1101452918 12:104796814-104796836 TAAAATAACCAGAGGAGAGATGG - Intergenic
1102773646 12:115500054-115500076 CAATATTAACAGGGGAAATTTGG + Intergenic
1103127089 12:118433010-118433032 AACTATTACCATAGGAAAGCAGG - Intergenic
1103345592 12:120247898-120247920 GAATATTACCAGAGGTAAAGAGG + Intronic
1104106769 12:125668253-125668275 CAATAATACCACAGGAAAAGGGG - Intergenic
1104619725 12:130302003-130302025 CATTTTTCCCAGAGGGAAGAGGG - Intergenic
1109118698 13:58425813-58425835 CCAAATTCCCAGAGGACAGACGG - Intergenic
1109589282 13:64456543-64456565 GCAAATTACCAGAGGAAAAAAGG + Intergenic
1109744404 13:66603930-66603952 AAATATTACCAGAGAAAATCAGG - Intronic
1109908358 13:68875392-68875414 CAATTGTACCAGAGGAAATATGG - Intergenic
1110614065 13:77521631-77521653 CAATATTGCCTGTGGAAACAGGG + Intergenic
1110984064 13:81940757-81940779 CAATTTTACCTCAGTAAAGATGG - Intergenic
1111176014 13:84597279-84597301 CATTATTACCTGAAGAAAAATGG - Intergenic
1112511101 13:100010170-100010192 GAATATTATCAGAGAAAAAAGGG + Intergenic
1112798510 13:103084243-103084265 CAATATCACCATCGGAGAGAGGG - Intergenic
1113668422 13:112157949-112157971 CCAAATTAACAGAGGAAAAATGG - Intergenic
1115308070 14:31952250-31952272 AGTCATTACCAGAGGAAAGAAGG + Intergenic
1115473469 14:33792011-33792033 AACTATTAACAGAGGAACGATGG - Intronic
1117275970 14:54193898-54193920 AAATGTTATCATAGGAAAGAAGG - Intergenic
1118536109 14:66766616-66766638 CAATATTCCCAAAAGAAGGATGG + Intronic
1118945624 14:70384268-70384290 AAACATTACTAGAGGAAAAATGG + Intronic
1119192415 14:72691978-72692000 CAATATTACGAGGGGAAAGTGGG + Intronic
1119447172 14:74675401-74675423 AAATTTTGGCAGAGGAAAGAAGG - Intronic
1119914787 14:78387778-78387800 CATTATCACCATAGGAAAGAAGG - Intronic
1121344969 14:93128898-93128920 CAAGACCTCCAGAGGAAAGAAGG + Intergenic
1125815416 15:42580162-42580184 CATTCCTCCCAGAGGAAAGAAGG + Intronic
1126731446 15:51687324-51687346 CAATCTTTCCAGAGGAAACAGGG + Intronic
1126776260 15:52103184-52103206 CATTATTATAAAAGGAAAGAAGG - Intergenic
1127685797 15:61342389-61342411 CATTTTAACCAGAGCAAAGAAGG - Intergenic
1129147512 15:73662271-73662293 CAAAATTAACAGATGAAGGATGG - Intergenic
1130072560 15:80660350-80660372 CTCTATTTCCAGAGGAAAGGAGG + Intergenic
1130574466 15:85079509-85079531 CAAAATAACAAGAGGAAATAGGG + Intronic
1130610008 15:85352669-85352691 CAATATTATCTCAGGAGAGATGG + Intergenic
1131319977 15:91378476-91378498 CAACATTACCAAACGTAAGAAGG - Intergenic
1132048877 15:98590637-98590659 CAATACCAGCTGAGGAAAGAGGG - Intergenic
1133777298 16:8907028-8907050 CAAAATTAACAGAGGCAGGAAGG + Intronic
1138099443 16:54240681-54240703 CATTATTCCCCAAGGAAAGAAGG + Intergenic
1138830530 16:60369189-60369211 CAAGTTTACAAGATGAAAGAGGG + Intergenic
1139132062 16:64158474-64158496 CAATAATATCAGAGTTAAGAGGG + Intergenic
1139154570 16:64424920-64424942 CAATTGTACCAGAAGGAAGAGGG - Intergenic
1140263694 16:73402282-73402304 CAAGTTTACCTGAGGAAACAAGG - Intergenic
1140534591 16:75697973-75697995 CAATATTTCCACAGACAAGAGGG - Intronic
1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG + Intergenic
1145820447 17:27829825-27829847 CAAAAGTACCAGAAGAGAGAAGG + Intronic
1145821494 17:27839998-27840020 CAAAAGTACCAGAAGAGAGAAGG - Intronic
1146004814 17:29154585-29154607 CAAGATCAACAGAGGCAAGAGGG - Intronic
1146210672 17:30940273-30940295 CACTATTAACTGAAGAAAGATGG + Intronic
1149339401 17:55670322-55670344 CAATACTACAAGGGGAAAAAAGG + Intergenic
1149367701 17:55962462-55962484 CAAAGTTACCAGAGGATACAAGG - Intergenic
1150525348 17:65916846-65916868 GAATATTAAAAGAGCAAAGATGG - Intronic
1150569272 17:66371779-66371801 CAATATTGCCAGATGACAAAGGG - Intronic
1151088954 17:71413293-71413315 GATTATTTCCAGAGGAAGGAGGG + Intergenic
1151145910 17:72040841-72040863 CATTTTTACCTGAGAAAAGAAGG + Intergenic
1153891133 18:9516579-9516601 CAATATTAGGAGGGGAAACAGGG - Intronic
1155489273 18:26383277-26383299 CAATATTAACACTGGAAATAGGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155974311 18:32111453-32111475 TAATATTACTAGAGGAAGCATGG - Intronic
1156641406 18:39104875-39104897 CTCTATTACCACAGGATAGAGGG + Intergenic
1156976626 18:43229760-43229782 CAATATTATGTGAGTAAAGATGG - Intergenic
1157371362 18:47115283-47115305 AGGTATTACAAGAGGAAAGATGG - Exonic
1157422656 18:47559457-47559479 CGTTACTCCCAGAGGAAAGAGGG + Intergenic
1157668608 18:49509780-49509802 GAATTTTACAAGAGGAAAGATGG - Intergenic
1159698795 18:71596721-71596743 CAACATTACAACAGGAAATAAGG + Intergenic
1161565689 19:5000701-5000723 CAATATAACCACAGTAAAGAAGG - Intronic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
925261774 2:2535578-2535600 CAAAATTACAAGAAGAAAGTAGG - Intergenic
926319938 2:11742750-11742772 CAATCTGACCAGAGGAGAAAGGG + Intronic
926401464 2:12501462-12501484 CAATTTAACAAGATGAAAGATGG + Intergenic
926457315 2:13082858-13082880 CAAAATTTAAAGAGGAAAGAAGG - Intergenic
927586604 2:24312745-24312767 GAATATTCCAAGTGGAAAGATGG + Intronic
928645294 2:33345918-33345940 AAATATTGCAGGAGGAAAGAGGG + Intronic
928665172 2:33543676-33543698 AATTATTATCAGAGGAGAGAAGG + Intronic
928776764 2:34774517-34774539 CAATTTTAGCACAGAAAAGATGG - Intergenic
929019595 2:37538497-37538519 CAAAACCACCAGAGAAAAGATGG - Intergenic
929322467 2:40561220-40561242 AAATGTTTTCAGAGGAAAGATGG - Intronic
929345114 2:40872796-40872818 CAGTATCACCAGGGGACAGAAGG - Intergenic
929695940 2:44115274-44115296 AAATATGATCAGAGGACAGAAGG - Intergenic
930122534 2:47771576-47771598 CAAAATTACAGGAAGAAAGAAGG + Intronic
931315819 2:61129961-61129983 CAATACCACAAGAGGAAACAGGG + Intronic
931949058 2:67340882-67340904 TAATAAAACCAGAGGAGAGAAGG + Intergenic
933172055 2:79135580-79135602 CAAATTTAGCAGAGGAGAGATGG + Intergenic
933233929 2:79843395-79843417 CTATATTAACATAGAAAAGAAGG - Intronic
933523065 2:83399270-83399292 GAGTACTACCAGAGGAAAAAAGG + Intergenic
933819933 2:86101749-86101771 CAATTTTACAAGATGAAAAAGGG - Intronic
934630292 2:95912265-95912287 GAATATAACCAGAGAAAAAAAGG - Exonic
934630569 2:95916001-95916023 GAATATAACCAGAGAAAAAAAGG - Exonic
934803622 2:97194874-97194896 GAATATAACCAGAGGAAAAAAGG + Exonic
934803905 2:97198615-97198637 GAATATAGCCAGAGGAAAAAAGG + Exonic
934804045 2:97200482-97200504 GAATATAACCAGAGAAAAAAAGG + Exonic
934804320 2:97204220-97204242 GAATATAGCCAGAGGAAAAAAGG + Exonic
934833005 2:97551310-97551332 GAATATAACCAGAGAAAAAAAGG - Exonic
935445290 2:103149867-103149889 GAAAAATACCAGAGCAAAGAGGG + Intergenic
936742956 2:115536881-115536903 TAATTTTACCAGAGTAATGAAGG - Intronic
938085525 2:128397778-128397800 CAAAAGCAACAGAGGAAAGATGG - Intergenic
938557970 2:132443297-132443319 CAATATTACTAAAGTACAGATGG + Intronic
939215139 2:139227571-139227593 CAGTGTTACCACAGAAAAGAGGG - Intergenic
939473108 2:142650526-142650548 CATTATTTCCAGAGGTGAGAAGG + Intergenic
939507269 2:143061108-143061130 AAATATTACCAGAGTAAACCAGG + Intergenic
939984847 2:148819743-148819765 CATTATTAACTGAGGAAAAATGG - Intergenic
940342014 2:152591303-152591325 AAATATTACCAGAGGGAGGCCGG - Intronic
942529276 2:176891209-176891231 CCATGTTGTCAGAGGAAAGATGG + Intergenic
942794013 2:179794744-179794766 CAATCATAATAGAGGAAAGAGGG + Intronic
942951304 2:181725085-181725107 CTTTATTACCTGAGAAAAGATGG + Intergenic
943679500 2:190753020-190753042 CAATAGTACTAGTGGAATGAGGG - Intergenic
943862906 2:192891699-192891721 TAATGTTATCAGAGAAAAGATGG + Intergenic
944384594 2:199150530-199150552 CAATTCCACCAGAGGAAACAAGG + Intergenic
946067258 2:216998639-216998661 CATTATAACCAGATGAAAGGGGG - Intergenic
946521208 2:220467004-220467026 CAATATTACCTGAAGAAAAAAGG + Intergenic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
948392238 2:237620639-237620661 TAAAATAACCATAGGAAAGATGG - Intergenic
1171019994 20:21576354-21576376 CAATATCTCCATAGGAAGGAAGG - Intergenic
1172541906 20:35724904-35724926 CAATACTACAAGAGGCAAAATGG + Intronic
1172749601 20:37241310-37241332 CATTAGTTCCAGAAGAAAGATGG + Exonic
1173015850 20:39225076-39225098 AAAGTTTACCAAAGGAAAGAAGG - Intergenic
1173209678 20:41022439-41022461 CAGTATTCCCTGAGGAATGAAGG - Intergenic
1174921482 20:54707143-54707165 CAACATGAGCAGAGGAGAGAAGG + Intergenic
1174950894 20:55040621-55040643 CAAGAATAGCACAGGAAAGACGG - Intergenic
1174959109 20:55135012-55135034 TAATATTACCAAAAGCAAGAAGG + Intergenic
1175060739 20:56239955-56239977 AAATATTGCCTGAGAAAAGATGG - Intergenic
1175158528 20:56990834-56990856 CAAGATTCCCAGAGGAGGGAGGG + Intergenic
1175728774 20:61337857-61337879 CAGAATTACCAGAGGAAAGAAGG - Intronic
1177403224 21:20633426-20633448 CAATATTTCCTGAGGTAAGCAGG - Intergenic
1177611946 21:23461409-23461431 CAAAATTACCAGAGGCAAAGAGG - Intergenic
1177800918 21:25827872-25827894 CAACATAATCAGAGGAAAAATGG - Intergenic
1179229543 21:39489037-39489059 CAAGAAGACCAGAGGGAAGAAGG + Intronic
1179438115 21:41375826-41375848 CATTACTACTAGAGGAAAGGGGG + Intronic
1181315553 22:21968743-21968765 AAATATTTCCAGGGGAAATACGG - Exonic
949204100 3:1417269-1417291 CCATATCACCAGTGGAATGAAGG + Intergenic
950478609 3:13230194-13230216 CATTATTACCCGAAGAAAGATGG + Intergenic
950978676 3:17278119-17278141 CAAGTTTACCAGAGGAATGTGGG + Intronic
951081768 3:18458585-18458607 AATTATTTCCAGAGGAAAGGGGG - Intergenic
951303257 3:21024706-21024728 CATTCTGACCAGAGGAGAGATGG - Intergenic
951652506 3:24966342-24966364 CAATTTTAACAAATGAAAGAAGG + Intergenic
951736431 3:25870378-25870400 CAAAATTACCAAAGGAATGTCGG + Intronic
951942662 3:28097619-28097641 CAATAGTAAAAGAGGAAAGGAGG - Intergenic
953471733 3:43173164-43173186 TAATATCCCCAGAGGAAATAAGG - Intergenic
954259150 3:49426162-49426184 CAATATACCAAGAGGGAAGAGGG - Intronic
955871995 3:63449092-63449114 CAGTATTGGGAGAGGAAAGAAGG + Intronic
957736839 3:84214550-84214572 CAAAAATAGCACAGGAAAGATGG + Intergenic
957928998 3:86853230-86853252 AAATATTCCCAGAGGAAGGGCGG + Intergenic
958488039 3:94736896-94736918 CAATATTTCCAGCAGGAAGATGG - Intergenic
958539270 3:95449241-95449263 CAATACAAGTAGAGGAAAGAAGG - Intergenic
958987703 3:100801651-100801673 CAATTTTCCTAGAGGCAAGATGG - Intronic
960197517 3:114787724-114787746 CAACATTTTCAGAGGAAAAAAGG + Intronic
962260993 3:133905814-133905836 TAACATTACCAGAGATAAGAAGG - Intergenic
963510459 3:146241410-146241432 GAAAATTACCAGAGATAAGAAGG + Intronic
964159274 3:153627187-153627209 CAAAATTAGAAGAGGAAATAAGG - Intergenic
964240808 3:154591943-154591965 CAATATTGTTAGATGAAAGAGGG - Intergenic
965532567 3:169788603-169788625 TAATAATACCAGAGGAAATTTGG - Exonic
968054608 3:195681788-195681810 CAAAGTTACCAGAGGGAAAAAGG - Intergenic
968101283 3:195967370-195967392 CAAAGTTACCAGAGGGAAAAAGG + Intergenic
968257163 3:197286329-197286351 CAATTTTTCCACAGAAAAGAGGG + Intronic
968838972 4:2986792-2986814 CAATAGTACTAAAGGAAAGATGG - Intronic
969735038 4:8982506-8982528 CAATATTCACAAAGGAAATACGG - Intergenic
971278490 4:25220851-25220873 CAACATTACCAAAGAAAAGTTGG + Intronic
971612540 4:28744172-28744194 TTATGTTAACAGAGGAAAGAAGG - Intergenic
972345788 4:38191194-38191216 CAAGACTGACAGAGGAAAGAAGG + Intergenic
972412050 4:38805192-38805214 CACTATTAAAAGTGGAAAGAGGG + Intronic
973768666 4:54187149-54187171 CAATATTACCAGATAAAAGTGGG - Intronic
975832769 4:78387404-78387426 CCACATTAGCAGAGGAGAGAGGG + Exonic
976483309 4:85570169-85570191 CAATATGCCCAGAGGAAACGTGG - Intronic
977523354 4:98113480-98113502 AAATATTCCTAGAGGAAATAAGG - Intronic
978116718 4:105027605-105027627 CCATGTTACTAGAGGAAAGGAGG + Intergenic
980349763 4:131669803-131669825 GAATATTTTCAGAGGAAGGAAGG - Intergenic
981310675 4:143295045-143295067 CTATAATACCAGGGGAAAAAAGG + Intergenic
981733675 4:147926338-147926360 GAATATTTGCAGTGGAAAGAAGG + Intronic
984030296 4:174596133-174596155 CAATATCAACAGAGGAAAGTGGG - Intergenic
984357223 4:178677470-178677492 CAATATTTCAAGAGGAAACTTGG + Intergenic
985270308 4:188188096-188188118 AAAAATTAACAGAGGAAAGTGGG - Intergenic
986057926 5:4157592-4157614 CAAATATACCAGAGCAAAGAAGG - Intergenic
986615600 5:9614002-9614024 CAACACTGCTAGAGGAAAGATGG + Intergenic
986957229 5:13167608-13167630 GTATGTTACCAGAGGAAAGTTGG + Intergenic
989811113 5:45676787-45676809 CAATCATAACAGAGGAAAAATGG + Intronic
990843706 5:60112887-60112909 CAAAATTTCCAGAAGAGAGAAGG + Intronic
993268394 5:85760644-85760666 AGAAATTAGCAGAGGAAAGAAGG + Intergenic
993678180 5:90842800-90842822 GAAAATAACCAGAGCAAAGAAGG - Intronic
994204065 5:97013073-97013095 CATTATGGCTAGAGGAAAGAGGG - Intronic
994704746 5:103188953-103188975 CAATATTAAAAAAGGAAAAAAGG - Intronic
994791913 5:104238240-104238262 GAATATTAGCAGATTAAAGAAGG + Intergenic
994934145 5:106231547-106231569 TAATTTTACCATAGGAAAAATGG + Intergenic
997802189 5:136874802-136874824 GAATATTGCCACAGGAAACAGGG + Intergenic
1001291663 5:170467471-170467493 CTTTACTACCAGTGGAAAGAAGG + Intronic
1002669239 5:180852198-180852220 TGAAATTACCAGAGAAAAGATGG + Intronic
1003216616 6:4119086-4119108 CCATATTACCAAGGGAAAGAAGG + Intronic
1003569987 6:7249453-7249475 GTAAATGACCAGAGGAAAGATGG + Exonic
1003849110 6:10203712-10203734 GAACATTAGCAGAGGAAAAAAGG - Intronic
1005658612 6:27969046-27969068 CAATTTTACCAGAAAAAAAATGG + Intergenic
1006052089 6:31353013-31353035 CATTATAACCAGAGTAAGGAAGG - Intronic
1007351368 6:41275940-41275962 CAAGATTATTAGAGGAACGAGGG + Exonic
1008578587 6:52884652-52884674 CATTATTACAAGAAGAAAGTGGG - Intronic
1009737739 6:67699902-67699924 AAATATTAGCTGAGGAAAAAAGG + Intergenic
1010068017 6:71708824-71708846 CAATTTTACCAAATGATAGAGGG - Intergenic
1012491800 6:99790068-99790090 CCATATTAAAGGAGGAAAGAGGG + Intergenic
1016350467 6:143161655-143161677 CCATATTAACAGAATAAAGAGGG + Intronic
1017489184 6:154929647-154929669 TGATATTACCAGAGGTAAAAGGG + Intronic
1017518795 6:155183164-155183186 AAATATTTTCAGATGAAAGAAGG - Intronic
1020863867 7:13531367-13531389 AAATATTAGTAGAGAAAAGAAGG - Intergenic
1022048209 7:26640270-26640292 CAATAGTAACAGTGGAAACATGG + Intronic
1022048415 7:26642286-26642308 CAATATTAACAATGGAAACATGG - Intronic
1022587658 7:31630194-31630216 CTAAATTACCAGAGGAAAAGAGG + Intronic
1022743820 7:33149265-33149287 CCACAGTGCCAGAGGAAAGAAGG + Intronic
1023535305 7:41202627-41202649 CAAAATTACCAGAGTTGAGATGG - Intergenic
1023996120 7:45159950-45159972 CAATATGACCACAGGTAACATGG - Intronic
1024052460 7:45636072-45636094 AAATATTACCAGAATAAAGAAGG - Intronic
1027547512 7:79546860-79546882 CAATATTTTTAGAGGAGAGATGG + Intergenic
1027628332 7:80571662-80571684 TAAAACTACCAGAAGAAAGATGG - Intronic
1027778396 7:82493600-82493622 CAATATTACCTGATGATAGGTGG - Intergenic
1029025401 7:97411964-97411986 CAATATTCCAAGAGGGAAGTGGG + Intergenic
1029054690 7:97729622-97729644 CATTATTAATATAGGAAAGATGG - Intergenic
1030141177 7:106305410-106305432 AAAAGTTGCCAGAGGAAAGAGGG + Intergenic
1030304980 7:108008658-108008680 CAATGTTACCAGATGAAGGGAGG - Intergenic
1030489927 7:110219486-110219508 CATTATAACCAGAGGAACTACGG - Intergenic
1031399148 7:121310828-121310850 AAAGATAACCAGAGGAAAAAAGG + Intergenic
1031716163 7:125111089-125111111 CAATATTTCCCGAGAACAGAAGG - Intergenic
1033380204 7:140809488-140809510 GAATATTCCCAGAGGAAACAGGG - Intronic
1033545998 7:142400597-142400619 CCATTTTACAAAAGGAAAGAGGG - Intergenic
1034476109 7:151283277-151283299 CCATATTAACAGATGGAAGAAGG + Intergenic
1036185216 8:6616720-6616742 CACCATTAGCAGAGGAAAGCTGG + Intronic
1037895706 8:22652923-22652945 CAACCATACCAGAGGAAAGAGGG - Intronic
1039733805 8:40308166-40308188 CAATATTTGGAGAGGACAGAAGG + Intergenic
1040621697 8:49099157-49099179 CAATATTAGTAGAAGAAAGTAGG + Intergenic
1041640771 8:60198787-60198809 AAATATTTCCATAGGAAATAAGG - Intronic
1041858865 8:62488323-62488345 CAGAATTAGCAGAGGAAAGAAGG - Intronic
1042690264 8:71490548-71490570 CAATATTTATAGAGAAAAGATGG + Intronic
1042692317 8:71514672-71514694 CAAGAATAGCACAGGAAAGATGG + Intronic
1042782688 8:72509635-72509657 CAGTATTGCCTCAGGAAAGAAGG + Intergenic
1045229990 8:100295468-100295490 CAATATTAGCAGATAAAAGGTGG + Intronic
1046036293 8:108845401-108845423 CAATATTATCAGATGAAAAACGG + Intergenic
1046675056 8:117098728-117098750 CAGTATTACCAAAGAACAGAGGG - Intronic
1047823193 8:128543951-128543973 CAATATTCCCAAAGGAGAGTGGG + Intergenic
1049516035 8:143057170-143057192 GAATATTACCAGAAAAAAGGGGG - Intronic
1050415524 9:5412672-5412694 CAAAAGTACCACAGGAAACAAGG + Intronic
1050470530 9:5984510-5984532 CAATATTACCAGGGATAAAAAGG + Intronic
1050631359 9:7561948-7561970 CATTTTTCCAAGAGGAAAGATGG + Intergenic
1050895744 9:10884838-10884860 CAAGATAACCAAATGAAAGAGGG + Intergenic
1051206116 9:14691053-14691075 CAATACTACCAGGCAAAAGAGGG - Intronic
1051766676 9:20532548-20532570 CAAGGTTCCCAAAGGAAAGAAGG + Intronic
1052634973 9:31091139-31091161 AAATATCACCAGAGGTAATAAGG - Intergenic
1053783006 9:41630269-41630291 GAATATTTTCAGAGGAAGGAAGG + Intergenic
1054170959 9:61840411-61840433 GAATATTTTCAGAGGAAGGAAGG + Intergenic
1054666577 9:67740401-67740423 GAATATTTTCAGAGGAAGGAAGG - Intergenic
1055448877 9:76412150-76412172 CAATAATACCAGAGACAGGAGGG - Intergenic
1058501845 9:105627270-105627292 CACTATTAAGAGAGTAAAGAAGG - Intronic
1059979649 9:119756972-119756994 CAAAATTATCAGAAGAAAGGAGG - Intergenic
1060379724 9:123156336-123156358 TAATATTACTTGAGGAATGAAGG - Intronic
1187747228 X:22422591-22422613 CCATATTACCAATGGAGAGATGG - Intergenic
1188379529 X:29473983-29474005 CAATATTATTAGAGGAAATGAGG - Intronic
1191184735 X:57597305-57597327 AAATATTTCCAGAGCAAAGAGGG - Exonic
1193031802 X:76906858-76906880 AAATATTTGCACAGGAAAGATGG - Intergenic
1193987009 X:88254783-88254805 CAATATTACCTCAAAAAAGAGGG - Intergenic
1194164574 X:90498979-90499001 CATTATTAAAACAGGAAAGAGGG + Intergenic
1195255686 X:103087588-103087610 TACTTTTACCAGAGGAAAGATGG + Intronic
1197316814 X:124976760-124976782 CTACATAACCAGATGAAAGAGGG + Intergenic
1197401559 X:125998113-125998135 CAATTTTAACTGAGGCAAGAAGG + Intergenic
1197875695 X:131103126-131103148 CAATATTACCAGGGATAAAAGGG - Intergenic
1199767000 X:150948590-150948612 AAAAAAAACCAGAGGAAAGAGGG + Intergenic
1199864940 X:151836315-151836337 CAAAGTTACCAAAGGAAGGATGG + Intergenic
1200510833 Y:4076774-4076796 CATTATTAAAACAGGAAAGAGGG + Intergenic
1201057025 Y:10004222-10004244 TAAAATGAGCAGAGGAAAGATGG - Intergenic
1202067999 Y:20960515-20960537 GGATCTTGCCAGAGGAAAGAAGG + Intergenic