ID: 923377949

View in Genome Browser
Species Human (GRCh38)
Location 1:233384711-233384733
Sequence GTGTTTGCATGTGTGTGTTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5366
Summary {0: 1, 1: 7, 2: 81, 3: 1077, 4: 4200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923377949 Original CRISPR GTGTTTGCATGTGTGTGTTG GGG Exonic
Too many off-targets to display for this crispr