ID: 923380237

View in Genome Browser
Species Human (GRCh38)
Location 1:233410466-233410488
Sequence TGTAAGCTGTAGTAGATGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923380234_923380237 14 Left 923380234 1:233410429-233410451 CCTTTTATTTCTAACTTCCACTG No data
Right 923380237 1:233410466-233410488 TGTAAGCTGTAGTAGATGTTTGG No data
923380236_923380237 -3 Left 923380236 1:233410446-233410468 CCACTGGAAAATTGTATAAATGT No data
Right 923380237 1:233410466-233410488 TGTAAGCTGTAGTAGATGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923380237 Original CRISPR TGTAAGCTGTAGTAGATGTT TGG Intergenic
No off target data available for this crispr