ID: 923380327

View in Genome Browser
Species Human (GRCh38)
Location 1:233411184-233411206
Sequence TCAACAGATGGGCCCAAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923380327_923380335 25 Left 923380327 1:233411184-233411206 CCAAGTTTGGGCCCATCTGTTGA No data
Right 923380335 1:233411232-233411254 CATCTATAGCTCCAAGGCACTGG No data
923380327_923380339 29 Left 923380327 1:233411184-233411206 CCAAGTTTGGGCCCATCTGTTGA No data
Right 923380339 1:233411236-233411258 TATAGCTCCAAGGCACTGGGGGG No data
923380327_923380340 30 Left 923380327 1:233411184-233411206 CCAAGTTTGGGCCCATCTGTTGA No data
Right 923380340 1:233411237-233411259 ATAGCTCCAAGGCACTGGGGGGG No data
923380327_923380330 -5 Left 923380327 1:233411184-233411206 CCAAGTTTGGGCCCATCTGTTGA No data
Right 923380330 1:233411202-233411224 GTTGACTCTCAACTGACCACAGG No data
923380327_923380334 19 Left 923380327 1:233411184-233411206 CCAAGTTTGGGCCCATCTGTTGA No data
Right 923380334 1:233411226-233411248 CCTTCTCATCTATAGCTCCAAGG No data
923380327_923380337 27 Left 923380327 1:233411184-233411206 CCAAGTTTGGGCCCATCTGTTGA No data
Right 923380337 1:233411234-233411256 TCTATAGCTCCAAGGCACTGGGG No data
923380327_923380338 28 Left 923380327 1:233411184-233411206 CCAAGTTTGGGCCCATCTGTTGA No data
Right 923380338 1:233411235-233411257 CTATAGCTCCAAGGCACTGGGGG No data
923380327_923380336 26 Left 923380327 1:233411184-233411206 CCAAGTTTGGGCCCATCTGTTGA No data
Right 923380336 1:233411233-233411255 ATCTATAGCTCCAAGGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923380327 Original CRISPR TCAACAGATGGGCCCAAACT TGG (reversed) Intergenic
No off target data available for this crispr