ID: 923384719

View in Genome Browser
Species Human (GRCh38)
Location 1:233454745-233454767
Sequence TCTCCAGGCTGGTCTCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923384715_923384719 29 Left 923384715 1:233454693-233454715 CCTGAACAAGGTAGGGAAAATTG No data
Right 923384719 1:233454745-233454767 TCTCCAGGCTGGTCTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923384719 Original CRISPR TCTCCAGGCTGGTCTCCTTG AGG Intergenic