ID: 923385182

View in Genome Browser
Species Human (GRCh38)
Location 1:233459324-233459346
Sequence CCGGGCTTGGCCAGGCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923385182_923385188 -1 Left 923385182 1:233459324-233459346 CCACTGAGCCTGGCCAAGCCCGG No data
Right 923385188 1:233459346-233459368 GAGTTTTGAGTCTCAATGTCAGG No data
923385182_923385192 15 Left 923385182 1:233459324-233459346 CCACTGAGCCTGGCCAAGCCCGG No data
Right 923385192 1:233459362-233459384 TGTCAGGGAGATAGTGGACAGGG No data
923385182_923385189 0 Left 923385182 1:233459324-233459346 CCACTGAGCCTGGCCAAGCCCGG No data
Right 923385189 1:233459347-233459369 AGTTTTGAGTCTCAATGTCAGGG No data
923385182_923385191 14 Left 923385182 1:233459324-233459346 CCACTGAGCCTGGCCAAGCCCGG No data
Right 923385191 1:233459361-233459383 ATGTCAGGGAGATAGTGGACAGG No data
923385182_923385193 19 Left 923385182 1:233459324-233459346 CCACTGAGCCTGGCCAAGCCCGG No data
Right 923385193 1:233459366-233459388 AGGGAGATAGTGGACAGGGAAGG No data
923385182_923385190 9 Left 923385182 1:233459324-233459346 CCACTGAGCCTGGCCAAGCCCGG No data
Right 923385190 1:233459356-233459378 TCTCAATGTCAGGGAGATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923385182 Original CRISPR CCGGGCTTGGCCAGGCTCAG TGG (reversed) Intergenic
No off target data available for this crispr